Prevalence and molecular characterization of Group B streptococcus in pregnant women from hospitals in Ohangwena and Oshikoto regions of Namibia.

doi:10.21203/rs.3.rs-38355/v2

Download PDF

Research article

Prevalence and molecular characterization of Group B streptococcus in pregnant women from hospitals in Ohangwena and Oshikoto regions of Namibia.

https://doi.org/10.21203/rs.3.rs-38355/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 05 Aug, 2021

Read the published version in BMC Microbiology →

You are reading this latest preprint version

Background

The main purpose of this study was to investigate the prevalence rate, antimicrobial susceptibility patterns and molecular characteristics of Streptococcus agalactiae isolated from pregnant women at 35 weeks of gestation and above, who attended antenatal screening at selected hospitals in Ohangwena and Oshikoto regions of Namibia.

Results

Out of 210 women screened for GBS, 12 (5.7%) were colonised of which 25.0% were colonised rectovaginally, 58.0% vaginally and 17.0% rectally. No significant association was reported between GBS colonisation and maternal age, geographic location, marital status, education, employment, parity, still births and miscarriages (P values >0.05). Antimicrobial susceptibility was reported at 100% for ampicillin, penicillin & ceftriaxone. Resistance to tetracycline was reported at 100%. Tetracycline resistance gene tet(M) was present in 88.9% of the isolates only and none of the isolates presented with tet(O). Polysaccharide capsular type Ia was found in 9(50%) and Ib was found in 1(5.5%) of the total isolates. The remaining isolates were not typeable using PCR.

Conclusion

Streptococcus agalactiae’s positive rate was 5.7% among the pregnant women examined. Socio-demographic and obstetric factors had no influence on GBS colonisation (P values >0.05). No resistance was reported to ampicillin, penicillin and ceftriaxone. No sensitivity was reported to tetracycline. Fifty percent of the isolates were capsular type Ia, 5.5% were type Ib and 44.4% were not typeable using PCR. The study provides crucial information for informing policy in screening of GBS in pregnant women.

General Microbiology

Obstetrics & Gynecology

Group B streptococcus

molecular characterization

antimicrobial susceptibility

Streptococcus agalactiae (S. agalactiae) is a gram-positive bacterium which belongs to the Lancefield Group B streptococcus (GBS). It is part of the normal flora of the gastrointestinal and female genitourinary tracts, and it is present in the genital tract of about 20 – 60% of pregnant women¹. Nearly 20 – 40% of healthy women are colonised by GBS, and 50 – 70% of infants born to these mothers become infected with it².

Group B streptococcus is a leading cause of neonatal sepsis and meningitis worldwide³. It is widely implicated in maternal infections such as endometritis and chorioamnionitis as well as neonatal infections such as pneumonia, meningitis, sepsis and septicaemia⁴. Mortality of GBS in neonates is over 50% and is particularly high in preterm infants³. Vaginal colonisation by GBS during pregnancy is associated with premature delivery and still births¹.

The median prevalence of GBS in pregnant women in Africa was reported at 16% in 2009⁵. The prevalence in Windhoek, Namibia was reported at 13.6% in 2016⁶. Furthermore, the colonisation rate in other Southern African countries was reported at 31.6% in Zimbabwe in 2000⁷, 37% in South Africa in 2018^{8; 9}, 21.2% in Malawi in 2010¹⁰ and 1.8% in Mozambique in 2008¹¹.

Most studies done in Africa have shown a uniformity in sensitivity of GBS to penicillin and ampicillin which are the recommended drugs for prophylaxis against GBS. The Centres for Diseases Control and Prevention (CDC) recommends GBS screening in women at 35 – 37 weeks of gestation. Prophylaxis is given to pregnant women who are colonised by GBS, deliver infants with invasive GBS disease or are of unknown GBS status at delivery to prevent neonatal infection¹². However, erythromycin & clindamycin are recommended for patients who are allergic to penicillin¹². Gene based resistance in GBS is encoded by ermB, ermA, ermTR, mefA, mefE, aphA-3, aad-6, tet(M), tet(O), int-Tn and mreA¹³. Despite the availability of the CDC guidelines, Namibia has not adopted an approach to screen for GBS in pregnant women.

Group B streptococcus is classified into ten common capsular types based on capsular polysaccharide antigens on the surface of the organism. These capsular types are Ia, Ib, II, III, IV, V, VI, VII, VIII and IX^{14; 15}. The most prominent capsular types in Southern Africa are type Ia, Ib, II, III and V^{16; 17; 18; 7; 19; 8}. The capsule is the main virulence factor for GBS. The study aimed to determine the prevalence and molecular characteristics of group B streptococcus isolated from pregnant women from selected rural settings of Namibia.

Prevalence of Group B streptococcus

A total of 12 out of the 210 participants, (5.7%) tested positive for GBS colonisation, of which 7 (3.3%) tested positive with vaginal swabs and 2 (1.0%) tested positive with rectal swabs. A total of 3 (1.4%) out of 210 participants tested positive with both rectal and vaginal swabs.

This study assessed the influence of different socio-demographic characteristics, age and obstetric factors on the rate of GBS colonisation in pregnant women screened.

The age of pregnant women screened in this study ranged from 16 – 49 years with mean age of 29 years and standard deviation of ± 7. Out of the total 210 pregnant women, 174 were living in rural, 9 in semi-urban and 27 in urban areas. One hundred and sixty (160) women were not married, while 50 were married. Those with qualifications below matric were 156, those with matric qualifications were 51 and those with tertiary qualifications were only 3. Unemployed women were 168 and employed women were 42.

Out of the twelve colonised women, 75.0% was women aged between 20 – 39 years and 25.0% was women aged 40 years and above (P value 0.209). Majority of colonised women were rural based women (83.3%) than urban living women (16.7%) (P value 0.708). Unmarried women colonised by GBS were 75.0% and 25.0% of colonised women were married (P value 0.921).

