Bacterial and yeast strains and culture conditions. Wildtype bacterial strains were isolated from a Midwestern dry-grind fuel ethanol plant and selected from a previous screen [16]. Unless otherwise stated, all bacterial strains described here (Table 1) were grown in its respective culture media. Escherichia coli strains in Miller’s LB (LB broth) medium (Difco Laboratories, Inc.). When used, ampicillin (Amp; Sigma-Aldrich, Inc.) at 100 µg/mL or kanamycin (Kan; Sigma-Aldrich, Inc.) at 50 µg/mL was added to LB media when required. Lactobacillus spp. and Weissella. were grown in Lactobacilli MRS (MRS broth) medium (Difco Laboratories, Inc.). Acetobacter and Pediococcus were grown in rapid lemonade spoilage organism broth (RLS broth; Sigma-Aldrich). Enterococcus strains were cultured in brain heart infusion broth (BHI; Bacto). Streptococcus were grown in tryptic soy broth (TSB; Difco Laboratories, Inc.). Unless otherwise stated, bacterial strains were inoculated at 37 °C with shaking (200 rpm), with expectation to Lactobacillus spp. (standstill incubation). Saccharomyces cerevisiae was grown in yeast extract peptone broth (YPD; BD Biosciences) at 32 °C with shaking (200 rpm).
Construct, strains, and plasmids. Bacteriophage EcoSau endolysin gene (LysKB317; GenBank accession number KP027015.1; protein accession number AIY32273.1[25]) was codon optimized for E. coli expression and synthesized by GenScript (Table 2). Plasmid pUC57 carrying LysKB317 was transformed into E. coli (E. cloni 10G; Lucigen Co.) for plasmid propagation (Table 1). Primer set Sau_F and Sau_R (Table 3) was used to amplify the 894 bp LysKB317 gene insert. PCR amplicon was cleaned using QIAquick PCR purification kit (Qiagen) and cloned into pRham N-His Kan vector (Table 2) using E. coli strain E. cloni 10G (Lucigen Co., Table 1) per manufacture protocol. The LysKB317 plasmid construct was Sanger sequenced verified using primer set pRham_F and pETite_R (Table 3).
Table 2
Plasmids used in this study
Plasmid | Relevant genotypea | Reference |
pUC57::LysKB317 | AmpR, containing LysKB317 gene fragment | GenScript |
pRham N-His Kan | KanR, Expresso rhamnose cloning vector | Lucigen Co. |
pRham N-His Kan::LysKB317 | KanR, containing the LysKB317 | This study |
aAmpR, Ampicillin resistant; KanR, Kanamycin resistant |
Table 3
Primers used in this study
Primer name | Sequence (5' − 3') | Purpose | Reference |
Sau_F | CATCATCACCACCATCACGCACTTTACGTAGTTGACGTT | Amplification of LysKB317 for cloning | This study |
Sau_R | GTGGCGGCCGCTCTATTATTTAAAGGTTCCGAATGCTTC |
pRham_F | GCTTTTTAGACTGGTCGTAGGGAG | Verify gene insert | Lucigen Co. |
pETite_R | CTCAAGACCCGTTTAGAGGC |
Expression and purification of LysKB317. Commercially available Gram-negative E. coli Expresso SUMO protein expression system (Lucigen) was used to express Gram-positive Lactobacilli toxin. The LysKB317 endolysin protein was over expressed in E. coli (E. cloni 10G/pRham N-His Kan::LysKB317; Table 1) via 0.2% (w/v) L-rhamnose (Sigma) induction in 1 L LB broth with Kan at 37 °C shaking (200 rpm) overnight. Cells were harvested by 4 °C centrifugation at 5,000 × g for 20 min. Cells were then lysed with B-PER (Thermo Scientific) and the addition of freshly prepared lysozyme (20 mg/mL in 1 mM Tris-HCl, pH8.0; Thermo Scientific), DNaseI (10 U/mL; Thermo Scientific), and RNase I (10 U/mL; Thermo Scientific), followed by gentle inversion for 20 min at room temperature. Soluble protein fraction was separated from whole cell lysate via 15,000 × g centrifugation at 4 °C for 5 min and purified using HisPur Ni-NTA Superflow Agarose (Thermo Scientific). Nickel resin was washed with 40 column volumes (CV) of lysis buffer, and 15 CV of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, and 30% glycerol, pH 8.0). Bound LysKB317 His6-tagged protein was eluted with elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, and 30% glycerol, pH 8.0) and filter sterilized with 0.22 µm. Concentration of protein was determined using a Qubit 3 fluorometer (Thermo Fisher Scientific) and Qubit Protein Assay Kit (Thermo Fisher Scientific). A sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was used to determine the protein purities. Purified N-terminus His-tagged LysKB317 recombinant protein was resuspended in 1x Laemmli sample buffer (Bio-Rad laboratories, Inc.) and boiled for 5–10 min. Fifteen microliters of the boiled sample and protein standard (Precision Plus Protein All Blue standard; Bio-Rad) were loaded side-by-side onto an Any kD Tris-glycine precast gel (Bio-Rad) for (SDS-PAGE) protein separation at 100 V for 70 min. The gel was stained with LabSafe Gel Blue stain (G-Biosciences) for 1 h at room temperature with gentle agitation, and then destained with deionized (DI) water for at least 1 h.
