Oleuropein protects against 5-Fluorouracil-Induced nephrotoxicity and hepatotoxicity in Rats

doi:10.21203/rs.3.rs-3802862/v1

Download PDF

Research Article

Oleuropein protects against 5-Fluorouracil-Induced nephrotoxicity and hepatotoxicity in Rats

https://doi.org/10.21203/rs.3.rs-3802862/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

The renal and liver dysfunction is considered to be a life-threatening side effect of chemotherapy drugs such as 5-fluorouracil (5-FU). This study was designed to assess the effects of Oleuropein (OLE) against 5-FU-induced renal and liver toxicity.

Methods

Twenty-four adult Sprague-Dawley rats were randomly divided into 4 groups (N = 6) including the control, 5-FU (100 mg/kg), OLE (200 mg/kg), 5-FU + OLE. After treatment, blood sample were collected for the measurement of biochemical parameters, and the kidney and liver tissues were removed for the determination of inflammatory markers and histological changes.

Results

5-FU significantly increased blood urea nitrogen (BUN), creatinine (Cr), uric acid (UA), liver enzyme levels, tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6) concentration. Also, histopathological findings of 5-FU showed acute tubular necrosis (ATN) in the renal tissues and coagulative necrosis in the hepatocytes. While the administration of OLE significantly decreased BUN-Cr, liver enzyme levels and inflammation and improved pathological changes.

Conclusion

Oleuropein exerted hepato-nephroprotective effects against 5-fluorouracil toxicity by the reduction of inflammatory factors.

Fluorouracil

Inflammation

Kidney

Liver

Oleuropein

Antimetabolites refer to a range of medications that hinder essential biosynthetic processes or become part of macromolecules like DNA and RNA, resulting in the disturbance of cell functioning. 5-fluorouracil (5-FU), an antimetabolite, specifically targets the metabolism of uracil. Developed in the 1950s, it has since been widely used as a component of chemotherapeutic regimens [1, 2]. It is commonly used to treat solid tumors in the gastrointestinal system especially some of the deadliest types like colorectal cancer and pancreatic ductal adenocarcinoma, as well as other types of cancer that arise in organs like the breast and cervix [3].

The drug 5-FU works by converting uracil into 5-fluoro-2′-deoxyuridine monophosphate, preventing the production of the enzyme responsible for thymidylate synthesis. This enzyme is crucial for tumor growth as it helps to synthesize thymine, and its expression is dependent on the cell cycle. By reducing the amount of thymidylate synthase enzyme, the levels of 2′-deoxythymidine-5′-monophosphate (dTMP) also decrease; dTMP is essential for DNA repair and replication. This can lead to cell dysfunction and disorder [4].

Chemotherapy is known to be effective in treating cancer and prolonging patient survival. However, its non-targeted action can result in life-threatening side effects on healthy organs, which often leads to discontinuation of treatment [5]. Like many other chemotherapy drugs, 5-FU can have toxic effects, such as myelotoxicity, gastrointestinal toxicity, and cardiotoxicity [6, 7]. 5-FU is also broken down in hepatic cells into urea, a-fluoro-b-alanine, dihydrouracil, carbon dioxide, and ammonia, causing nephrotoxicity and hepatotoxicity [8].

Several studies have focused on using natural products to cope with the toxic effects of 5-FU, due to the increasing desire to use natural products [9–12]. Oleuropein (OLE) is a polyphenol that is extracted from various parts of the olive tree, including the fruit and leaves [13, 14]. The health benefits of olive leaves and their components have been widely researched, and it has been found that oleuropein has numerous positive effects on health, including cardioprotective, antioxidant, anti-inflammatory, antidiabetic, and anti-cancer properties, making it a natural extract that can be integrated into treatment plans for a variety of disorders [14–17].

Based on the given information, it appears that oleuropein can assist in relieving 5-FU-induced toxicities. Therefore, our study aims to examine the hepato-nephroprotective benefits of oleuropein in an experimental nephrotoxicity and hepatotoxicity model induced by 5-FU in rats.

2.1. Animals

In the current research, 24 adult male Sprague-Dawley (SD) rats were put randomly in 4 groups of 6 rats in a random method. Their weights ranged from 200 to 225 g. Stainless steel houses were prepared for rats under controlled temperature (21ºC) and humidity (60%) with 12 hours of light and darkness cycle; and ad libitum access to standard water and food was allowed. The present research was approved by the ethics committee of Ardabil University of Medical Sciences (Ethics code: IR.ARUMS.AEC.1402. 031). All experiments were performed according to the recommendations of the Care and Use of Laboratory Animals provided by the Institute of Laboratory Animal Resources Commission on Life Sciences [18].