Majority of colonised women were those with educational level below matric (58.3%) than those with matric qualifications (41.7%) (P value 0.333). The same scenario was found in terms of employment status, whereby 66.7% of unemployed women were colonised and only 33.3% of colonised women were employed (P value 0.234).

Majority of GBS colonised were unmarried, unemployed and rural based women aged between 20 – 39 years who never matriculated. Table 1 illustrates the rates of GBS colonisation based on various socio-demographic factors.

Table 1: Association between socio-demographic factors and GBS colonisation

Characteristic	Category	GBs non-colonised frequency (n = 198)	GBS colonised frequency (n = 12)	P value
Age in years	Below 20 20 – 39 40 and above	12 (6.1%) 166 (83.8%) 20 (10.1%)	0 (0.0%) 9 (75.0%) 3 (25.0%)	0.209

Geographic location	Rural Semi-urban Urban	164 (82.8%) 9 (4.5%) 25 (12.6%)	10 (83.3%) 0 (0.0%) 2 (16.7%)	0.708

Marital status	Not married Married	151 (76.3%) 47 (23.7%)	9 (75.0%) 3 (25.0%)	0.921

Educational level	Below matric Matric Tertiary	149 (75.3%) 46 (23.2%) 3 (1.5%)	7 (58.3%) 5 (41.7%) 0 (0.0%)	0.333

Employment status	Unemployed Employed	160 (80.8%) 38 (19.2%)	8 (66.7%) 4 (33.3%)	0.234

Among all GBS colonised women, women of with three or more successful pregnancies were 50.0%, while those with either one or two were 33.0% and those without any previous pregnancy were 16.7% (P value 0.659). Carriage of GBS was only shown in women without previous history of still births (P value 0.613). GBS colonised women without any history of miscarriages were 83.3% while those with a history of either 1 or 2 miscarriages were 16.7% (P value 0.471). Table 2 illustrates the association between obstetric factors and GBS colonisation.

Table 2: Association between obstetric factors and GBS colonisation

Characteristic	Category	GBS non-colonised frequency (n = 198)	GBS colonised frequency (n = 12)	P value
Parity	0 1 – 2 ≥3	43 (21.7 %) 82 (41.4 %) 73 (36.9 %)	2 (16.7 %) 4 (33.3 %) 6 (50.0 %)	0.659

Still births	0 1 – 2 ≥3	183 (92.4 %) 13 (6.6 %) 2 (1.0 %)	12 (100 %) 0 (0.0 %) 0 (0.0 %)	0.613

Miscarriages	0 1 – 2 ≥3	178 (89.9 %) 20 (10.1 %) 0 (0.0 %)	10 (83.3 %) 2 (16.7 %) 0 (0.0 %)	0.471

The culture of rectal and lower vaginal swabs by both direct BCNA agar and Todd-Hewitt-BCNA agar yielded a total of 18 CAMP positive GBS isolates recovered from 12 women. These isolates were confirmed as S. agalactiae using real time PCR, in which the target gene scpB for C5a peptidase gene was amplified. Following gel electrophoresis, DNA amplicons approximately 255 base pairs on the gel were identified as S. agalactiae as previously described by Dmitriev et al., 2004. No sequencing was performed in this study.

Antimicrobial susceptibility patterns

All 18 GBS isolates obtained from this study were tested individually for antimicrobial susceptibility to each of the antibiotics used, and all showed 100% susceptibility to penicillin, ampicillin, ceftriaxone, clindamycin, erythromycin, vancomycin, linezolid and chloramphenicol. All isolates revealed 100% resistance to tetracycline. Intermediary sensitivity and inducible clindamycin resistance were reported for any organism. The frequencies of antimicrobial susceptibility patterns are illustrated in Table 3.

Table 3: Frequency of antimicrobial susceptibility patterns of GBS isolates

Antimicrobial agent	Percentage of GBS antibiotics sensitive, intermediate and resistant
	Sensitive (S)		Intermediate (I)			Resistant (R)
	Frequency	Percentage	Frequency	Percentage		Frequency	Percentage
Penicillin	18	100%	0	0%		0	0%
Ampicillin	18	100%	0	0%		0	0%
Ceftriaxone	18	100%	0	0%		0	0%
Erythromycin	18	100%	0	0%		0	0%
Clindamycin	18	100%	0		0%	0	0%
Vancomycin	18	100%	0		0%	0	0%
Tetracycline	0	0%	0		0%	18	100%
Linezolid	18	100%	0		0%	0	0%
Chloramphenicol	18	100%	0		0%	0	0%

Ceftriaxone was performed using Kirby-Bauer disc diffusion method for all isolates

Consistent minimum inhibitory concentrations (MICs) were observed in most antibiotics. These include ampicillin (≤0.25µg/L), penicillin (≤0.12µg/L), clindamycin (≤0.25µg/L), chloramphenicol (≤10µg/L) and tetracycline (≥16µg/L). The highest MIC value reported in erythromycin was 0.5µg/L and the lowest was ≤0.25µg/, which were all considered sensitive.

The highest MIC value reported for vancomycin was 4µg/L and the lowest was ≤ 0.5µg/L, which were all considered sensitive. Linezolid was reported sensitive with MICs ranging from 1µg/L to 2µg/L. The smallest inhibitory zone reported for ceftriaxone was 25mm and the biggest was 33mm which were all considered as sensitive.

Gene based resistance of GBS isolates

All isolates were tested for the presence of tetracycline resistance genes i.e. tet(M) and tet(O) with multiplex PCR, using previously described primers (Poyart et al., 2003 & Zeng et al., 2006). In total, 16 isolates possessed tet(M) whereas tet(O) was found in none of the isolates, although they were all phenotypically resistant to tetracycline. Amplicons for tet(M) have 347 base pairs and for tet(O) have 548 base pairs (Poyart et al., 2003).

