2.1. Preparation of the biomaterial scaffolds
2.1.1 Nanocomposite xerogels (B30 and B30Str)
The silica-collagen nanocomposites were kindly provided from the Max Bergmann Center of Biomaterials and Institute of Materials Science from Dresden University of Technology and preparation was carried out as described by [11, 22]. Our investigations were performed with xerogel granules. Therefore, the silica-collagen monoliths were ground into a powder and then classified into different particle fractions. In these investigations fractions with a particle size < 0.125 mm were examined.
2.1.2 CultiSpher-S Microcarrier (MC)
Preparation of the CultiSpher macroporous gelatin microcarriers was performed according to the company instruction (Percell, Biolytica AB, Sweden). Briefly, the dry MC were rehydrated in phosphate buffered saline (PBS, 1g/50 mL) for one h then were autoclaved at 121 °C for 15 min. The PBS was removed and fresh PBS was added then MC were washed three times in culture medium. Generally, 1x 105 cells were mixed with 0.1 % MC in DMEM for all experimental setups.
2.2. Isolation of adipose tissue derived MSCs
Experiments were accomplished from equine adipose mesenchymal stem cells MSCs (N=8; aged 7.66 ± 1.34 years). Equine MSCs of both sex were examined as previously reported by (Elashry et al., 2018). Briefly, the adipose tissue was obtained from the subcutaneous fat from horses being slaughtered at the local abattoir and the Institute of Veterinary Pathology, Justus- Liebig University in Giessen. MSCs were transferred in cold PBS supplemented with 1 % penicillin-streptomycin (P/S, Gibco® life technologies, Germany). Adipose tissue samples were cut into 1mm2 pieces using sterile scalpel then were washed twice in PBS for 5 min. The samples were digested under shaking in 0.1 % collagenase I (Biochrom AG, Germany) in 1 % bovine serum albumin dissolved in PBS for 60 min at 37 °C. The homogenates were filtered in 70 µm cell strainer and were centrifuged at 240 g for 5 min. The supernatant was discarded and the pellets were suspended in fresh Dulbecco’s Modified Eagle’s Medium (1g/L, DMEM, Gibco® life technologies, Germany). The cells were counted using a hemocytometer, were expanded in DMEM containing 10 % foetal bovine serum (FBS, Biocell, Germany) and 1 % P/S growth medium within the T75 culture flasks. The cells were incubated at 37 °C, 5 % CO2 and 90 % humidity up to confluency. In the current study, MSCs were characterized either by flow cytometry using the surface marker CD90 also using PCR for the expression of stem cell markers CD90, CD 105 and Oct 4 as previously reported by our group [28, 29]. Upon confluency, cells were detached using TryplE (Gibco® life technologies), were counted using a hemocytometer and were stored in 1 mL aliquots at -160 °C. Medium change was carried out twice a week and cells of passage 2-4 were used for the following experiments. After expansion, 4x106 cells and 20 mg of MC and B30 biomaterials were cultivated in 10 mL growth medium using two different settings: a static culture in falcon tubes (Sarstedt, Germany) and a rotating bioreactor (Rotary cell culture systems, Synthecon Inc., Houston, TX, USA). To enable proper gas exchange, the falcon lid was perforated before incubation. In the rotating culture, the vessel was allowed to perform 11 cycles/min. Both settings were incubated at 37 °C with 5 % CO2 for four days without carrying out a medium change. Afterwards, the medium with biomaterial-cell- complexes (from both experimental settings) was carefully transferred to a new 15 mL falcon tube. Two washing steps followed by 5 min interval until all complexes were precipitated. The latter was suspended in 10 mL fresh medium for 5 min to select all non-attached cells using various sedimentation speed. The harvested complexes were used for the consecutive experiments.
2.3. Histological staining
The biomaterial-cell-complexes were fixed with 4 % paraformaldehyde (PFA, Roth, Germany) for 20 min at 4°C followed by two washing steps in distilled water. The cell biomaterials complexes were dehydrated in ethanol (Roth, Germany), cleared in xylene (Roth, Germany) and were processed for paraffin embedding. Sections of 6 µm were produced using a microtome(Leica, Germany), were transferred to glass slides (Roth, Germany) and were processed for hematoxylin and eosin histological staining to get an overview of cell-biomaterial interaction. The sections were mounted using Eukitt mounting media (HICO-MIC, Hirtz & Co, Germany) and were examined using light microscopy microscope equipped with a digital camera and the LAS V4.4 software (Leica, Germany).
