Role and Expression of Annexin IV (ANXA4) and Matrix-remodeling Associated 5 protein (MXRA5) in connective tissue remodeling of placenta in preeclampsia.

doi:10.21203/rs.3.rs-3802052/v1

Objective:

To evaluate the expression of Annexin IV (ANXA4), Matrix-remodelling associated 5 (MXRA5), and Tissue inhibitor metalloproteinase 2 (TIMP2) level in connective tissue remodelling of placenta in women with preeclampsia.

Methods:

Forty-eight pregnant women complicated by preeclampsia, their age range from 20 to 40 years, in addition to 48 age and sex matched normotensive pregnant women served as control group were enrolled in the study. The placental samples in this study were obtained by cesarean section, frozen immediately in liquid nitrogen, and stored at − 80°C till time of assay for subsequent RNA and protein biochemical measurements.

Results:

There was statistically significant decrease in mean ANXA4 among cases compared to controls. Additionally, there was statistically significant decrease in mean MXRA5 among cases compared to controls (p < 0.001 for both). There was statistically significant decrease in mean MXRA5 among patients with severe PE compared to mild PE (p < 0.001). A statistically significant moderate positive correlation between ANXA4 and MXRA5 (r = 0.571, p < 0.001) in total sample, and the degree of correlation increased to 0.732 among cases when stratified the groups to cases and controls. There was a statistically significant lower mean difference of pAKT-ELIZA among PE patients (0.29 ± 0.04) compared to controls (0.56 ± 0.14, p < 0.001).

Conclusions:

In pre-eclampsia patients, there was a statistically significant positive correlation between the pAKT protein level and ANXA4 and MXRA5 compared to controls. Reduced MXRA5 expression is a more sensitive biomarker for predicting the severity of PE compared to ANXA4.

Preeclampsia

ANXA4

MXRA5

TIMP2

Placenta

Preeclampsia (PE) is a severe pregnancy-specific illness that manifests after 20 weeks of pregnancy and is marked by newly developed hypertension and proteinuria [1]. Two to eight percent of all pregnancies are affected by preeclampsia [2] It continues to be a leading factor in maternal and fetal morbidity and mortality, especially in Underdeveloped nations which experience PE seven times more frequently than developed nations do [3, 4].

Although the exact mechanism of PE is still unknown, defective trophoblast invasion, apoptosis, and impaired remodeling of spiral arteries[5–8] are the major causes of PE-associated impaired placentation [9, 10].

MXRA5 (matrix-remodeling associated 5), is one member of the MXRA (matrix-remodeling associated) family that is made up of three genes (MXRA5, MXRA7, and MXRA8). MXRA5 is sometimes called adhesion protein with leucine-rich repeats and immunoglobulin domains related to perlecan [11]. It may contribute to matrix remodeling and cell adhesion [12]. Thus, it was shown that MXRA5 expression was downregulated in the placentas of preeclamptic patients[9]. The involvement of MXRA5 mutation in matrix remodeling and cell invasion has been linked to non-small cell lung cancer (NSCLC) and colorectal cancer (CRC) [13, 14]. Moreover, MXRA5 has anti-inflammatory and anti-fibrotic characteristics in response to treatment with transforming growth factor-1 (TGF-1) in chronic renal disease[15]. However, the precise function of MXRA5 in the pathophysiology of preeclampsia is still unclear.

Annexin IV (ANXA4) binds to the plasma membrane in a Ca2-dependent manner and regulates its downstream signaling transduction, including phosphoinositide 3-kinase (PI3K)/Akt signaling. It has been shown to participate in the regulation of cellular growth, invasion, and apoptosis[16, 17]. Thus, tumor cells, including ovarian clear cell adenocarcinoma cells, experience reduced cell migration and invasion when ANXA4 is knocked down[18]. Additionally, it has been shown that, in comparison to normal placentas, the expression of ANXA4 was downregulated in PE placentas [19].