Polysaccharide capsular typing

Following the amplification and electrophoresis, 9 isolates presented with amplicons of 521 base pairs and 1 isolate with an amplicon sized 770 base pairs. An amplicon of 521 base pairs is associated with capsular polysaccharide Ia whereas 770 base pairs is associated with capsular type Ib. Polysaccharide capsular type Ia was found in 9 (50%) of isolates and Ib was found in 1 (5.5%) of the total isolates. The remaining eight (44.4%) isolates could not be classified using PCR. Polysaccharide capsular type IX was not assessed in this study.

The prevalence of GBS among pregnant women found in this study (5.7%) was lower compared to what was reported in a similar study conducted in Windhoek, Namibia in 2016, whereby the prevalence of GBS colonisation was reported at 13.6% 2016⁶. Different recruitment centres were included in the current study, which comprise of a different population characteristic from the study by Engelbrecht et al. The prevalence in this current study is lower than the 31.6% found in Zimbabwe in 2000⁷, 30.9% in South Africa in 2012^{17; 9}, 37% in South Africa in 2019⁸ and 21.2% in Malawi in 2010¹⁰.

The findings of this current study are similar to those reported in a Mozambican study, whereby a colonisation rate of 1.8% was obtained¹¹. However, in the Mozambican study swabs were inoculated in Todd-Hewitt broth with only gentamycin (8µg/ml of agar) and the broth was sub-cultured onto human blood agar. The use of gentamycin alone without nalidixic acid can cause overgrowth of enterobacteriaceae organisms over GBS, hence reducing the growth of GBS. Furthermore, human blood used in preparation of blood agar might have contained inhibitory substances against the growth of GBS¹¹.

GBS colonisation was not associated with age, geographic location, marital status, educational level and employment status. This study revealed that 75.0% of colonised women were aged between 20 – 39 years and 25.0% were aged 40 years and above. There was however no statistical significant association between GBS colonisation and age (P value 0.209). A similar study conducted at Dr George Mukhari hospital, South Africa found majority of GBS colonised women to be aged between 25 and 29 years, which was also not statistically significant (P value 0.07)⁹. There was a significant association between maternal age and GBS colonisation in pregnant women screened at the maternity and children hospital in Makkah, Saudi Arabia (P value 0.002)²².

In the current study, 83.3% of colonised women were rural based and 16.7% were urban based. This difference was however not statistically significant (P value 0.708). In a similar study conducted in Dr George Mukhari hospital, South Africa, more of the colonised women were dwelling in the urban areas⁹. This finding was however also not statistically significant (P value 0.08). It was observed in this study that majority of GBS colonised women were not married (75.0%), compared to married women (25.0%). There was however no significant statistical association between GBS colonisation and marital status (P value 0.921). This agrees with the study conducted at Dr George Mukhari hospital, South Africa, which reported that the majority of colonised women were single, divorced or widowed followed by cohabiting women (P value 0.56)⁹. In another study conducted in Windhoek by Engelbrecht et al., 2016, more single women were colonised compared to married women (P value 0.315)⁶. Both findings were not statistically significant.

Furthermore, GBS was more prevalent in women who had no formal secondary education (58.3%), with a decrease in colonisation observed as educational level increased, although this was not statistically significant (P value 0.333). A slight decrease in GBS colonisation with increase in educational level was also observed in the study conducted in Windhoek, although this was also not statistically significant (P value 0.729). Educational level was found to have a significant influence on GBS colonisation in pregnant women in the South African study (Dr George Mukhari hospital), whereby women with tertiary level of education were found to have lower colonisation compared to women with and without secondary education (P value < 0.0001)⁹.

GBS colonisation was higher in unemployed women than those employed as reported in this current study, with percentages of colonisation being 66.7% and 33.3% respectively. This was however not statistically significant (P value 0.234). On the contrary, a slightly large number of GBS colonised women was found to be employed women as revealed in the study conducted at Dr George Mukhari hospital⁹, and in Windhoek⁶. The relationship between employment and GBS colonisation was however not statistically significant in the Windhoek study (P value 0.125)⁶, while in the South African study it was statistically significant (P value 0.003)⁹.

Group B streptococcus colonisation did not appear to be linked to obstetric factors such as history of miscarriages and still births, as women with no history of still births and miscarriages were largely colonised (100% and 83.3% respectively). These findings did not have any statistical significance (P value 0.613 and 0.471 respectively). However, GBS colonisation had shown to increase with parity, 50.0% in women with parity exceeding two, 33.3% in women with one or two previous deliveries and 16.7% in women without previous deliveries. This was however not statistically significant (P. value 0.659). In the Saudi Arabian study conducted at Makkah, a significant statistical association was found between parity and GBS colonisation²².

Similarly, GBS colonisation did not appear to be linked to history of miscarriages and still births in the South African study, as the carriage rate was greater in women who had no history of miscarriages and still births compared to the opposite. These were equally not statistically significant findings (P value 0.33 and 0.24 respectively)⁹. In contrast to the findings of this current study, a study by⁹, 2016 in South Africa reported that women with multiple deliveries exceeding two were less affected by GBS compared to women who had one to two deliveries and those with zero parity. However, there was no statistical significance (P value 0.24)⁹.

In the current study, GBS showed sensitivity to penicillin, ampicillin, ceftriaxone, vancomycin, chloramphenicol and linezolid by 100%. This correlates with the findings of the study done in Windhoek, where 100% susceptibility was reported to penicillin, ampicillin, ceftriaxone, vancomycin and linezolid. All isolates were found to be sensitive to clindamycin and erythromycin by 100%. This does not correlate with findings of the Windhoek study, whereby 88.9% sensitivity and 11.1% resistance was reported for erythromycin, while for clindamycin 72.6% sensitivity, 18.8% intermediate sensitivity and 8.5% resistance was reported⁶.