2.2. Experimental groups

At the beginning of the experiment, male rats were randomly put in 4 groups (N = 6). The treatment period was considered 14 days. Animals were treated as follows:

Group 1 (control): received saline solution (0.9%) for 14 consecutive days (0.4 ml/day, IP)

Group 2 (5-FU, 5-fluorouracil): received 5-FU (100 mg/kg/week, IP)

Group 3 (OLE, Oleuropein): received OLE suspended in 0.9% saline (200 mg/kg/day, IP)

Group 3 (5-FU + OLE): administrated 5-FU (100 mg/kg/week) with OLE (200 mg/kg/day)

5-FU (Sigma-Aldrich) was dissolved in the saline under the hood and administrated weekly intraperitoneally (IP) for 14 days (100 mg/kg) [12]. OLE powder, purchased from the company (Sigma-Aldrich), was dissolved in normal saline, and injected at (200 mg/kg/day) [19]. Animals were weighed at the launch and the final days of study by standard weighing balance (Ohaus Europe GmbH, Henwinelstrasse, Nanikon, Switzerland).

2.3. Biochemical measurement

A mixture of 10 mg/kg xylazine and50 mg/kg ketamine was injected intraperitonealy to anesthetize the rats at the end of the treatment period. Blood samples and fresh kidney and liver tissues were obtained from the body. Ten minutes centrifuge at 3000 rpm was performed to separate the plasma from the blood samples which was then stored at − 80̊C for biochemical analysis. The creatinine (Cr), blood urea nitrogen (BUN), and uric acid (UA) levels were assayed by the Auto-analyser with original kits to assess the kidney function. The serum levels of ALT (Alanine transaminase), AST (Aspartate transaminase), and ALP (Alkaline phosphatase) were measured using Randox assay kits. The kits for measurement of serum total protein, albumin and bilirubin levels were purchased from Pars Azmoon company (Tehran, Iran), and measured according to the manufacturer’s protocol.

2.4. Interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) assessment

The Real-Time PCR method was used to determine the TNF-α and IL-6 expression levels in liver and renal tissues. TRIzol reagent (Anazol, Iran) was utilized to isolate the total RNA from the kidney and liver tissues, including the control, oleuropein, 5-FU, and combination groups. Then, the NanoDrop (Thermo Fisher, USA) was used to measure the RNA concentration. Next, complementary DNA (cDNA) was synthesized using 1 µg of total RNA, as per the instructions (YektaTajhiz, YTA, Iran). Before the experiment, the primer sequences were blasted with the primer-blast software of the NCBI website. Real-time PCR (Applied Biosystems StepOne™) was performed with specific primers for TNF-α, and IL-6 genes (Bioneer, Korea), as illustrated in Table 1. Moreover, the outcomes were considered utilizing the 2^{− ΔΔCt} analysis method [20].

Table 1

Sequence of primers used for RT-PCR.
Genes	Forward and reverse	Sequences
TNF-a	F R	5´ ATCGGTCCCAACAAGGAGGA 3´ 5´ TCCGCTTGGTGGTTTGCTAC 3´
IL-6	F R	5´ GACTTCCAGCCAGTTGCCTTCTTG 3´ 5´TGGTCTGTTGTGGGTGGTATCCTC 3´
GAPDH	F R	5´ CCTCCAGGAGCGAGATCC C 3´ 5´ GTGGTTCACACCCATCACAAA C 3´

2.5. Histopathological study

Liver and kidney tissues were fixed in formalin 10% and embedded in paraffin blocks; then their histopathological changes were evaluated. Afterwards, 5 µm sections were provided and stained with hematoxylin-eosin (H&E) method, and then examined by a pathologist in a blinded manner under light microscope [21].

2.6. Statistical analysis

The findings were expressed as Mean ± Standard Deviation (SD), and one-way ANOVA with Graph Pad Prism version 8.4.3 were used to analyze data. Significant differences between groups was determined by Tukey post hoc test. P-Value (P < 0.05) shows a significant relationship in statistical analyses.