The role of matrix metalloproteinases (MMPs) in the pathogenesis of preeclampsia has been given much attention in recent years. It includes at least 28 different enzymes of zinc-dependent endopeptidases that hydrolyze the extracellular matrix [20, 21]. Particularly important for the effective cytotrophoblast invasion during the early stages of pregnancy are MMP-2 and MMP-9, which are regarded as essential enzymes for the basement membrane's degradation[22]. These extra-cellular matrix remodeling enzymes, balanced by their tissue inhibitors (TIMP), are essential effectors of developmental processes including cell migration, cell proliferation, apoptosis tissue morphogenesis and tumor progression[23, 24].

The PI3K/Akt signaling pathway is involved in cell proliferation, migration, metastasis, and invasion [25, 26]. A previous study has suggested that the PI3K/Akt pathway is activated in PE placentas to regulate cell proliferation [27, 28].

To verify our theory, we tested the expression of ANXA4, MXRA5, TIMP2, expression level in human PE placentas. Also, we investigated how these genes expression affected trophoblast cells' proliferation, invasion, and apoptosis, mediated by MAPK pathway by correlating them with pAkt protein levels.

Study population

This study is a case control study conducted at the Gynecology and Obstetrics Department, Assiut Woman's Health Hospital, Egypt and the Medical Biochemistry Department, Faculty of Medicine, Assiut university, Egypt. Forty-eight pregnant women complicated by PE, their age range from 20 to 40 years, in addition to 48 age and sex matched normotensive pregnant women served as control group were enrolled in the study.

Patients were diagnosed with PE as their blood pressure was higher than 140/ 90 mm Hg at two different occasions, with urinary excretion of > 300 mg protein per 24 h. Among them, 30 patients developed severe PE according to systolic blood pressure (SBP) ≥ 160 mmHg and/or diastolic blood pressure (DBP) ≥ 110 mmHg and proteinuria > 300 mg/24 h and 18 with mild PE.

Women who have gestational diabetes, pregestational hypertension, proteinuria, vaginal infection, major known fetal or chromosomal anomalies, multiple gestations, preterm labor, premature rupture of membranes, sepsis, fever, chronic renal disease, or any systemic illness were excluded from study. All women included in the study were delivered by elective cesarean section (CS).

Sampling

The placental samples in this study were obtained under sterile conditions after caesarean section. Tissue samples (4×6 cm) were removed from the central region of the placenta and rinsed with cold phosphate buffered saline (PBS), then quickly frozen and maintained at − 80°C until required for qPCR and protein biochemical measurements.

All samples were collected at the department of Obstetrics and Gynaecology; Assiut University hospital. Data on maternal anthropometric measures and medical history were gathered at the time of admission. The experimentation was conducted in Medical Biochemistry Department, and medical research center, faculty of medicine, Assiut University.

Collection and experimentation of human tissues reviewed and approved by the Ethical Committee of Faculty of medicine of Assiut university (IRB no:17300355). All study participants agreed to the sample collection and provided written informed consent.

Quantitative real-time PCR (qRT-PCR) analysis

The total RNA in placental tissue was isolated by using Quick-RNA™ MiniPrep kit (by ZYMO RESEARCH) (catalog No. R1055) following the manufacturer's instructions. After quantitation using Nanodrop spectrophotometer, RNA (500 ng) was used for reverse transcription to complementary DNA (cDNA) with the High-Capacity cDNA Reverse Transcription kit by (Thermo Fisher SCIENTIFIC USA) (catalog No, 4374967). cDNA was then amplified with Thermo Scientific Maxima SYBR Green qPCR Master Mix (2X) (Catalog No, #K0252).

Amplification used 40 cycles of PCR in the Applied Biosystems 7500 Real-Time PCR Detection System (Applied Biosystems, Germany). An initial denaturation cycle of 95°C for 10 min, followed by 40 amplification cycles of 95°C for 15 sec and 60°C for 1 min. Internal control GAPDH was used to normalize the gene expression (Table 1). Data were analyzed using the formula: R = 2^{− (Δ Ct sample − Δ Ct control)}.

Primers designed for the studied genes as follows:

	Forward	Reverse
MXRA5	CCTTGTGCCTGCCTGCTACGTCC	TTGGTCAGTCCTGCAAATGAG
ANXA4	GGACTGTATGAGGCTGGAGAG	TGCTCTGTTCAATGTCCTTCTG
TIMP2	AAGCGGTCAGTGAGAAGGAGTGG	CCTTGGAGGCTTTTTTGCAGTTG
GAPDH	GAGCTACGAGCT GCCTGACG	CCTAGAAGCATTTGCGGTGG

pAKT Elisa-kit

Determination of Level of pAKT in both patients and controls was determined by a commercially available sandwich enzyme-linked immunosorbent assay (ELISA) technique supplied by SinoGene Clon Biotech Co., Ltd. (catalog no. SG-16318) according to manufacturer's protocol.