Since only 18 GBS isolates were obtained from the current study, 100% susceptibility to clindamycin and erythromycin might not be a true reflection of the antimicrobial susceptibility patterns of GBS in the two regions, as a bigger number of isolates might have reflected a different picture. Furthermore, this current study revealed a 100% resistance to tetracycline, while the previous study has revealed 94.9% resistance to tetracycline and 5.1% susceptibility thereof. This differences may be attributable to the differences in the locations of the two studies and also different sample sizes. High levels of resistance to tetracycline are an indication of growing resistance to commonly used antibiotics by GBS, especially to tetracycline which is still commonly used in both humans and animals^6-11.

The findings of our study are in correlation with another study conducted in Ayder referral hospital and Mekelle health centre, Mekelle, Northern Ethiopia, whereby GBS was reportedly 100% susceptible to penicillin, ampicillin, erythromycin, and vancomycin¹. However, in the same study, intermediate GBS susceptibility was reported to chloramphenicol by 42.1% and ceftriaxone by 26.3%, which opposes the findings of our study¹.

On the contrary, our study findings are different from the findings of a similar study conducted in Ghandi memorial and Tikur Anbessa, Addis Ababa, Ethiopia, where GBS was found to be 55% susceptible to penicillin, 91% sensitive to ampicillin and all isolates except one were susceptible to erythromycin²³. Increased resistance to penicillin in this area was attributable to a wide non-prescription use of penicillin due to weak drug control mechanisms²³.

Another study conducted in Gabon, Central Africa to determine capsular type distribution and antimicrobial susceptibility of GBS in pregnant women found that all GBS isolates were susceptible to clindamycin, linezolid, vancomycin and benzyl penicillin which correlates with the findings of our study¹⁶. Fourteen isolates were however found intermediary susceptible to erythromycin, which contrasts the findings of our study. However, no inducible clindamycin resistance was found in the Gabon study, which draws a parallel between the two studies¹⁶.

In the neighbouring South Africa, a study conducted to assess the antimicrobial resistance of S. agalactiae isolated from pregnant women in Garankuwa found that all strains were 100% susceptible to penicillin, ampicillin and vancomycin, which is similarly demonstrated in our study²³. The same study however found some strains to be resistant to erythromycin, clindamycin, tetracycline and chloramphenicol by 21.1%, 17.2%, 94.5% and 24.9% respectively, which distinguishes the two study findings²³. In a comparable study conducted in Soweto, South Africa to determine the risk of GBS sepsis in infants exposed to HIV, all isolates were penicillin sensitive, and macrolide resistance was observed in 5.5%²⁵.

Generally, GBS has shown uniform sensitivity to penicillin, ampicillin, vancomycin, ceftriaxone and linezolid across many settings. Resistance to tetracycline was reported at 100% in our study compared to many previous studies, even though they also reported quite high percentages of resistance to tetracycline. Resistance to erythromycin and clindamycin was however not reported in our study, as opposed to other studies. These differences may be attributed to variations in capsular types common in different locations. In additions, fewer GBS isolates were obtained in the current study as compared to other studies, hence the differences in percentages of antimicrobial susceptibility.

None of the isolates phenotypically resistant to tetracycline presented with tet(O) gene, which confers resistance against tetracycline in addition to tet(M) gene¹³. A related study which was conducted in Windhoek has found tet(M) in 114/117 GBS isolates and of these, 111 were tetracycline resistant as interpreted by the Vitek 2⁶. Based on that study, six of the isolates that possessed tet(M) did not appear to be phenotypically resistant to tetracycline⁶. This does not concur with our findings, as all isolates presenting with tet(M) were phenotypically resistant to tetracycline in our study. Only tetracycline resistance genes were inspected in our study, as all isolates from this study have only shown phenotypical resistance to tetracycline.

Our study found capsular type Ia to be common among the pregnant women screened. A similar study conducted to determine the antigenic distribution of S. agalactiae isolates from pregnant women at Garankuwa hospital in South Africa revealed that capsular type III was the most common capsular type (29.7%), followed by Ia (25.6%), II (15.6%) IV (8.6%), V (10.9%) and Ib (8.6%)¹⁷. These implies that the prominent capsular types associated with this population were III, Ia and II. Differences in geographical locations of the two studies may attribute to the differences in capsular types found in the two studies. Non-typable strains reported in this study could have been a result of capsular type IX which was not assessed as literature did not support its assessment in our geographic location. A combination of both serology and molecular analysis may also have improved classification of the non-typables.

Another South African study conducted on pregnant mothers attending prenatal clinics in Soweto concluded that capsular type III was more associated with persistent colonisation throughout the study (29%) than Ia (18%) and V (6%)¹⁸. In a Zimbabwean study, the following capsular types were identified as follows: la, lb, II, III and V at 15.7%, 11.6%, 8.3%, 38.8% and 24.0% respectively¹⁹, which corresponds with our findings.

GBS colonises pregnant women presenting the risk of vertical transmission to the baby during the process of giving birth. Although the prevalence of GBS was low in this current study, it provides further information that some women are colonised with GBS at the late stages of pregnancy and are at risk of passing it on to the babies. Antimicrobial resistance was low to commonly used antibiotics except tetracycline in this study. However, there is need for continuous monitoring of antibiotic resistance as studies in other geographic locations have reported varying degrees of resistance by GBS to antibiotics. Although GBS is not routinely screened in pregnant women in Namibia, the results of this study are important for informing future policy considerations on its screening and management among pregnant women in the country and for empirical treatment of those colonised with GBS.

In the current study, the prevalence of GBS colonisation in women who attended antenatal screening at Okongo, Eenhana and Onandjokwe state hospitals was 5.7%. Twelve women were colonised in total and of these, 25.0% carried GBS in their lower vagina and rectum, 58.0% in the lower vagina only and 17.0% in the rectum only. Our study findings have revealed that there was no significant statistical association between GBS colonisation and age, habitat, marital status, educational level and employment status. Similarly, there was also no statistically significant association between GBS colonisation and parity, history of still births and miscarriages.

