Chemical reagents
Tris, NaCl, and sodium dodecyl sulfate (SDS) used for molecular biology experiments and buffer preparation were purchased from Sigma-Aldrich. The following antibodies for western blotting analysis were purchased from Cell Signaling Technology: anti-Stat3 (#9139), anti-p-Stat3 (#9145), anti-Src (#2109), anti-p-Src (#12432), anti-Erk (#4696), anti-p-Erk (#4370), anti-GSK3β (#5676), and anti-p-GSK3β (#9327) antibodies. The anti-TOPK (ab236872), anti-p-TOPK (ab250790), and anti-γ-catenin (ab32572) antibodies were purchased from Abcam. The antibodies against β-actin (sc-47778) and tubulin (sc-73242) were purchased from Santa Cruz Biotechnology. The human phospho-kinase arrays were obtained from R&D Systems. RPMI-1640, Dulbecco’s modified Eagle’s medium (DMEM), and minimum essential medium (MEM) were purchased from BI (Bioind, Israel). Fetal bovine serum (FBS) was purchased from Gibico. The TOPK inhibitor, HI-TOPK-032 was a gift from Prof Zigang Dong. The stock solution of HI-TOPK-032 (50 mM) was prepared in dimethyl sulfoxide (DMSO) and stored at −20°C. The working solution of HI-TOPK-032 was prepared by diluting the stock solution to 1000 times and used for in vitro treatment.
Human ESCC tissue array
The tissue microarray was purchased from Shanghai Outdo Biotech Co., Ltd. The information on clinical stages (stage I-IV) (AJCC 7.0) and TNM score was obtained from the patient clinical data. The tissue microarray comprises 10 paired ESCC and adjacent normal tissues with lymph node-negative tissue (N0), 19 N1 ESCC tissues, 10 N2 ESCC tissues, 8 N3 ESCC tissues with lymph node-positive tissue. The expression of TOPK in the ESCC metastasis tissue was evaluated by immunohistochemical staining. The tissue microarray was incubated with the anti-TOPK (1:50) antibody at 4°C overnight. Next, the tissue microarray was washed and incubated with the secondary antibody. The proteins were detected using DAB. The positive cells were graded under a microscope (20 X) and analyzed using the Image J software.
Cell culture
The following ESCC cell lines were purchased from Shanghai Xinyu Biological Technology Co., Ltd.(Shanghai, China): KYSE450 (XY-H600), KYSE510 (AD0604), KYSE140 (AD0602), KYSE70 (XY-H601), and KYSE30 (AD0601). These cells have been authenticated by STR technology of GENEWIZ Co., Ltd (Suzhou, China) and no mycoplasma contamination. The KYSE450 cell line was cultured in DMEM supplemented with 10% FBS. The other ESCC cell lines were cultured in RPMI-1640 medium supplemented with 10% FBS, 100 μg/mL penicillin, and 100 U/mL streptomycin at 37°C and 5% CO2.
Western blot
The cells were lysed in the RIPA buffer [50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 1 mM Na3VO4, and complete EDTA-free protease inhibitor (Roche)] for 20 min on ice. The cells were centrifuged and the supernatant was subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using 10% gel. The resolved proteins were blotted onto a polyvinylidene difluoride membrane (Millipore, USA). The proteins were developed using the enhanced chemiluminescence (ECL) western blotting detection reagent (GE, USA) and analyzed using the LAS-1000UVmini image analyzer (GE, USA).
Lentiviral infections
The lentiviral TOPK constructs, shTOPK#1 (ATTAGTGCATACAGAGAAGAGTT) and shTOPK#2 (GTCTGTGTCTTGCTATGGAAT) were gifts from Prof Zigang Dong. The lentiviruses were engineered by co-transfecting the shRNA-expressing vector with psPAX2 and pMD2.G constructs into the 293T cells using jetPrime reagent. The viral supernatant was harvested and used to infect the cells along with 8 µg/mL polybrene. The cells were selected using 2 µg/mL puromycin to establish the stable KYSE510 and KYSE30 TOPK knockdown cell lines.
Wound healing assay
For wound healing assays, the shMock-, shTOPK#1-, and shTOPK#2-transfected KYSE510 and KYSE30 cells were seeded on 6-well plates containing culture medium at 80% confluency and incubated for 24 h. The confluent monolayer was scratched using a fine pipette tip. The cells were washed twice with phosphate-buffered saline (PBS pH 8.0). The cell debris was removed and the cells were incubated with the growth medium containing 1% FBS. The migration of cells to the injured blank area was evaluated by capturing the images at 0, 24, and 48 h.