ELISA plate was read at an absorbance of 450 nm using an ELISA plate reader. The concentration of pAKT in the samples were then determined by comparing the optical density of the samples to the standard curve. The detection range is 0.05 ng/ml to 4 ng/ml.

Statistical analysis

Data was analyzed using Statistical Package for Social Science (SPSS), version 26.0 for Windows. Quantitative data tested for normality by Shapiro-Wilk test data, expressed as mean ± SD or median and range according to normality of data, qualitative data were expressed as frequencies and percentages.

Independent Sample T-test/ Mann Whitney U test was used to compare mean/median difference between two independent groups, while One way ANOVA/ Kruskal Wallis were used to compare mean/median difference between more than two groups. Chi square/Fisher Exact tests were used to compare proportion between groups.

Spearman correlation was used to explore the correlation between the three groups and other variables. Roc curve analysis was done to identify diagnostic ability of biomarkers in prediction of preeclampsia, area under curve, sensitivity, specificity, positive predictive value, and negative predictive value were calculated. The level of significance was considered at P value < 0.05.

Table (1) shows the demographic criteria of the study participants. No statistically significant difference between both groups.

Table (2) shows the difference in laboratory data between patients with mild and severe PE. Apart from serum bilirubin level, there was statistically significant difference in all results between both groups.

Regarding ANXA4, there was statistically significant decrease in mean ANXA4 among cases compared to controls. Additionally, there was statistically significant decrease in mean MXRA5 among cases compared to controls (p < 0.001 for both). However, there was no statistically significant difference in mean TIMP2 between cases and controls (Table 3).

There was statistically significant decrease in mean MXRA5 among patients with severe PE compared to mild PE (p < 0.001). On the other hand, there was no statistically significant difference in mean ANXA4 and TIMP2 between mild and severe PE (Table 4).

Table 5 shows statistically significant moderate positive correlation between ANXA4 and MXRA5 (r = 0.571, p < 0.001) in total sample, and the degree of correlation increased to 0.732 among cases when stratified the groups to cases and controls. No statistically significant correlation between TIMP2 in relation to ANXA4 and MXRA5

Table 6 shows no statistically significant correlation between ANXA4, MXRA5, TIMP2 and other characteristics of patients with preeclampsia (age, systolic, diastolic BP, weight, height, and BMI).

Table 7 shows the correlation between studied genes (ANXA4, MXRA5 and TIMP2) and other laboratory data in patients with PE. Regarding ANXA4, there were statistically significant moderate negative correlation between ANXA 4, PT (r =-0.439, p = 0.002), INR (r= -0.475, p = 0.001), urea (r=-0.482, p = = 0.001), strong negative correlation in creatinine (r=-0.871, p < 0.001). Moreover, there were statistically significant positive moderate correlation between ANXA4, total protein (r = 0.407, p = 0.004), mild in PC (r = 0.313, p = 0.030), and albumin (r = 0.351, p = 0.015).

Regarding MXRA5, there were statistically significant moderate negative correlation between MXRA5, PT (r= -0.410, p = 0.008), INR (r= -0.471, p = 0.001), urea (r=-0.524, p < 0.001), strong correlation negative in creatinine (r=-0.802, p < 0.001), ALT (r=-0.401, p = 0.006), and AST (r=-0.401, p = 0.011). Moreover, there were statistically significant positive moderate correlation between MXRA5, PC (r = 0.539, p < 0.001), platelets (r = 0.450, p = 0.001), total protein (r = 0.421, p = 0.003), and albumin (r = 0.467, p = 0.001).

There was a statistically significant lower mean difference of pAKT-ELIZA among PE patients (0.29 ± 0.04) compared to controls (0.56 ± 0.14, p < 0.001). Moreover, there was statistically significant positive moderate correlation among patients with PE between pAKT serum level and ANXA4 (r = 0.407, p = 0.004), and MXRA5 (r = 0.430, p = 0.005) (Fig. 1).