Antimicrobial susceptibility was reported at 100% sensitive for ampicillin, penicillin, ceftriaxone, clindamycin, erythromycin, vancomycin, linezolid and chloramphenicol. Resistance to tetracycline was reported at 100%. However, 100% susceptibility to erythromycin and clindamycin may be due to a smaller number of GBS isolates obtained from this study. The tetracycline resistance gene tet(M) was present in 88.9% of isolates and 11.1% had none, regardless of being phenotypically resistant to tetracycline. None of the isolates possessed detectable tet(O) resistance gene.

Polysaccharide capsular type Ia was found in 9 (50%) of isolates and Ib was found in 1 (5.5%) of the total isolates. The remaining 8 (44.4%) isolates could not be classified using PCR.

Study design

This was a descriptive cross-sectional study which gathered descriptive data such as socio-economic, demographic characteristics and obstetric factors directly from participants using a questionnaire.

Study population

The population comprised of pregnant women between 35 and 37 weeks gestation, who attended antenatal clinics at Onandjokwe, Eenhana and Okongo state hospitals between May and September 2018. Women who had taken antibiotics two weeks prior to the study, as well as those aged below 16 years were excluded from the study.

Sample size

The sample size was calculated based on the prevalence rate of GBS colonisation in pregnant women found in Windhoek, which was 13.6%⁶, using the following formula adopted from a prior study¹. The expected sample size was 181 participants (n = 181 participants).

A total of 210 subjects were screened, 98 from Onandjokwe hospital, 93 from Eenhana hospital and 19 from Okongo hospital.

Specimen collection

A convenience sampling technique was used in this study and samples were collected consecutively. A lower vaginal and a rectal swab were collected from each participant by qualified clinicians using sterile cotton-tipped swabs. A lower vaginal swab was collected by inserting and brushing a sterile swab 2cm into the vagina, periurethral area and labia. A rectal swab was collected by inserting a sterile swab 1cm into the anus, rubbing the wall of the anal canal as described before¹². The swabs were inserted into Amie’s transport medium for preservation of bacteria. Each specimen was labelled with a unique identification. Specimens were transported at 2 – 8°C to the laboratory. A cold chain protocol was observed during specimen transport and samples were cultured within an hour after reaching the laboratory.

Specimen culturing

Each swab was inoculated directly onto 5% Sheep blood agar with colistin and nalidixic acid (BCNA), followed by inoculation into Todd-Hewitt broth (TH) supplemented with colistin and nalidixic acid. The culture plates and broths were incubated at 37°C in CO₂ for 18-24 hours. After incubation, BCNA culture plates were examined for presence of large, whitish-grey and translucent colonies with a narrow zone of β-haemolysis while the Todd-Hewitt broths were subcultured onto BCNA agar. Subcultured BCNA plates were incubated at 37°C in CO₂ for 18-24 hours and examined for presumptive GBS colonies. The Columbia CNA agar, Todd Hewitt broth, colistin and nalidixic acid antibiotics were obtained from Rochelle Chemicals and Laboratory Equipment, Johannesburg, South Africa.

Isolation and identification of GBS

Single colonies that presented with a narrow or large zone of β-haemolysis on the BCNA or TH-BCNA were subjected to the CAMP test for presumptive identification. S. agalactiae ATCC 12403 was used as a positive control and Streptococcus pyogenes ATCC 1244 as negative control. A known β-haemolytic toxin producing Staphylococcus aureus clinical isolate was used in this test. Presumptive GBS isolates were tested again using Vitek 2 before they were confirmed as GBS using molecular techniques by amplifying the scpB gene²⁰.

DNA extraction

DNA was extracted using the boiling method as described in a prior study⁴. Pure cultures of presumptive isolates were harvested from nutrient agar plates and emulsified in 200 µL of DNA free water in respective Eppendorf tubes using sterile plastic loops, followed heating at 100°C on the heating block for 15 minutes. Eppendorf tubes were centrifuged at 8 000 revolutions per minute (rpm) for 10 minutes. The supernatant containing DNA was transferred to a clean labelled tube, and stored at -20℃ before use.

PCR for identification

A primer pair from Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa) 5’–ACAACGGAAGGCGCTACTGTTC–3’ (forward primer) and 5’–ACCTGGTGTTTGACCTGAACTA–3’ (reverse primer) which targeted the scpB gene was used for confirmation of GBS²⁰. PCR reaction mixture was prepared as follows: 12µl One Taq^® Quick load^® 2X master mix with standard buffer, 10.5µl nuclease free water, 1µl of forward and reverse primer, and 5µl DNA template, giving a final volume of 29.5µl. The PCR conditions were as follows: 1 cycle at 94°C for 4 minutes (initial denaturation), 35 cycles at 93°C for 1 minute (denaturation), 57.6°C for 1 minute (annealing), 72°C for 1 minute (elongation), 1 cycle at 72°C for 7 minutes (further elongation) and 4°C dwelling temperature using a BioRad thermal cycler (Johannesburg, South Africa).

The amplicons were electrophoresed on a 2% agarose gel electrophoresis with 1xTris-Acetate EDTA (TAE) buffer, at 110 volts for 45 minutes. A 1 000 base pair (bp) DNA ladder, positive and negative control were included. The gel was visualised under the SYN GENE BIO IMAGING ultra violet system (Cambridge, United Kingdom). The sizes of amplicons were determined using the DNA molecular weight size standard.

Antimicrobial sensitivity testing

Antimicrobial sensitivity testing for sixteen confirmed isolates was performed using the Vitek 2 system (bioMerieux, Midrand, South Africa). This method employed gram positive antimicrobial sensitivity cards (AST-ST01). This card tested for penicillin, ampicillin, erythromycin, clindamycin, vancomycin, tetracycline, linezolid & chloramphenicol Ceftriaxone was tested using the Kirby-Bauer disk diffusion method. Two isolates were tested using the Kirby-Bauer disc diffusion method against all antibiotics. Minimum inhibitory concentration (MIC) breakpoint results and disc zones were interpreted as stipulated by the Clinical Laboratory Standards Institute²⁷.