Expression and purification of endolysin LysA. The endolysin LysA (36.4 kD; glycosidase) known to inhibit Lactobacilli spp. was chosen as an endolysin comparison to LysKB317 [4]. E. coli BL21(DE3)/pET21a::LysA (Table 1) was induced similar to previously discussed methods [49] with 0.5 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG; Sigma) in LB broth and ampicillin (100 µg/mL) overnight at 37 °C with agitation. LysA endolysin was purified using methods described above.
Western blot analysis. Purified N-terminus His-tagged LysKB317 recombinant protein described above was separated by SDS-PAGE as previously described. A Trans-Blot turbo transfer system (Bio-Rad) was used for protein transfer onto a low-fluorescence polyvinylidene difluoride (PVDF) membrane with 0.2 µm pore size (Bio-Rad). Protein electrophoresis transfer was verified using Ponceau S staining (Cell Signaling Technology, Inc.). Nonspecific binding was blocked by 3% bovine serum albumin (BSA) in 1x tris-buffered saline (TBS) containing 0.1% Tween-20 (Sigma-Aldrich). Mouse anti-His tag antibody conjugated to DyLight 488 was applied and incubated at 4 °C overnight (1:1,000; Thermo Fisher Scientific). Fluorescent band signals were detected using a ChemiDoc XRS + imaging system (Bio-Rad).
Spot plate assay. Bacterial strains (Table 1) were inoculated in 5 mL MRS at 37 °C without shaking and grown to OD600 nm of approximately 0.8. Bacterial strains (1 mL) were then mixed with 0.7% agar (50 °C), and 0.5 mL of plate buffer (50 mM NaH2PO4, pH 7.0), then poured onto pre-solidified regular MRS agar plate (1.6%) and allowed to air dry. Purified LysKB317 protein at a pre-determined concentration [1.0 µM; 5 µL] was pipetted onto the MRS-agar and dried for 10–15 min. Sterile water was used as negative control. The plate was then incubated at 37 °C overnight. Strains that exhibited zones of clearance was deemed susceptible to LysKB317. As controls, 5 µL of MRS broth served as the negative control and 5 µL of 20 µg/mL purified endolysin LysA and lysozyme separately served as the positive control [4].
Zymogram. Zymogram analysis was performed based on a previously described method with slight modification [4]. Briefly, L. fermentum 0315 − 25 cells (Table 1) were grown to mid-log phase in 50 mL MRS media and pelleted at 4,000 × g for 15 min. Cells were washed with 10 mL of zymogram buffer (10 mM Tris, 150 mM NaCl, pH 7.5), harvested and resuspended in 300 µL zymogram buffer resulting in a final volume of approximately 600 µL. The purified LysKB317 protein described above, and protein standard (Precision Plus Protein All Blue standard; Bio-Rad) were run in parallel in two separate 15% SDS-PAGE gels. One gel contained 600 µL of resuspended L. fermentum 0315 − 25 cell (zymogram), and the other gel contained only 600 µL of buffer (negative control). Each of which was added prior to gel polymerization. Gels were electrophoresed for 1–2 hrs at 150 V until completion. SDS-PAGE gels were stained using LabSafe GEL Blue (G-Biosciences) and washed in deionized (DI) water for 1 hr at room temperature. Additional de-staining incubation was done with gels submerged in de-staining buffer (50 mM Tris-HCl, 1% Triton X-114, pH 5.5) at room temperature with gentle swirling overnight or until translucent bands is clearly visible as described [49].