Figure (2) shows the ROC curve for ANXA4, MXRA5 and TIMP2 for prediction of pre-eclampsia in comparison to controls. Regarding ANXA4, it has an accuracy of 81.5%, sensitivity 95.8%, specificity 66.7%, positive predictive value 74.2% and negative predictive value 94.1% for prediction of PE (p < 0.001). Regarding MXRA5, it has an accuracy of 94.0% sensitivity 91.7%, specificity 95.8%, positive predictive value 95.7% and negative predictive value 92.0% for prediction of PE (p < 0.001) (Table 8).

Additionally, figure (3) shows the ROC curve of ANXA4, MXRA5 and TIMP2 for prediction of severe PE in comparison to mild PE. ANXA4 had an accuracy of 75.5%, sensitivity 73.3%, specificity 77.8%, positive predictive value 84.6% and negative predictive value 63.9% in prediction of severe PE (p < 0.001). While MXRA5 had an accuracy of 95.5%, sensitivity 96.7%, specificity 94.4%, positive predictive value 96.7% and negative predictive value 94.4% in prediction of severe PE (p < 0.001) (Table 9).

PE is primarily brought on by inadequate spiral artery remodeling, faulty trophoblast invasion, trophoblast apoptosis, defective matrix remodeling and cell adhesion [12]. Our study observed that MXRA5 expression was down regulated in placentas of patients with preeclampsia compared to controls, this occurs in accordance with the study of Ding, Lan et al. that also found a down regulation of gene expression [29]. Cytotrophoblast function may be strongly impacted by MXRA5, a gene involved in modifying the extracellular matrix. So, its expression greatly affects function and integrity of placenta.

Two possible mechanisms exist for MXRA5 to control trophoblast cell migration and invasion activation: the first is enhancing the stability of other receptors, such as EGFR and PDGF, as a structural matrix protein and facilitating signaling transduction; and the second is directly influencing the MAPK protein structure in the cytoplasm [30].

MXRA5 dysregulation affect MAPK signaling pathway, which would affect trophoblast cell survival and invasion [29, 30]. This is supported by the finding of our study which showed a positive correlation between MXRA5 expression and serum pAKT level, a member in MAPK pathway.

Moreover, pAKT level shown to be considerably lower in PE human placentas compared to placentas from normal pregnancies, according to Trojaneket al. [25]. This is matched by our findings, which show that preeclampsia patients' pAKT levels are considerably lower than those of healthy controls.

According to previous studies, activation of PI3K/Akt/eNOS pathways are crucial for controlling angiogenesis, averting hypertension, and regulating cell migration [31].Thus, the observed decrease in pAKT level in PE patients may be the key effector in poor trophoblast invasion and placentation required for healthy pregnancy.

ANXA4 which is a cell membrane protein may also activate the PI3K/Akt/eNOS signaling pathway to promote cell migration and invasion of trophoblast cells, thereby attenuating PE progression [32]. Our study's findings in accordance to previous studies showed that patients with PE had significantly lower levels of ANXA4 than healthy pregnant women but this decline in patients isn't strongly correlated with the severity of preeclampsia[19].

Due to its role in the vasodilatation process and relevance in preeclampsia, MMP-2 is regarded as being of fundamental importance in the development of hypertension[33]. Its levels were shown to be higher in the plasma of preeclamptic women, according to several earlier studies [40][41].

Studies on MMP-9 and MMP-2 serum levels in PE have varied, with some indicating a decrease in and others showing an increase [21]. Furthermore, scant research has been done on the serum concentrations of MMP-9, MMP-2, and the corresponding tissue inhibitors at various stages of gestation. According to previous research, TIMP expression and activity are downregulated during trophoblast cell invasion and differentiation[34]. Our study results on TIMP-2 level expression in PE patients compared to controls discovered neither significant changes in TIMP-2 levels nor association with severity of preeclampsia. Thereafter the role of TIMP-2 on pathogenesis of PE haven’t been elucidated yet.