2.4. Phalloidin staining
Complexes were fixed in 4 % PFA, were washed twice for 5 min interval and were then incubated with phalloidin, an actin filaments cytoskeleton staining (2, 5 %, Sigma-Aldrich, Germany) for 30 min. The nuclei were counterstained with 0. 05 % Hoechst dye in TBS for five min (Invitrogen, USA). After the complexes were stained, they were transferred in PBS buffer on a microscopic slide and were examined using fluorescence microscope (Axio Observer.Z1, Carl Zeiss, Germany).
2.5. Scanning electron microscopy
To examine the morphology of the biomaterial surface and the appearance of attached cells, a scanning electron microscopy (SEM) was performed. Cell-biomaterial complexes were fixed in 2 % glutaraldehyde in cacodylate buffer (Merck, Germany). The specimens were dehydrated in ethanol gradient for ten min and afterwards, were coated by hexamethyldisilazane (Merck) overnight. After drying, they were sputter-coated with Au/Pd with a Balzer sputter coater (SCD 020, Balzers Union, Germany) and examined by Digital Scanning Microscope (DSM 940, Zeiss at 15kV and 16 mm working distance). The cell biomaterial complexes were photographed using a Digital Image Scanning System 5 and Digital Image Processing System 2.9 (Point Electronic, Germany).
2.6. Transmission electron microscopy (TEM)
To assess the ultramicrocellular morphology of the cell-biomaterial in combined culture, the complexes were fixed in cacodylate buffer solution (pH 7.2) containing 2 % PFA, 0.02 % picric acid (Fluka, Germany) and glutaraldehyde (Sigma Aldrich, Germany) for 24 hours at 4°C. After that, the complexes were post fixed in 1% osmium tetroxide (Sigma Aldrich, Germany) in 0.1 M cacodylate buffer for two hours at room temperature. The complexes were counterstained with 0.5 % uranyl acetate (Delta microscopy) for 30 min and 0.2 % lead citrate for 80 sec. Then, complexes were dehydrated and embedded in Peon (Sigma-Aldrich). Ultrathin 70nm sections were generated using an ultramicrotome (Reichert - Jung Ultracut, Leica Microsystems) and were examined using a TEM (EM 109, Zeiss, Germany).
2.7. Life cell imaging
To investigate the cell viability and the capacity to spread out from the biomaterial after having attached on their surface, life cell imaging was carried out. Cell-biomaterial complexes were placed into a 35x10 mm culture dish (VWR, Germany) with 3 mL basic medium and then incubated for 60 min under standard culture conditions. Life cell imaging was implemented using Axio Observer Z1, Temp Module S, CO2 Module S, Zeiss, Germany). Incubation parameters were established at 37 °C and 5 % CO2. The images were taken every 15 min up to 72 h. The analysis was performed using the Axiovision Imaging Software (Zeiss, Germany). Furthermore, the complexes were seeded in 24-well plastic dishes and were incubated for 24 h under standard conditions with basic medium. After this, cells were fixed in 4 % PFA for 20 min and were stained in phalloidin.
2.8. MTT cell viability assay
To evaluate the viability of cells already attached on the biomaterial, a colorimetric MTT assay was performed. Viable cells are able to reduce the yellow substrate MTT (3- 4, 5-Dimethylthiazol-2yl -2, 5- diphenyltetrazoliumbromid, Sigma-Aldrich, Germany) to the insoluble blue formazan, the later can be solubilized and measured by a spectrophotometer reader at a specific wavelength. Therefore, 2x106 cells with MC, B30 and B30Str were incubated in the two mentioned settings for 4 days. After washing twice in basal medium (BM), the cells and biomaterials were incubated with MTT for 12 h. The cells were lysed with 200 µL of Dimethylsulfoxid (DMSO, AppliChem, Germany) together with a tissue Lyser in oscillation frequency of 50 HZ (Quiagen, Germany) for 5 min. Hereafter, the color intensity was measured by a microplate reader at 570 nm (Tecan, Germany) and was analysed with Magellan TM – Data Analysis Software (Crailsheim, Germany).