Multiplex PCR for gene-based resistance testing

Specific oligonucleotide primers from Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa) were used to screen for genotypic resistance (Table 1)^{21 & 13}. The reaction mixture was prepared as follows: 12µl One Taq^® Quick load^® 2X master mix with standard buffer, 10.5µl nuclease free water, 1µl of all forward and reverse primers, and 5µl DNA template, giving a final volume of 31.5µl. The multiplex PCR conditions were as follows: 1 cycle at 94°C for 4 minutes (initial denaturation), 35 cycles at 93°C for 1 minute (denaturation), 57.6°C for 1 minute (annealing), 72°C for 1 minute (elongation), 1 cycle at 72°C for 7 minutes (further elongation) and 4°C dwelling temperature using a BioRad thermal cycler (Johannesburg, South Africa). The amplicons were electrophoresed on a 2% agarose gel electrophoresis with 1xTris-Acetate EDTA (TAE) buffer, at 110 volts for 45 minutes. A 1 000 base pair (bp) DNA ladder, positive and negative control were included. The gel was visualised under the SYN GENE BIO IMAGING ultra violet system (Cambridge, United Kingdom). The sizes of amplicons were determined using the DNA molecular weight size standard.

Table 4: Oligonucleotide primers used in multiplex PCR for gene based resistance testing

Primer	Target	Primer sequence 5’ – 3’	Size
tetmS – F	tet(M)	GTCTTGCATATATACGCCTTTATAGTGGAGTACTACATTTACGAG	374bp
tetmA – R	tet(M)	CCACGTAATATCGTAGAAGCGGATCACTATCTGAG	374bp
tetoS – F	tet(O)	CGTATATATAGCGGAACATTGCATTTGAGGG	548bp
tetoA – R	tet(O)	CGGCTCTATGGACAACCCGACAGAAG	548bp

Poyart et al., 2003 & Zeng et al., 2006

PCR for polysaccharide capsular typing

Oligonucleotide primer pairs from Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa) were used in capsular polysaccharide typing, in three different categories, i.e. type Ia – III, IV – VII and VIII (Table 2)²¹. The PCR reaction mixture was prepared as follows: 12µl One Taq^® Quick load^® 2X master mix with standard buffer, 10.5µl nuclease free water, 1µl of all forward and reverse primers, and 5µl DNA template, giving a final volume of 35.5µl for type Ia – III & IV – VII, and a final volume of 29.5µl for type VIII categories.

The thermocycling conditions were as follows: 1 cycle at 94°C for 4 minutes (initial denaturation), 35 cycles at 93°C for 1 minute (denaturation), 58°C for 1 minute (annealing) (for type Ia – III), 59°C (for type IV – VII) & 56°C (for type VIII), 72°C for 1 minute (elongation), 1 cycle at 72°C for 7 minutes (further elongation) and 4°C dwelling temperature using a BioRad thermal cycler (Johannesburg, South Africa). The amplicons were electrophoresed on a 2% agarose gel electrophoresis with 1xTris-Acetate EDTA (TAE) buffer, at 110 volts for 45 minutes. A 1 000 base pair (bp) DNA ladder, positive and negative control were included. The gel was visualised under the SYN GENE BIO IMAGING ultra violet system (Cambridge, United Kingdom). The sizes of amplicons were determined using the DNA molecular weight size standard.

Table 5: Oligonucleotide Primers for polysaccharide capsular typing

Primer	Target	Primer sequence	Size bp
Ia-F	cps1aH	5’ – GGTCAGACTGGATTAATGGTATGC – 3’	521 & 1,826 bp
Ia-R	cps1Ah	5’ – GTAGAAATAGCCTATATACGTTGAATGC – 3’	521 & 1,826 bp
Ib-F	cps1bJ	5’ – TAAACGAGAATGGAATATCACAAACC – 3’	770 bp
Ib-R	cpsIbK	5’ – GAATTAACTTCAATCCCTAAACAATATCG – 3’	770 bp
II-F	cps2K	5’ – GCTTCAGTAAGTATTGTAAGACGATAG – 3’	397 bp
II-R	cps2K	5’ – TTCTCTAGGAAATCAAATAATTCTATAGGG – 3’	397 bp
III-F^a	cps1a/2/3I	5’ – TCCGTACTACAACAGACTCATCC – 3’	1,826 bp
III-R^a	cps1a/2/3J	5’ – AGTAACCGTCCATACATTCTATAAGC – 3’	1,826 bp
IV-F	cps4N	5’ – GGTGGTAATCCTAAGAGTGAACTGT – 3’	578 bp
IV-R	cps4N	5’ – CCTCCCCAATTTCGTCCATAATGGT – 3’	578 bp
V-F	cps5O	5’ – GAGGCCAATCAGTTGCACGTAA – 3’	701 bp
V-R	cps5O	5’ – AACCTTCTCCTTCACACTAATCCT – 3’	701 bp
VI-F	cps6I	5’ – GGACTTGAGATGGCAGAAGGTGAA – 3’	487 bp
VI-R	cps6I	5’ – CTGTCGGACTATCCTGATGAATCTC – 3’	487 bp
VII-F	cps7M	5’ – CCTGGAGAGAACAATGTCCAGAT – 3’	371 bp
VII-R	cps7M	5’ – GCTGGTCGTGATTTCTACACA – 3’	371 bp
VIII-F	cps8J	5’ – AGGTCAACCACTATATAGCGA – 3’	282 bp
VIII-R	cps8J	5’ – TCTTCAAATTCCGCTGACTT – 3’	282 bp