Turbidity reduction assay. Turbidity reduction assay was performed in Synergy 2 Microplate Reader (BioTek Inc.) with purified LysKB317 protein (described above) diluted in turbidity reduction assay buffer (300 mM NaCl, 30% (v/v) glycerol, 21 mM citric acid, 58 mM NaH2PO4, pH 5.5) to 1 µM concentration. Lactobacillus cultures (listed in Table 1) used in the turbidity reduction assay were prepared as previously described [4]. Briefly, bacterial cells were inoculated in 50 mL MRS media and grown to mid-log phase. Cells were washed in phosphate buffered saline (PBS; pH 7.4, 30% glycerol) before being adjusted to an optical density (OD600 nm) = 2.0. Aliquots of 1 mL of cells were then centrifuged and pellet re-suspended in 1 mL of turbidity reduction assay buffer. Each of the designated experimental wells of a 96-well microtiter plate (flat bottom; Falcon) contained 100 µL bacterial suspension and 100 µL of 1 µM endolysin. Wells containing bacterial cell suspension (100 µL) without endolysin (100 µL turbidity reduction assay buffer) were used to control the rate of autolysis of bacterial cells. Immediately upon addition of endolysin to bacterial suspension, absorbance readings (OD600) were recorded every 30 s for 30 min. Treatment and control wells were run in triplicates. Specific actives were determined by (Δ mOD600 nm/min/µM) described by Becker et al. [50].
Temperature, pH and ethanol sensitivity assays. Thermostability of LysKB317 was determined by placing 1 µM of purified endolysin in turbidity reduction assay buffer at pH 6.0 and at each pre-determined temperature (4°, 21°, 28°, 32°, 37°, 50°, 60°, and 95 °C) and incubated for 0.5, 24, 41, and 72 hrs before performing the turbidity reduction assay described above. In a similar fashion, 1 µM of purified LysKB317 was added to pre-determined turbidity reduction assay buffer at pH 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, and 7.5 for 0.5, 24, and 48 hrs at room temperature prior to performing the turbidity reduction assay as described above for 30 min. Ethanol from 0–30% (g/100 ml) concentrations were added to the LysKB317 buffer for pre-determined amount of time (0–72 hrs) before performing the turbidity reduction assay.
Preparation of small-scale corn mash fermentation. This was done as described in Bischoff et al. and Roach et al. [4, 36]. Briefly, the S. cerevisiae strain NRRL Y-2034 (Table 1) was grown overnight in YP broth supplemented with 5% (w/v) glucose at 32 °C with 200 rpm shaking. The infection L. fermentum strain 0315 − 25 (Table 1) was grown in static MRS media at 37 °C to mid-log phase (OD600 nm = 0.4–0.6). Both yeast and bacteria cells were collected via centrifugation and inocula were re-suspended in sterile phosphate buffered saline (PBS; pH 7.4, Fisher Scientific) to OD600 nm equivalent of 80 for yeast, and OD600 nm equivalent of 8.0 for L. fermentum 0315 − 25. One OD600 nm is approximately 6 × 107 CFU/mL for yeast and 1 × 108 CFU/mL for bacteria. Corn mash (approximately 33% solids) was collected from a commercial dry grind ethanol facility and stored at -20 °C. Verification of aliquots of corn mash samples onto MRS agar did not detect transient bacteria in the mash (< 102 CFU/mL). In separate 50 mL Erlenmeyer flasks, 40 mL corn mash with ammonium sulfate (0.12%, w/v) and glucoamylase (20 µL of Optidex L-500; Genecor International Inc.) was dispensed.
Purified endolysin LysKB317 (1 µM) was added with 0.5 mL S. cerevisiae inoculum and when indicated, 0.5 mL challenged bacterial inoculum were added sequentially at time 0. Each flask was plugged with a rubber stopper containing a 20-gauge 0.9 mm x 40 mm PrecisionGlide needle (Becton Dickinson) to vent excess CO2. Flasks were initially incubated at 32 °C with 100 rpm shaking for 3 hrs to acclimate yeast. All fermentation flasks were briefly removed from the incubator prior to the beginning of the experiment. Designated flasks were then seeded with 0.5 mL of L. fermentum with half of the flasks getting endolysin treatment before all flasks were returned to the incubator (32 °C and 100 rpm shaking). Two-hundred fifty microliters of samples were taken at 0, 0.5, 1.0, 1.5, 4, 48, and 72 hrs and diluted in PBS (pH 7.4, 1:10). Fermentation samples were tittered for bacterial counts on 1.5% MRS agar and yeast inhibitor (100 µg/mL; cycloheximide) by serial dilution plating using the Eddy Jet 2 spiral plater (IUL Instruments) set in the E mode 50 (50 µL sample). Plates were then incubated anaerobically using the Anaero Pack System (Mitsubishi) at 37 °C for 18 hrs [49]. Colony forming unit/mL (CFU/mL) were numerated using a Flash & Go plate reader (IUL Instruments) with ≥ 10 CFU minimum detection limit at 3.3 log10 (CFU/mL). As previously described, a high-performance liquid chromatography (HPLC) system with 300 mm Aminex HPX 87H column (Bio-Rad laboratories, Inc.) was used to quantify presence of acetic acid, galactose, glucose, and lactic acid [36].
Statistical analysis. Where appropriate, experimental results were analyzed using one-way analysis of variance (ANOVA) test (Microsoft Excel 2019).