3.1. The impact of oleuropein on 5-FU-induced changes in biochemical factors

As shown in the Table 2, the serum levels of uric acid, BUN- Cr, AST, ALP and ALT levels were significantly elevated in the 5-FU group compared to the control group (P < 0.05). Co-administration of OLE and 5-FU significantly decreased above mentioned factors compared to the 5-FU group (P < 0.05).

Table 2

Effects of OLE on biochemical parameters in rats treated with 5-FU
Parameters	Control	5-Fu	OLE	5-Fu + OLE
BUN(mg/dl)	63.80 ± 2.85	152.00 ± 12.53^***	51.10 ± 3.48	80.00 ± 15.66^###
Cr(mg/dl)	0.57 ± 0.06	0.99 ± 0.14^*	0.53 ± 0.04	0.59 ± 0.07^#
Uric acid(mg/dl)	1.13 ± 0.11	1.86 ± 0.14^**	1.31 ± 0.18	1.36 ± 0.11
AST(U/L)	145.00 ± 16.51	246.00 ± 27.10^*	188.40 ± 23.54	156.80 ± 25.84^#
ALT(U/L)	57.20 ± 6.90	143.00 ± 9.92^***	58.30 ± 3.17	68.00 ± 20.27^##
ALP(U/L)	161.20 ± 15.05	250.40 ± 24.41^**	108.20 ± 11.90	134.00 ± 11.37^###
Total protein(mg/dl)	5.64 ± 0.17	4.63 ± 0.48	7.52 ± 0.25^*	6.02 ± 0.54^$
Albumin(mg/dl)	3.29 ± 0.09	1.98 ± 0.20^§§§	4.14 ± 0.12^**	2.69 ± 0.08^§§
Bil T(mg/dl)	0.35 ± 0.04	0.43 ± 0.08	0.33 ± 0.07	0.36 ± 0.08
5-Fu; 5-fluorouracil, OLE; Oleuropein, BUN; Blood urea nitrogen, Cr; Creatinine, AST; Aspartate transaminase, ALT; Alanine transaminase, ALP; Alkaline phosphatase, Bil T; Bilirubin total. The results were expressed as Mean ± SD.
^, ^, ^** Significantly increased when compared with control group, (P < 0.05, 0.01, 0.001).
^#, ^##, ^### Significantly decreased when compared with 5-Fu group, (P < 0.05, 0.01, 0.001).
^$ Significantly decreased when compared with OLE group, (P < 0.05).
^§§§ Significantly decreased when compared with control group, (P < 0.001).
^§§ Significantly increased when compared with 5-Fu group, (P < 0.01).

Also, in the 5-FU group, the serum levels of albumin and total protein were declined. Whereas the administration of OLE for 14 days significantly increased albumin and total protein levels in contrast to the 5-FU group (P < 0.05, Table 2).

3.2. The impact of oleuropein and 5-fluorouracil on TNF-α and IL-6 expression

We evaluated whether OLE declines the inflammatory factors’ expression (TNF-α, IL-6), which are induced by 5-FU. The toxic properties of 5-FU cause a significant increase in TNF-α and IL-6 expression levels in liver and renal tissues compared to the control group (P < 0.001). Nevertheless, a significant decrease was observed in the expression levels of these markers in the 5-Fu plus OLE group (P < 0.01, Fig. 1). Our findings confirm that oleuropein alone and co-treatment of 5-FU with OLE cause the reduction of IL-6 and TNF-α expressions.

3.3. The effect of oleuropein on 5-FU-induced histopathological changes

Renal histological evaluation of the control group revealed no morphological alterations (Fig. 2A). While, the normal structure of the kidney tissues was disrupted in the 5-Fu group, showing lymphocyte infiltration and acute tubular necrosis following 5-Fu administration (Fig. 2B). In the OLE group, the degree of congestion in the glomerulus was observed (Fig. 2C). Co-administration of oleuropein and 5-Fu considerably declined morphological abnormalities induced by 5-Fu (Fig. 2D).

Also, hepatic histological assessment of the control group indicated normal hepatocytes (Fig. 3A).Whereas coagulative necrosis, neutrophil infiltration, and congestion occurred after 5-Fu administration in the 5-Fu group (Fig. 3B). Moreover, the OLE-treated group showed normal hepatic structure (Fig. 3C). 5-Fu plus OLE demonstrated decreased degenerative alterations with the degree of lymphocyte infiltration in the hepatocytes (Fig. 3D).