Poyart et al., 2007

A	Adenine
ATCC	American Type Culture Collection
BBB	Blood Brain Barrier
BCNA	Columbia Sheep Blood with Colistin and Nalidixic acid
BibA	GBS immunogenic bacterial adhesion
C	Cytosine
CAMP	Christie, Atkins, Munch and Petersen test
CDC	Centres for Diseases Control and Prevention
CLSI	Clinical Laboratory Standards Institute
DNA	Deoxy Ribonucleic Acid
EOD	Early Onset Disease
Fbs	Fibrigogen binding proteins
G	Guanine
GBS	Group B Streptococcus
HIV	Human Immuno-Deficiency Virus
IAP	Intrapartum Antibiotic Prophylaxis
Lmb	Laminin binding protein
LOD	Late Onset Disease
LVS	Lower Vaginal Swab
MIC	Minimum Inhibitory Concentration
NIP	Namibia Institute of Pathology
NUST	Namibia University of Science and Technology
PCR	Polymerase Chain Reaction
rRNA	Ribosomal Ribonucleic Acid
S. agalactiae	Streptococcus agalactiae
S. aureus	Staphylococcus aureus
SBA	Sheep Blood Agar
scpB	Group B streptococcal C5a peptidase
SfbA	Streptococcal fibronectin binding protein
SPSS	Statistical Package for Social Sciences
S. pyogenes	Streptococcus pyogenes
T	Thymine
TAE	Tris-Acetate EDTA buffer
Taq	Polymerase enzyme produced by Thermophilus aquaticus

TH Todd Hewitt

Ethics approval and consent to participate

Ethical approval was granted by the Ministry of Health and Social Services (MoHSS), Namibia. Written informed consent was obtained from each participant.

Consent for publication

Not applicable.

Availability of data and material

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

Funding for this study was provided by the Namibia Institute of Pathology (NIP) and Namibia University of Science and Technology (NUST).

Authors' contribution

All authors the authors significantly contributed to the conduct of the study. ELH, MM and SRM conceptualised the research and designed the work. SRM supervised the study and ELH collected data and cultured specimens. ELH and MM carried the molecular screening of isolates and all authors contributed to the drafting of the manuscript and revision and approved it.

Acknowledgements

We would like to thank NIP and NUST for financial support. The Department of Health Sciences, Medical Laboratory Sciences Programme for general support during the conduct of the study. Our sincere thanks go to all the women who participated in the study and the nurses from the study hospitals who helped in the collection of samples for the study.

Alemseged, G., Niguse, S., Hailekiros, H., Abdulkadir, M., Saravanan, M., & Asmelash, T. (2015). Isolation and anti‑microbial susceptibility pattern of Group B streptococcus among pregnant women attending antenatal clinics in Ayder Referral Hospital and Mekelle Health Centre, Mekelle, Northern Ethiopia. BioMed Central, 8. 1 – 8.

Belard, S., Toepfner, N., Capan-Melser, M., Mombo-Ngoma, G., Zoleko-Manego, R., Groger, M.,… Berner, R. (2015). Streptococcus agalactiae capsular type distribution and antimicrobial susceptibility in pregnant women in Gabon, Central Africa. Scientific Reports, 5, 1 – 4.

bioMerieux (2014). Vitek® 2: Healthcare. Retrieved from http://www.biomerieux-usa.com/clinical/vitek-2-healthcare.

Bolukaoto, J. Y., Monyama, C. M., Chukwu, M. O., Lekala, S. M., Nchabeleng, M., Maloba, M. R. B.,… Moyo, S. R. (2015). Antibiotic resistance of Streptococcus agalactiae isolated from pregnant women in Garankuwa, South Africa. BioMed Central Research Notes, 8. 1 – 7.

Centre for Diseases Control and Prevention (2010). Algorithm for screening Group B Streptococcus colonisation. Retrieved from: https://www.cdc.gov/Groupbstrep/guidelines/algorithms-tables.html.

Chukwu, M. O., Mavenyengwa, R. T., Monyama, C. M., Bolukaoto, J. Y., Lebelo, S. L., Maloba, M. R. B., Nchabeleng, M., & Moyo, S. R. (2015). Antigenic distribution of Streptococcus agalactiae isolates from pregnant women at Garankuwa hospital – South Africa. Germs, 5(4), 125 – 133.

Clinical and Laboratory Standards Institute (2018). Performance standards for antimicrobial susceptibility testing. (28^th ed.). Clinical and Laboratory Standards Institute, Wayne.

Cutland, C. L., Schrag, S. J., Thigpen, M. C., Velaphi, S. C., Wadula, J., Adrian, P. V.,… Madhi, S. A. (2015). Increased risk for Group B streptococcus sepsis in young infants exposed to HIV, Soweto, South Africa, 2004 – 2008. Emerging Infectious Diseases, 21(4), 638 – 645.

de Steenwinkel, F. D. O., Tak, H. V., Muller, A. E., Nouwen, J. L., Oostvogel, P. M., & Mocumbi, S. M. (2008). Low carriage rate of Group B streptococcus in pregnant women in Maputo, Mozambique. Tropical Medicine and International Health, 13(3), 427 – 429.

Dmitrieve, A., Suvorov, A., Shen, A. D., & Yang, Y. H. (2004). Clinical diagnosis of Group B streptococci by scpB gene based PCR. Indian J Med Res, 119, 233 – 236.

Doran, K. S., & Nizet, V. (2004). Molecular pathogenesis of neonatal Group B streptococcal infection: No longer in its infancy. Molecular Microbiology, 54(1), 23 – 31.

Engelbrecht, F., Moyo, S. R, Maposa, I., Mukesi, M., & Khan, S. (2016). The antimicrobial susceptibility and gene-based resistance of Streptococcus agalactiae (Group B streptococcus) in pregnant women in Windhoek (Khomas region), Namibia. Medical Technology SA, 30(2), 9 – 14.

