Cell culture and treatment
MDA-MB-468, SUM149PT, MCF-7, SKBR3, MCF-10A cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and routinely cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, U.S.A.) supplemented with 10% fetal bovine serum (FBS, LifeTechnologies, Inc., USA) in a humidified cell incubator at 37℃ with 5% CO2.
Cell transfection
Cells were transduced with small interference RNA (siRNA) specifically targeting UBE2T (si-UBE2T) as well as their corresponding negative control, UBE2T overexpression vector (UBE2T) and empty vector (pcDNA3.1) were purchased from GenePharma (Shanghai, China). For transfection, cells were plated into six-well plates and transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The sequences were used as follows: UBE2T siRNA-1: 5′-TTGTCTGGATGTTCTCAAATT-3′, siRNA-2: 5′-CTCCTCAGATCCGATTTCT-3′, siRNA-3: 5′-GCTGCTCATGTCAGAACCCAA-3′.
Cell Counting Kit 8 (CCK8) assay
Cell viability was detected by MTT assay. MCF-7 cells (1 × 105 cells/well) were seeded in 96-wells plate and cultured for 24 h, 48 h and 72 h. Then, cell viability was examined by CCK-8 kit (Beyotime Biotechnology, China). In brief, 50 µL of CCK-8 solution was added into each well and incubated at 37°C for 4 h. The absorbance value was measured by a microplate reader at 490nm wavelength. The experiment was repeated for three times.
Transwell assay
Cells were collected and plated the upper chamber (Corning) coated with (invasion) or without (migration) Matrigel (0.1%, Millipore, MO, USA). 1 × 105 cells in serum-free medium in the upper chamber of transwell. Culture medium containing 20% FBS was supplemented into the lower chamber. Following 24 h incubation, the non-migrated and non-invading cells were removed. At last, cells were fixed with 4% formaldehyde and stained using crystal violet. Cells were counted under a microscope (Olympus, Tokyo, Japan) at 200× magnification. The number of cells was the average value from six representative fields. The migratory or invaded cells were counted and photographed under a light microscope (Nikon, Tokyo).
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay
Total RNA extraction was harvested utilizing TRIzol (Invitrogen). RNA quantification were amplified and detected on ABI PRISM 7900 Real-time PCR system (Applied Biosystems). The reaction conditions were as follows: 94℃ 3 min, 94℃ 30s, 56℃ 40 s, 72℃ 30 s, a total of 32 cycles, and finally extended at 72℃ for 10min. GAPDH used for normalization and the relative expression level was calculated by the 2−ΔΔCt method. The primers were as followed: UBE2T: 5′-GGCAAGATAAAGACCAAATGGA-3′ (Forward), 5′-CCTACTAGCTGACTGGCCTT-3′ (Reverse); E-cadherin: 5′-CGATTCAAAGTGGGCACAGATG-3′ (Forward), 5′-GTAGG TGGAGTCCCAGGCGTAG-3′ (Reverse); Vimentin: 5′-TCTGGATTCACTCCCTCTGGTT-3′ (Forward), 5′-ATCGTGATGCTGAGAAGTTTCGT-3′ (Reverse). GAPDH: 5′-GAAGGTGAAGGTCGGAGTC-3′ (Forward) and 5′- GAAGATGGTGATGGGATTTC -3′ (Reverse).
Western blot analysis
Total protein was extracted from cells using ice-cold RIPA lysis buffer (Beyotime Bitechnology, China). The concentration was estimated through a BCA protein assay kit (Beyotime Bitechnology, China). Equivalent samples (20 mg) were separated by 10% SDS-PAGE, and then transferred onto a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). Subsequently, the membrane was blocked utilizing non-fat milk for 2 h and incubated with the following primary antibodies overnight at 4℃, including E-cadherin (ab231303, 1: 1, 000, abcam), N-cadherin (ab76057, 1: 1, 000, abcam), β-catenin (ab68183, 1: 1, 000, abcam), p-GSK-3β (ab93926, 1: 1, 000, abcam), GSK-3β (ab32391, 1: 1, 000, abcam), GAPDH (ab128915, 1: 1, 000, abcam). Then the membrane was washed three times with PBST. Then the membrane was cultured with HRP adjusted second antibody for about 2 h at room temperature. Protein bands were visualized with Enhanced Chemiluminescence Detection Kit (Thermo Fisher Scientific, USA) and the density of the bands was quantified by ImageJ software. GAPDH was used as the loading control.
Statistical analysis
Graphpad prism 8.0 (GraphPad, San Diego, CA, USA) was applied for statistical analysis. Data are presented as the mean ± standard deviation (SD). Comparisons between two groups were determined using Student’s t-test. One-way ANOVA analysis followed by Turkey’s poc host was used for multiple comparisons. P < .05 meant statistically significant.