Studies have revealed that oleuropein, the primary derivative of olive oil, has various pharmacological effects. These include antioxidant, anti-atherogenic, anti-inflammatory, anti-aging, vasodilatory, and anti-diabetic effects, to name just a few. As a result, it can be beneficial in cells' stressful conditions, including oxidative stress, toxicity, and inflammation [22]. Consequently, in this study, we hypothesize that OLE can reduce the nephrotoxicity and hepatotoxicity caused by 5-fluorouracil, a commonly used drug in chemotherapic regimens [2]. Although there are well-documented preventive strategies for 5-FU-induced nephrotoxicity and hepatotoxicity, there are few animal studies evaluating the protective effect of OLE.

Based on our results, treatment with 5-fluorouracil resulted in increased liver enzyme levels including ALT, AST, and ALP, as well as Cr, BUN, and UA, suggesting liver and renal dysfunction which was highly reduced after oleuropein administration. On the other side, the assessment of IL-6 and TNF-α inflammatory factors showed increased inflammation due to the 5-FU administration. In normal conditions, BUN, Cr, and UA are excreted by the kidneys. Creatinine is mainly produced by muscles so its serum concentration will be a reflection of lean body mass. Although its concentration also depends on other factors such as activity or renal failure in Cr secretion. The amount of urea increases in the context of a high protein diet, fever, catabolic conditions, and inflammation. Also, uric acid, a waste byproduct of purines, is dissolved in blood and is excreted from kidneys and it can be increased in kidney dysfunction and high protein diet. Due to a normal, similar diet and body activity of 5-FU-administered rats and control ones, and decreased muscle volume and body weight in the 5-FU group, it can be understood that this increase in BUN, Cr, and UA is because of kidney dysfunction induced by 5-FU treatment not because of increased diet protein, muscle mass or activity [23, 24]. ALT, ALP, and AST are enzymes that are mostly present in the liver, they are also found in other tissues. Any hepatic cell and hepatic duct injury can lead to a rise in ALT, AST, and ALP. These enzymes along with serum albumin and bilirubin, clearly can express liver function [25].

Our findings also showed that co-administering OLE and 5-FU can significantly decrease the levels of ALP, AST, ALT, Cr, UA, and BUN alongside inflammatory markers IL-6 and TNF-α. This suggests that OLE may be helpful in mitigating the disadvantageous of 5-FU on tissues. The histopathological findings also confirmed the beneficial effects of OLE. The previous findings are aligned with the present study showing the protective effects of OLE due to its proven anti-inflammatory and antioxidant effects that leads to hepato-protection and nephro-protection [26–29].

It has been demonstrated that 5-FU induces apoptosis by causing oxidative stress within the cells. The NF-κB pathway’s activation during inflammation and oxidative stress, increases the pro-inflammatory genes’ expression. On the other hand, there is evidence that 5-FU activates MAPK (Mitogenactivated protein kinase), that has a critical part in the expression of inflammatory cytokines, such as TNF-α [30]. Based on previous research about the oleuropein’s antioxidant and anti-inflammatory effects, it appears that this compound inhibits the activation of MAPK and NF-κB, thus protects the liver and kidneys against 5-FU-induced damage [31]. These findings help to explain the decreased levels of IL-6 and TNF-α observed when oleuropein is administered alongside 5-FU.

Additionally, histopathological studies revealed pathological alterations, such as acute tubular necrosis in the renal tissues and coagulative necrosis in the hepatocytes. These laboratory and histopathological findings confirm that 5-fluorouracil is associated with severe hepatotoxicity and nephrotoxicity, which is consistent with previous researches [32–34]. OLE administration attenuated the morphological defects associated with 5-FU toxicity, in addition, the pathological alterations are reversed by OLE treatment. Therefore, a cytoprotective activity is regarded for oleuropein in the liver and kidney tissues that are damaged by 5-FU. This cytoprotective property of oleuropein may be due to its potential anti-inflammatory capacity [31].

Moreover, there are several other studies suggest that OLE has anti-oxidative, anti-cancer and anti-metastatic properties [14]. Thus, it can be considered as a co-treatment in chemotherapeutic regimens. However, further investigation is required to understand its molecular pathways and mechanism of action, which would enable the development of new formulations with better pharmacokinetic properties and therapeutic effects.