Transwell migration assay
Transwell migration assay was performed using the transwell inserts for a 24-well plate. The upper chamber membrane (8 µm; Millipore) was coated with 100 μL of 200 μg/mL Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) at 37℃ for 1 h before adding the cells. The shMock-, shTOPK#1-, and shTOPK#2-transfected KYSE510 and KYSE30 cells were plated in culture medium without serum or growth factors in the upper chamber of 1×105. The lower chamber contained medium supplemented with 20% FBS, which served as a chemo-attractant. After incubating for 24 h, the cells that did not migrate or invade through the pores were removed using a cotton swab. The cells on the lower surface of the membrane were fixed with methanol for 10 min and stained with 0.1% crystal violet. The cells were then counted in 5 randomly selected microscopic fields (×100) in each well.
Protein kinase array
The phosphorylated proteins were analyzed using the human phospho-kinase arrays, following the manufacturer’s instructions. Briefly, the cell lysates (500 μg) of shMock-, shTOPK#1-, and shTOPK#2-transfected KYSE510 cells were collected and incubated with each array at 4°C overnight on a rocking platform shaker. The cell lysate was removed the next day and the arrays were washed thrice with washing buffer. The arrays were incubated with the secondary antibody for 2 h at room temperature (25 ℃) and washed thrice with washing buffer. The array was incubated with horseradish peroxidase (HRP solution on a rocking shaker for 30 min. The array was then washed thrice with washing buffer and the protein spots were visualized using a chemiluminescence detection kit. The density of each duplicated array spot was assessed using the Image J software (v.1.37v, NIH). The density of the sample was calculated after subtracting the background density and the density of negative control (PBS). The expression level in the shTOPK#1- and shTOPK#2-transfected cells was normalized (indicated as a value of 1) to that of the shMock-transfected cells.
Surface plasmon resonance (SPR)
The glutathione-S-transferase (GST)-tagged TOPK proteins were purified from BL21 bacteria using the glutathione-sepharose 4B beads. The anti-GST antibody was immobilized onto the CM5 chip by amine coupling, following the manufacturer’s instructions (GE). The recombinant TOPK (Signalchem, T14-10G-10) and purified GST-tagged TOPK protein (>90%) were captured by the anti-GST antibody on the CM5 chip. The KYSE510 cell lysate was introduced into the CM5 chip at a flow rate of 10 μL/min for 5 min with running buffer (1X kinase buffer, pH 7.2) for one cycle and the captured protein was recycled. The control group did not contain recombinant TOPK or GST-TOPK protein. The SPR procedure was performed at Bicore T200 (GE, USA).
Nanoflow liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS)
The captured proteins bound to the recombinant TOPK, GST-TOPK (TOPK protein was purified by GST tag), and negative group (KYSE510 lysis buffer) in the SPR were subjected to mass spectrometry (MS). The samples were subjected to reduction by incubation with dithiothreitol (DTT) (final concentration 10 mmol/L) for 1 h at 37°C. Next, the samples were subjected to alkylation by incubation with iodoacetamide (final concentration 30 mmol/L) at room temperature for 45 min. Finally, the samples were diluted with 25 mmol/L ammonium hydrogen carbonate buffer to ensure that the urea concentration was below 2 mol/L and incubated with sequencing grade trypsin at a mass ratio of 1:50 at 37°C for 14 h. The LCS-ESI.MS/MS analysis was performed using freeze-dried samples dissolved in 60% acetonitrile (ACN) containing 0.1% formic acid. The sample was passed through a R3 self-loading desalting column conditioned with 99.9% acetonitrile (ACN) and 0.1% trifluoroacetic acid (TFA) twice. Next, the samples were subjected to gradient elution as follows: 0.1% TFA, 1% TFA, with 30% ACN, 60% ACN, 30% ACN. The MS/MS conditions were as follows: mobile phase, solution A (0.1% formic acid, 99.9% H2O), solution B (0.1% formic acid, 99.9% ACN); sample volume, 10 mL; continuous gradient elution; flow rate, 200 nL/min. The analytical column gradient elution settings for the LTQ Orbitrap elite and the MS parameters were as follows: setting mode, cation; collision model, collision-induced dissociation (CID); resolution, 120000; mass range, 350-1800, before top 15 ionic strength. The data were analyzed using the Thermo Proteome Discoverer software (1.4.0.288) with the following settings: databases, Mascot and UniProt; enzyme, trypsin-P; maximum missed cleavage, 2; precursor mass tolerance, 10 ppm; fragment mass tolerance, 0.5 Da; fixed modifications, carbamidomethyl (c); variable modification, Gln>pyro-Glu (N-term q), acetyl (protein N-term), oxidation (M), Phospho (st), and Phospho (y); peptide confidence, high false discovery rate (FDR)<0.01.