2.9. Osteogenic differentiation induction
To examine the osteogenic differentiation capacity of combined cultivation of MSCs together with biomaterial (B30, B30Str and MC), the cells were cultivated in growth medium for 48 h to facilitate cell attachment on biomaterials. The cells were allowed to differentiate in osteogenic medium containing DMEM, 5 % FBS, 0.05 mM ascorbic acid-2-phosphate (Sigma-Aldrich, Germany), 10 mM β-glycerolphosphate (Sigma-Aldrich, Germany) and 0.1 µM dexamethasone (Sigma-Aldrich, Germany) up to 21 days. Cells were provided with fresh medium twice a week. Cells were incubated in parallel either in BM (5 % FBS in DMEM and 1 % P/S) or osteogenic differentiation medium without biomaterials were served as control (NC). Osteogenic differentiation was assessed by evaluating the morphological alteration, histological examination using alizarin red S (ARS) staining, alkaline phosphatase (ALP) activity and osteogenic relative markers at day 7, 14 and 21 post induction.
2.10. Mechanical fluid shear stress
MSCs were seeded in combination with MC, B30 and B30Str in a ratio 1x105 per well in a 24-well culture plates (VWR, Germany. After 48 h, the growth medium was replaced by the osteogenic differentiation medium (OD). The plates were divided into two experimental groups; static (ST) and mechanical fluid shear stress (FSS) culture conditions. In the latter, the cells were incubated under a regular vertical rocking pattern. To optimize the mechanical stress, a rocking angle of 10° with a frequency of 40 turns/min and a fluid depth of 3.13 mm were generated. The formula for the FSS calculation was previously described by [30]. The assumed fluid viscosity of 10-3 Pa s, the FSS was 77.21 mPa (in non SI-units 0.77 dyn/cm²) at the center of the dish bottom. The experimental setup guaranteed that the cells were covered with medium during plates cycling. In parallel, cells were grown in parallel in BM served as negative control.
2.11. Alizarin Red S staining (ARS)
ARS specific dye with affinity to “Ca2+” used as an indicator for Ca2+ deposition in the mineralized matrix. Fixed cells in 4 % PFA were washed in distilled water three times at 5 min interval. The cells were incubated with 1 % ARS staining solution (pH 4.2) (Roth, Germany) at room temperature for 30 min. Excess of staining was washed three times in distilled water for 5 min to remove the unbound dye. The morphological alterations following each time point were examined and were photographed using light microscope equipped with a digital camera and the LAS V4. 4 Software (Leica, Germany).
2.12. Semi-quantification of ARS staining
ARS stained cells were washed twice in distilled water then were incubated with a volume of 2 mL of 10 % Cetyl Pyridinium Chloride (CPC, Roth Germany) with a moderate shaking for 60 min. An equal volume from each experimental group was transferred to a 96-well microplate. The absorbance was measured in triplicates at 562 nm using microplate reader (Tecan, Germany).
2.13. Measurement of alkaline phosphatase (ALP) activity
Cells were incubated with 500 µL of 1 % TritonTM X-100 in 10 mM Tris (pH 7.4) at 4 º C for 60 min. The cells/biomaterials complexes were transferred into a 1.5 mL Eppendorf tube. Cell lysates were centrifuged at 28400 g for two min at room temperature and kept on ice. P-Nitrophenylphosphate (2 mg/mL) was dissolved into buffer solution containing 1M Tris and 5 mM MgCl2 (pH 9.0). A volume of 50 µL of cell lysate were incubated with 150 µL of p-Nitrophenylphosphate solution for up to 30 min. The mixtures were loaded in triplicates into a 96-well microplates. The standard of p-nitrophenol solution was used to prepare the standard curve. ALP potency to hydrolyze p- Nitrophenylphosphate into p-Nitrophenol (PNP) was measured as previously reported [31]. The absorbance was measured at 405 nm by using a microplate reader. The rate of ALP activity was measured using the equation, Y = mx+b. Where, x= sample absorbance value and Y= pNP concentration of samples.