This study was designed to provide quantitative evidence for the potential protective and therapeutic properties of oleuropein against renal and liver toxicity induced by 5-FU. The beneficial effects of oleuropein such as improvement of kidney and liver function and pathological alterations and decreased expression of pro-inflammatory cytokines were proved in the present study. In conclusion, it could be argued that as OLE demonstrates potent anti-inflammatory properties, it can be regarded as a strong therapeutic agent in 5-FU-induced nephrotoxicity and hepatotoxicity.

Funding: This study was financially supported by Ardabil University of Medical Sciences (Project code: 402000403).

Conflict of interest

The authors have no relevant financial or non-financial interests to disclose.

Authorsʼ Contributions

SB and ES designed the study, SB and MMC did histopathological evaluation, SB analyzed the data; ES and FM wrote the manuscript, VA conducted the biochemical and molecular analyses. All authors read and approved the final manuscript.

Ethics statement: The Ethics Committee of Ardabil University of Medical Sciences approved this study (IR.ARUMS.AEC.1402. 031).

Tanaka, F., et al., The history, mechanism and clinical use of oral 5-fluorouracil derivative chemotherapeutic agents. Current pharmaceutical biotechnology, 2000. 1(2): p. 137–164.
Longley, D.B., D.P. Harkin, and P.G. Johnston, 5-fluorouracil: mechanisms of action and clinical strategies. Nature reviews cancer, 2003. 3(5): p. 330–338.
Chalabi-Dchar, M., et al., A novel view on an old drug, 5-fluorouracil: an unexpected RNA modifier with intriguing impact on cancer cell fate. NAR cancer, 2021. 3(3): p. zcab032.
Chibber, S., et al., White light-mediated Cu (II)–5FU interaction augments the chemotherapeutic potential of 5-FU: an in vitro study. Tumor Biology, 2011. 32: p. 881–892.
Schwab, M., et al., Role of genetic and nongenetic factors for fluorouracil treatment-related severe toxicity: a prospective clinical trial by the German 5-FU Toxicity Study Group. Journal of clinical oncology, 2008. 26(13): p. 2131–2138.
Alter, P., et al., Cardiotoxicity of 5-fluorouracil. Cardiovascular & Hematological Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Cardiovascular & Hematological Agents), 2006. 4(1): p. 1–5.
Kimura, Y. and H. Okuda, Prevention by chitosan of myelotoxicity, gastrointestinal toxicity and immunocompetent organic toxicity induced by 5-fluorouracil without loss of antitumor activity in mice. Japanese journal of cancer research, 1999. 90(7): p. 765–774.
Yousef, H.N. and H.R. Aboelwafa, The potential protective role of taurine against 5-fluorouracil-induced nephrotoxicity in adult male rats. Experimental and Toxicologic Pathology, 2017. 69(5): p. 265–274.
Al-Khrashi, L.A., et al., Thymol ameliorates 5‐fluorouracil‐induced intestinal mucositis: Evidence of down‐regulatory effect on TGF‐β/MAPK pathways through NF‐κB. Journal of Biochemical and Molecular Toxicology, 2022. 36(1): p. e22932.
Safarpour, S., et al., Cardioprotective effect of silymarin nanoemulsion on 5-fluorouracil‐induced cardiotoxicity in rats. Archiv der Pharmazie, 2022. 355(7): p. 2200060.
Noorbakhsh, M.F., et al., The protective effects of silymarin in 5-fluorouracil-ınduced hepatotoxicity and nephrotoxicity in rats. Iranian Veterinary Journal, 2022. 18(3): p. 103–113.
Safarpour, S., et al., Protective effect of kaempferol and its nanoparticles on 5-fluorouracil-induced cardiotoxicity in rats. BioMed Research International, 2022. 2022.
Romero-Márquez, J.M., et al., An oleuropein rich-olive (Olea europaea L.) leaf extract reduces β-amyloid and tau proteotoxicity through regulation of oxidative-and heat shock-stress responses in Caenorhabditis elegans. Food and Chemical Toxicology, 2022. 162: p. 112914.
Rishmawi, S., et al., A Comprehensive Review on the Anti-Cancer Effects of Oleuropein. Life, 2022. 12(8): p. 1140.
Menezes, R.C.R., et al., Oral administration of oleuropein and olive leaf extract has cardioprotective effects in rodents: A systematic review. Revista Portuguesa de Cardiologia, 2022. 41(2): p. 167–175.