Molecular modeling
To confirm whether TOPK binds to γ-catenin, in silico docking was performed using the Schrödinger Suite 2016 software. The TOPK and γ-catenin crystal structures were obtained from the Protein Data Bank (11) (PDB ID: 5J0A and 3IFQ, respectively) and prepared according to the standard procedures of the Protein Preparation Wizard (Schrödinger Suite 2012). The protein-protein docking of TOPK and γ-catenin was performed using the protein docking server with the interactive molecular graphics program (12). The best configuration was selected to represent the binding mode.
Immunofluorescence assay
Immunofluorescence assay was performed using the primary antibodies against TOPK and γ-catenin. The samples were then incubated with the fluorescein-conjugated affinity pure goat anti-mouse IgG or rhodamine (TRITC)-conjugated affinity pure goat anti-rabbit IgG secondary antibodies (1:2000) for 1 h. The samples were mounted on coverslips along with 4′, 6-diamidino-2-phenylindole (DAPI) (Santa Cruz TM). The images were captured and analyzed using high-throughput confocal microscopy (IN Cell Analyzer 6000, GE).
Co-immunoprecipitation
For co-immunoprecipitation studies, the HEK293 cells were transfected with 4 μg pcDNA3-HA-TOPK and/or pDEST-myc-γ-catenin using jetPRIME reagent (Polyplus-transfection® SA, France) for 72 h. The protein was isolated in CHAPS buffer (as previously described) supplemented with protease inhibitor cocktail (Roche). The lysates were centrifuged at 14500 g for 30 min. Next, 500 μg protein in 500 μL was incubated with anti-hemagglutinin (HA) antibody overnight at 4°C. The samples were then incubated with secondary antibodies (sc-2004, Santa Cruz) immobilized on A/G agarose (40 μL) for 4 h at 4°C. The collected protein complexes were washed thrice with cold PBS and eluted by boiling in loading buffer at 95°C, followed by incubation on ice for 2 min. The myc protein was resolved by SDS-PAGE and analyzed by western blotting.
Lung metastasis in ESCC cell xenograft mouse models
The stable GFP-KYSE510 cells were established by transferring the pcDNA3.1-green fluorescent protein (GFP) vector and screened using G418. The GFP signal of KYSE510 cells was evaluated using the IVIS® Lumina III In Vivo Imaging System. Next, the GFP-KYSE510 cells (2×106 cells/mL) were injected into the tail vein of BALB/c nude mice, which were purchased from Vital River, Beijing, China. After two weeks, these mice were divided into vehicle and treatment groups. The vehicle group was treated with 5% DMSO-PBS (n=12, 6 females and 6 males), while the treatment group was injected with HI-TOPK-032 (n=13, 7 females and 6 males). The mice in the treatment group were treated with HI-TOPK-032 was dissolved in 5% DMSO-PBS and was given to each mouse in treatment group once daily at 10 mg/kg (i.p., 100µL per mouse). Four to five mice were kept in a pathogen-free environment with light controlled rooms (12 h cycles) and provided with food and water ad libitum. After two weeks, the mice were subjected to in vivo imaging. The fluorescence of GFP was evaluated as described previously (13). The mice were euthanized by CO2 inhalation. The lung tumor tissues were used to evaluate the changes in the signaling pathways. This study was approved by the Ethics Committee of Basic Medical College of Zhengzhou University.
Statistical analysis
All data are expressed as mean ± standard error (SEM) and all comparisons between samples were evaluated using the two-tailed non-parametric Mann-Whitney test and one-way or two-way analysis of variance (ANOVA) followed by Bonferroni post hoc test. The p values obtained from the tests are described in the Figure legends. Statistical significance is denoted as follows: * for p<0.05, ** for p<0.01, and *** for p<0.001.