2.14. Real-time quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from cells cocultivated with MC, B30 and B30Str at day 7, 14 and 21 post osteogenic induction using an innuPREP RNA mini kit (Analytik, Jena AG, Germany) and was quantified using a UV-Spectrophotometer (Bio-Photometer, Eppendorf AG). Cells in parallel were examined either incubated in BM or osteogenic medium without biomaterials were served as controls (NC). Briefly, RNA samples were incubated with 3.9 µL per sample DNase mix containing 1.2 µL of 25 mM MgCl2, 1.2 µL DNase buffer I, 1.2 µL DNase I and 0.3 µL RNase inhibitor in 100 µL PCR tubes. The mixture was incubated at 37 °C for 25 min then at 75 °C for 5 min in a thermal cycler (Bio-Rad, Germany). RNA samples were reverse transcribed into cDNA in a master mix containing 45 µL RT-Mix, 3µL RNase inhibitor and 3 µL reverse transcriptase multiscribe (Promega). The reaction was generated at 21°C for 8 min, at 42 °C for 15 min, at 99 °C for 5 min, at 5 °C for 5 min in the Bio-Rad thermal cycler. To examine the validity of the PCR reaction and the quality of the primers, a qualitative PCR reaction was performed. All primers were purchased from (microsynth, Germany) and were listed in table (1). Glyceraldehyde-3-phosphat dehydrogenase (GAPDH) was used as an endogenous reference. PCR fragments were allowed to run in a 2 % agarose gel electrophoresis at 180 V for 20 min and were examined under UV light. Relative osteogenic markers Runx2 and ALP were quantified using RT-qPCR after 14 and 21 days. The reaction of 1 µL of cDNA template with 9 µL of a mixture composed of 5 µL 2 x SYBR Green PCR Master Mix (Bio-Rad), 0.6 µL of 10 pM forward and reverse primers mix and 3.4 µL nucleic acid free water was carried out. The samples were loaded in triplicates in a 96-well PCR plates in a real time cycler (CFX96, Real-Time PCR Detection System, Bio-Rad). The following PCR condition was followed; activation at 95 °C for 2 min, 40 cycles at 95 °C for 15 sec, and 60 °C for 30 sec, followed by a melting curve (60-95 °C for 3 sec). PCR-Mix without adding cDNA was served as a negative control. The qPCR data was relatively normalized to GAPDH expression. The expression of each target gene was analyzed using 2-ΔΔCt equation as reported by [32].
2.15. Statistical analysis
The influence of combined osteogenic induction together with MC, B30 and B30Str biomaterials on the osteogenic differentiation of MSCs were investigated. Data were collected under static (ST) and mechanical fluid shear stress (FSS) conditions at days 7, 14 and 21 post induction. In order to analyze the effect of biomaterials (MC/SC, MC/RC, B30/ST and B30/RC) on cell viability compared to BM, One way ANOVA was carried out. To evaluate the effect of biomaterials (MC vs. B30) at different time point (T0 up to 72 h) on the migration capacity of MSCs, a two-way ANOVA was examined. To assess whether various biomaterials alter the migration potential of MSCs, a two-tailed Pearson (r) correlation coefficient analysis was carried out. The effect of osteogenic induction (OD vs. BM) concurrently with biomaterials (MC, B30 and B30Str vs. NC) on cell viability, ALP activity, ARS staining and the osteogenic related markers (Runx2 and ALP) expression, a two-way ANOVA was carried out. Multiple comparisons were tested using Tukey’s and Sidak’s post hoc tests. The data from triplicates presented as the mean ± SEM and p value ≤ 0.05 was considered to be significant. All the statistical analyses were carried out using Graph Pad Prism 7.0 (La Jolla, Canada).
Table 1
Primers sequences used for RT-qPCR analysis
Gene | Forward | Reverse | Size (bp) |
GAPDH | CCAGCAAGAGAAGGAGAAAGG | AACTGTGGAGGTCAGGAGAC | 93 |
Runx2 | ACCGACAGCCCCAACTTC | ACCCGCCATGACAGTAACC | 132 |
ALP | GACTGGTACTCGGACAACGAG | GTTCTTGGGGAACATGTACTTC | 137 |