Although the finding that MXRA5 regulates the expression of MMP-2 and MMP-9 from a prior study supports the idea that MXRA5 can cause trophoblast cell invasion [29]. The lack of a positive correlation between the two markers in our study between PE cases and controls, however, may have been caused by racial or ethnic differences between the study populations.

To the best of our knowledge, this is the first study to compare the roles of ANXA4 and MXRA5 in excluding cases and controls of PE, with MXRA5 outperforming ANXA4 in terms of accuracy (sensitivity: 96.7%, specificity: 94.4%). Furthermore, MXRA5 exhibits greater sensitivity than ANXA4 in distinguishing between severe and mild cases.

Three genes MXRA5, ANXA4, and TIMP2 activate the PI3K/Akt/eNOS pathways, which is essential for regulating angiogenesis and cell migration and acting alone or in concert for appropriate placentation. Thus, any dysregulation of their expression level in placenta could be the pathogenic factor for PE. In pre-eclampsia patients, there was a statistically significant positive correlation between the pAKT protein level and ANXA4 and MXRA5 compared to controls. Reduced MXRA5 expression is a more sensitive biomarker for predicting the severity of PE compared to ANXA4.

Acknowledgments

We are appreciative of the Medical Research Centre and Medical biochemistry Department, Assiut University for their technical assistance with data collection, sample collection and preparation.

Sources of funding

This work was supported by Assiut Faculty of Medicine Research Grant’s office, Assiut University

Conflicts of interest/Competing interests

The authors declare that they have no conflict of interest.

Ethics approval

The study protocol was approved by the Ethical Committee at Faculty of Medicine, Assiut University (approval no: IRB17300355).

Consent to participate.

All participants signed an informed consent before participation in the study.

Consent for publication

Participants have consented to the submission of data.

Availability of data and material

All related data and materials are available from the corresponding author upon request.

Code availability

Not applicable

Author Contribution

S.H and S.A. prepared the figures and performed the laboratory work. M.E supervised the laboratory work. A.S performed the statistical analysis. S.H and A.S. wrote the manuscript. All authors reviewed the manuscript.