Pojero, F., et al., Effects of oleuropein and hydroxytyrosol on inflammatory mediators: Consequences on inflammaging. International Journal of Molecular Sciences, 2022. 24(1): p. 380.
Hadrich, F., et al., Olive leaves extract and oleuropein improve insulin sensitivity in 3T3-L1 cells and in high-fat diet-treated rats via PI3K/AkT signaling pathway. Oxidative Medicine and Cellular Longevity, 2023. 2023.
Council, N.R., Guide for the care and use of laboratory animals. 2010.
Geyikoglu, F., et al., Effect of oleuropein against chemotherapy drug-induced histological changes, oxidative stress, and DNA damages in rat kidney injury. Journal of food and drug analysis, 2017. 25(2): p. 447–459.
Golmohammadi, M.G., et al., Vitamin D3 and erythropoietin protect against renal ischemia-reperfusion injury via heat shock protein 70 and microRNA-21 expression. Sci Rep, 2020. 10(1): p. 20906.
Golmohammadi, M.G., et al., Saponin protects against cyclophosphamide-induced kidney and liver damage via antioxidant and anti-inflammatory actions. Physiol Int, 2023. 110(2): p. 108–120.
Omar, S.H., Oleuropein in olive and its pharmacological effects. Scientia pharmaceutica, 2010. 78(2): p. 133–154.
Hosten, A.O., BUN and Creatinine. Clinical Methods: The History, Physical, and Laboratory Examinations. 3rd edition, 1990.
Becker, B.F., Towards the physiological function of uric acid. Free Radical Biology and Medicine, 1993. 14(6): p. 615–631.
Gowda, S., et al., A review on laboratory liver function tests. The Pan african medical journal, 2009. 3.
Abdel-Hamid, N., M. Fawzy, and M. El-Moselhy, Evaluation of hepatoprotective and anticancer properties of aqueous olive leaf extract in chemically induced hepatocellular carcinoma in rats. Am J Med Med Sci, 2011. 1(1): p. 15–22.
Kim, Y., Y. Choi, and T. Park, Hepatoprotective effect of oleuropein in mice: mechanisms uncovered by gene expression profiling. Biotechnology journal, 2010. 5(9): p. 950–960.
Cerig, S., et al., Hepatoprotective effect of oleuropein against cisplatin-induced liver damage in rat. World Acad Sci Eng Technol Int J Med Health Biomed Bioeng Pharm Eng, 2016. 10: p. 260–7.
Butt, M.S., et al., Neuroprotective effects of oleuropein: Recent developments and contemporary research. Journal of Food Biochemistry, 2021. 45(12): p. e13967.
Elsea, C.R., et al., Inhibition of p38 MAPK suppresses inflammatory cytokine induction by etoposide, 5-fluorouracil, and doxorubicin without affecting tumoricidal activity. PloS one, 2008. 3(6): p. e2355.
Nasrallah, H., et al., Effect of oleuropein on oxidative stress, inflammation and apoptosis induced by ischemia-reperfusion injury in rat kidney. Life Sci, 2020. 255: p. 117833.
Gelen, V., et al., The protective effects of naringin against 5-fluorouracil-induced hepatotoxicity and nephrotoxicity in rats. Iranian journal of basic medical sciences, 2018. 21(4): p. 404.
Gelen, V., et al., The protective effects of hesperidin and curcumin on 5-fluorouracil–induced nephrotoxicity in mice. Environmental Science and Pollution Research, 2021. 28: p. 47046–47055.
Gelen, V., et al., The protective effect of rutin and quercetin on 5-FU-induced hepatotoxicity in rats. Asian Pacific Journal of Tropical Biomedicine, 2017. 7(7): p. 647–653.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Oleuropein protects against 5-Fluorouracil-Induced nephrotoxicity and hepatotoxicity in Rats

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials and Methods

2.1. Animals

2.2. Experimental groups

2.3. Biochemical measurement

2.4. Interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) assessment

2.5. Histopathological study

2.6. Statistical analysis

3. Results

3.1. The impact of oleuropein on 5-FU-induced changes in biochemical factors

3.2. The impact of oleuropein and 5-fluorouracil on TNF-α and IL-6 expression

3.3. The effect of oleuropein on 5-FU-induced histopathological changes

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1