Zakiyah N et al (2015) Pre-eclampsia Diagnosis and Treatment Options: A Review of Published Economic Assessments. PharmacoEconomics 33(10):1069–1082
Force UPST (2021) Aspirin Use to Prevent Preeclampsia and Related Morbidity and Mortality: US Preventive Services Task Force Recommendation Statement. JAMA 326(12):1186–1191
Steegers EA et al (2010) Pre-eclampsia Lancet 376(9741):631–644
Osungbade KO, Ige OK (2011) Public health perspectives of preeclampsia in developing countries: implication for health system strengthening. Journal of pregnancy, 2011
Chen H et al (2015) Long non-coding RNA MALAT-1 is downregulated in preeclampsia and regulates proliferation, apoptosis, migration and invasion of JEG-3 trophoblast cells. Int J Clin Exp Pathol 8(10):12718–12727
Longtine MS et al (2012) Villous trophoblast apoptosis is elevated and restricted to cytotrophoblasts in pregnancies complicated by preeclampsia, IUGR, or preeclampsia with IUGR. Placenta 33(5):352–359
Redman CW, Sargent IL (2005) Latest advances in understanding preeclampsia. Science 308(5728):1592–1594
Sircar M, Thadhani R, Karumanchi SA (2015) Pathogenesis of preeclampsia. Curr Opin Nephrol Hypertens 24(2):131–138
Yan YH et al (2013) Screening for preeclampsia pathogenesis related genes. Eur Rev Med Pharmacol Sci 17(22):3083–3094
Nirupama R et al (2021) Preeclampsia: Pathophysiology and management. J Gynecol Obstet Hum Reprod 50(2):101975
Walker MG, Volkmuth W (2002) Cell adhesion and matrix remodeling genes identified by co-expression analysis, vol 3. Gene Function & Disease, pp 109–112. 3–4
Busch S et al (2009) mTOR mediates human trophoblast invasion through regulation of matrix-remodeling enzymes and is associated with serine phosphorylation of STAT3. Exp Cell Res 315(10):1724–1733
Xiong D et al (2012) Exome sequencing identifies MXRA5 as a novel cancer gene frequently mutated in non–small cell lung carcinoma from Chinese patients. Carcinogenesis 33(9):1797–1805
Wang GH et al (2013) Identification of MXRA5 as a novel biomarker in colorectal cancer. Oncol Lett 5(2):544–548
Poveda J et al (2017) MXRA5 is a TGF-β1-regulated human protein with anti-inflammatory and anti-fibrotic properties. J Cell Mol Med 21(1):154–164
Lin LL, Huang HC, Juan HF (2012) Revealing the molecular mechanism of gastric cancer marker annexin A4 in cancer cell proliferation using exon arrays. PLoS ONE 7(9):e44615
Yao H et al (2016) The role of annexin A4 in cancer. Front Biosci (Landmark Ed) 21(5):949–957
Mogami T et al (2013) Annexin A4 is involved in proliferation, chemo-resistance and migration and invasion in ovarian clear cell adenocarcinoma cells. PLoS ONE 8(11):e80359
Xu Y et al (2019) ANXA4 promotes trophoblast invasion via the PI3K/Akt/eNOS pathway in preeclampsia. Am J Physiology-Cell Physiol 316(4):C481–C491
Mahameed S et al (2005) The effect of serum from women with preeclampsia on JAR (trophoblast-like) cell line. J Soc Gynecol Investig 12(6):e45–50
Chen J, Khalil RA (2017) Matrix Metalloproteinases in Normal Pregnancy and Preeclampsia. Prog Mol Biol Transl Sci 148:87–165
Nissi R et al (2013) Circulating matrix metalloproteinase MMP-9 and MMP-2/TIMP-2 complex are associated with spontaneous early pregnancy failure. Reprod Biol Endocrinol 11:2
Vu TH, Werb Z (2000) Matrix metalloproteinases: effectors of development and normal physiology. Genes Dev 14(17):2123–2133
Goldman S, Shalev E (2003) The role of the matrix metalloproteinases in human endometrial and ovarian cycles. Eur J Obstet Gynecol Reprod Biol 111(2):109–121
Lu Q et al (2016) TIPE2 Overexpression Suppresses the Proliferation, Migration, and Invasion in Prostate Cancer Cells by Inhibiting PI3K/Akt Signaling Pathway. Oncol Res 24(5):305–313
Peng X et al (2018) Oxyfadichalcone C inhibits melanoma A375 cell proliferation and metastasis via suppressing PI3K/Akt and MAPK/ERK pathways. Life Sci 206:35–44
Park JK et al (2010) Inhibition of the PI3K-Akt pathway suppresses sFlt1 expression in human placental hypoxia models in vitro. Placenta 31(7):621–629
Prast J et al (2008) Human chorionic gonadotropin stimulates trophoblast invasion through extracellularly regulated kinase and AKT signaling. Endocrinology 149(3):979–987
Ding L et al (2018) MXRA5 is decreased in preeclampsia and affects trophoblast cell invasion through the MAPK pathway. Mol Cell Endocrinol 461:248–255
Guo G et al (2015) Ligand-Independent EGFR Signaling. Cancer Res 75(17):3436–3441
Zhu X et al (2016) Knockdown of TACC3 inhibits trophoblast cell migration and invasion through the PI3K/Akt signaling pathway. Mol Med Rep 14(4):3437–3442
Zhu X et al (2016) Knockdown of TACC3 inhibits trophoblast cell migration and invasion through the PI3K/Akt signaling pathway. Mol Med Rep 14(4):3437–3442
Trojanek JB (2015) Role of matrix metalloproteinases and tissue inhibitors of metalloproteinases in hypertension. Pathogenesis of hypertension and obesity. Postepy Biochem 61(4):356–363
Di Simone N et al (2007) Low-molecular Weight Heparin Induces In Vitro Trophoblast Invasiveness: Role of Matrix Metalloproteinases and Tissue Inhibitors. Placenta, 28(4): p. 298–304

Table (1): characteristics of patients with preeclampsia and controls

Variables	Preeclampsia (n= 48)	Controls (n =48)	P-Value
Age (years)
Mean ± SD	27.29±5.77	26.79±5.76	0.672
Residence
Urban	0	2 (4.2%)	0.495
Rural	48 (100.0%)	46 (95.8%)	0.495
Education
Illiterate	12 (25.0%)	14 (29.2%)	0.290
Primary	2 (4.2%)	8 (16.7%)
Preparatory	14 (29.2%)	12 (25.0%)
Secondary/technical	14 (29.2%)	10 (20.8%)
Higher	6 (12.5%)	4 (8.3%)
Blood pressure
Systolic	155.83±9.63	114.17±8.20	0.221
Diastolic	96.67±4.76	75.83±7.09	0.221
Anthropometric measures
Weight (Kg)	82.83±13.17	78.72±9.91	0.088
Height (cm)	159.37±6.56	157.66±7.81	0.249
BMI	32.90±6.65	31.79±4.44	0.341

Data were expressed as frequency and % or mean ± SD.

*Chi square/Fisher Exact tests was used to compare proportion between groups, independent Sample T test was used to compare mean between groups

Table (2): comparison of laboratory data between mild and sever preeclampsia.

Variables	Mild (n= 18)	Sever (n =30)	P-Value
Hb (g/dl) (Mean ± SD)	10.92±1.115	11.85±1.914	0.066
Platelets (10 ³/ul) (Mean ± SD)	229.33±56.85	169.09±61.75	0.002
PT (sec) (Mean ± SD)	11.18±0.38	11.26±0.78	0.698
PC (%) (Mean ± SD)	129.45±16.32	112.79±16.80	0.002
INR (Mean ± SD)	0.90±0.04	0.93±0.07	0.031
Urea (mmol/L) (Mean ± SD)	3.77±0.78	6.04±3.13	0.001
Creatinine (umol/l): Median (range)	47.00 (30-54)	59.00 (33-298)	0.001
ALT (U/L): Median (range)	18.00 (7-40)	48.00 (7-262)	0.007
AST (U/L): Median (range)	25.00 (21.0-43.0)	45.70 (21.0-430.0)	0.001
Total proteins (g/L) (Mean ± SD)	60.25±6.89	54.72±6.33	0.007
Albumin (g/L) (Mean ± SD)	33.44±4.52	29.87±3.82	0.005
Bilirubin (umol/l): Median (range)	6.00 (5.0-8.0)	7.00 (4.0-61.1)	0.101

Data were expressed as mean ± SD/median (range)

Independent sample T test/ Mann Whitney U test were used to compare mean/median between groups.

Table (3): Comparison of ANXA4, MXRA5 and TIMP2 among cases and controls

Variables	Preeclampsia (n= 48)	Controls (n =48)	P-Value*
ANXA4
Mean ± SD. Range	0.741±0.28 (0.445-1.323)	1.075±0.36 (0.494-1.455)	<0.001
MXRA5
Mean ± SD. Range	0.506±0.16 (0.322-1.002)	1.011±0.14 (0.530-1.276)	<0.001
TIMP2
Mean ± SD. Range	1.091±0.22 (0.717-1.402)	1.028±0.24 (0.662-1.416)	0.186

* Independent Sample T test was used to compare mean between groups

Table (4): Comparison of ANXA4, MXRA5 and TIMP2 between mild and severe preeclampsia.

Variables	Mild (n= 18)	Severe (n =30)	P-Value*
ANXA4
Mean ± SD	0.83±0.26	0.69±0.27	0.072
MXRA5
Mean ± SD	0.64±0.17	0.43±0.11	<0.001
TIMP2
Mean ± SD	1.04±0.21	1.12±0.22	0.219

* Independent Sample T test was used to compare mean between groups

Table (5): Correlation between ANXA4, MXRA5 and TIMP2 in the studied groups

Variables	ANXA4		MXRA5		TIMP2
Variables	r	P	r	P	r	P
Total (n=96)
ANXA4			0.571	<0.001	-0.022	0.835
MXRA5	0.571	<0.001			-0.099	0.335
TIMP2	-0.022	0.835	-0.099	0.335
Cases (n=48)
ANXA4			0.732	<0.001	-0.238	0.103
MXRA5	0.732	<0.001			-0.168	0.255
TIMP2	-0.238	0.103	-0.168	0.255
Controls (n=48)
ANXA4			0.237	0.104	0.270	0.064
MXRA5	0.237	0.104			0.174	0.237
TIMP2	0.270	0.064	0.174	0.237

*r (Spearman correction coefficient)

P (P-value significant if <0.05)

Table (6): Correlation between studied ANXA4, MXRA5 and TIMP2 and characteristics of patients with preeclampsia

Variables	ANXA4		MXRA5		TIMP2
Variables	r	P	r	P	r	P
Age	-0.101	0.494	-0.027	0.856	-0.027	0.857
Systolic BP	-0.010	0.948	-0.252	0.084	0.019	0.897
Diastolic BP	-0.166	0.259	-0.206	0.160	-0.140	0.341
Weight	-0.248	0.089	0.066	0.657	0.015	0.921
Height	-0.182	0.215	-0.278	0.056	0.313
BMI	-0.150	0.307	0.128	0.385	-0.047	0.754

*r (Spearman correction coefficient)

P (P-value significant if <0.05)

Table (7): Correlation between ANXA4, MXRA5 and TIMP2 and laboratory data in patients with preeclampsia

Variables	ANXA4		MXRA5		TIMP2
Variables	r	P	r	P	r	P
Hb (g/dl)	0.163	0.268	-0.108	0.463	-0.187	0.203
Platelets (10 3/ul)	0.193	0.188	0.450	0.001	-0.224	0.126
PT (sec)	-0.439	0.002	-0.410	0.008	-0.039	0.791
PC (%)	0.313	0.030	0.539	<0.001	0.145	0.327
INR	-0.475	0.001	-0.471	0.001	0.011	0.939
Urea (mmol/L)	-0.482	0.001	-0.524	<0.001	0.218	0.137
Creatinine (umol/l)	-0.871	<0.001	-0.802	<0.001	0.130	0.380
ALT (U/L)	-0.178	0.227	-0.401	0.006	0.288	0.057
Total proteins (g/L)	0.407	0.004	0.421	0.003	-0.197	0.180
Albumin (g/L)	0.351	0.015	0.467	0.001	-0.062	0.674
Bilirubin (umol/l)	-0.152	0.304	-0.264	0.069	0.070	0.637

*r (Spearman correction coefficient)

P (P-value significant if <0.05)

Table (8): Diagnostic criteria of ANXA4, MXRA5 and TIMP2 for prediction of preeclampsia

Indices	Diagnostic criteria
Indices	ANXA4	MXRA5	TIMP2
AUC (95% CI)	0.769 (0.670-0.868)	0.964 (0.929-0.998)	0.585 (0.480-0.685)
Cut off	≤ 1.215	≤ 0.682	> 1.096
Accuracy	81.5%	94.0%	64.5%
Sensitivity, %	95.8%	91.7%	62.5%
Specificity, %	66.7%	95.8%	66.7%
PPV %	74.2%	95.7%	65.2%
NPP %	94.1%	92.0%	64.0%
*P-Value*	<0.001	<0.001	0.155

PPV: positive predictive value; NPV: negative predictive value; AUC: area under curve.

95% CI: 95% confidence interval

Table (9): Diagnostic criteria of ANXA4, MXRA5 and TIMP2 for prediction of severe PE compared to mild PE.

Indices	Diagnostic criteria
Indices	ANXA4	MXRA5	TIMP2
AUC (95% CI)	0.770 (0.626-0.879)	0.931 (0.819-0.984)	0.614 (0.462-0.751)
Cut off	≤ 0.606	≤ 0.467	>1.159
Accuracy	75.5%	95.5%	68.0%
Sensitivity, %	73.3%	96.7%	63.3%
Specificity, %	77.8%	94.4%	72.2%
PPV %	84.6%	96.7%	79.2%
NPP %	63.6%	94.4%	54.2%
*P-Value*	0.001	<0.001	0.182

PPV: positive predictive value; NPV: negative predictive value; AUC: area under curve.

95% CI: 95% confidence interval

No competing interests reported.

Role and Expression of Annexin IV (ANXA4) and Matrix-remodeling Associated 5 protein (MXRA5) in connective tissue remodeling of placenta in preeclampsia.

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Study population

Sampling

Quantitative real-time PCR (qRT-PCR) analysis

pAKT Elisa-kit

Statistical analysis

Results

Discussion

Conclusions

Declarations

References

Tables

Additional Declarations

Status:

Version 1