Engelbrecht, F. (2015). The antimicrobial susceptibility and gene-based resistance of Streptococcus agalactiae (Group B streptococcus) in pregnant women in Windhoek (Khomas region), Namibia (Published master’s thesis). Cape Peninsula University of Technology, Bellville.

Gray, K. J., Kafulafula, G., Matemba, M., Kamdolozi, M., Membe, G., & French, N. (2011). Group B streptococcus and HIV infection in pregnant women, Malawi, 2008 – 2010. Emerging Infectious Diseases, 17(10), 1932 – 1935.

Gygax, S. E., Schuyler, J. A., Kimmel, L. E., Trama, J. P., Mordechai, E., & Adelson M. E. (2006). Erythromycin and clindamycin resistance in Group B streptococcal clinical isolates. American Society for Microbiology, 50(5), 1875 – 1877.

Heelan, J. S., Hasenbein, M. E., & McAdam, A. J. (2004). Resistance of Group B streptococcus to selected antibiotics, including erythromycin and clindamycin. Journal of Clinical Microbiology, 42(3), 1263 – 1264.

Joachim, A., Matee, M. I., Massawe, F. A., & Lyamuya, E. F. (2009). Maternal and neonatal colonisation of Group B streptococcus at Muhimbili National Hospital in Dar es Salaam, Tanzania: Prevalence, risk factors and antimicrobial resistance. BioMed Central Public Health, 9. 1 – 7.

Khan, M. A., Faiz, A., & Ashshia, A. M. (2015). Maternal colonisation of Group B Streptococcus: Prevalence, associated factors and antimicrobial resistance. Annals of Saudi Medicine, 35(6), 423 – 427.

Kwatra, G., Adrian, P. V., Shiri, T., Buchmann, E. J., Cutland, C. L., & Madhi, S. A. (2014). Capsular type-specific acquisition and loss of Group B streptococcus recto-vaginal colonisation in late pregnancy. Plos One, 9(6). 1 – 9.

Mavenyengwa, R. T., Afset, J. E., Schei, B., Berg, S., Caspersen, T., Bergseng, H., & Moyo, S. R. (2009). Group B streptococcus colonisation during pregnancy and maternal-fetal transmission in Zimbabwe. Acta Obstetricia et Gynecologica Scandinavica, 89(2), 250 – 255.

Mavenyengwa, R. T., Moyo, S. R., & Nordbo, S. N. (2010). Streptcoccus agalactiae colonisation and correlation with HIV-1 and HBV seroprevalence in pregnant women from Zimbabwe. European Journal of Obstetrics & Gynaecology and Reproductive Biology, 150(2010), 34 – 38.

Mavenyengwa, R. T., Maeland, J. A., & Moyo, S. R. (2010). Serotype markers in a Streptococcus agalactiae collection from Zimbabwe. Indian Journal of Medical Microbiology, 28(4) 313 – 319.

Monyama, M. C., Bolukaoto, J. Y., Chukwu, M. O., Maloba, M. R. B., Moyo, S. R., Mavenyengwa, R. T.,… Lebelo, S. L. (2016). Group B streptococcus colonisation in pregnant women at Dr. George Mukhari Hospital, South Africa. Southern African Journal of Infectious Diseases, 1(1). 1 – 5.

Moyo, S. R., Mudzori, J., Tswana, S.A., & Maeland, J. (2000). Prevalence, capsular type distribution, anthropometric and obstetric factors of Group B streptococcus (Streptococcus agalactiae) colonisation in pregnancy. The Central African Journal of Medicine. 46(5), 115 – 120.

Poyart, C., Jardy, L., Quesne, G., Berche, P., & Trieu-Cout, P. (2003). Genetic basis of antibiotic resistance in Streptococcus agalactiae strains isolated in a French hospital. Antimicrobial agents and Chemotherapy, 47(2), 794 – 797.

Poyart, C., Tazi, A., Reglier-poupet, H., Billoet, A., Tavares, N., Raymond, J., & Trieu-Cuot, P. (2007). Multiplex PCR assay for rapid and accurate capsular typing of Group B streptococci. Journal of Clinical Microbiology, 45(6), 1985 – 1988.

Teatero, S., McGeer, A., Low, D. E., Li, A., Demczuk, W., Martin, I., & Fittipaldia, N. (2014). Characterisation of invasive Group B streptococcus strains from the greater Toronto area, Canada. Journal of Clinical Microbiology, 52(5), 1441 – 1447.

Woldu, Z. L., Teklehaimanot, T. G., Waji, S. T., & Gebremariam, M. Y. (2014). The prevalence of Group B streptococcus recto-vaginal colonisation and antimicrobial susceptibility pattern in pregnant mothers at two hospitals of Addis Ababa, Ethiopia. Reproductive Health, 11.

Zhao, Z., Kong, F., Zeng, X., Gidding, H. F., Morgan, J., & Gilbert, G. L. (2008). Distribution of genotypes and antibiotic resistance genes among invasive Streptococcus agalactiae (Group B streptococcus) isolates from Australasian patients belonging to different age groups. European Society of Clinical Microbiology and Infectious Diseases, 14, 260 – 267.

Zeng, X., Kong, F., Wang, H., Darbar, A., & Gilbert, G., L. (2006). Simultaneous detection of nine antibiotic resistance-related genes in Streptococcus agalactiae using multiplex PCR and reverse line blot hybridization assay. American Society for Microbiology, 50(1), 204 – 209.

Download PDF

Journal Publication

published 05 Aug, 2021

Read the published version in BMC Microbiology →

Reviewer #3 agreed at journal
28 Feb, 2021
Review #2 received at journal
01 Jan, 2021
Review #1 received at journal
01 Jan, 2021
Reviewer #2 agreed at journal
14 Dec, 2020
Reviewer #1 agreed at journal
13 Dec, 2020
Reviewers invited by journal
10 Dec, 2020
Editor assigned by journal
19 Nov, 2020
Submission checks completed at journal
19 Nov, 2020
Editor invited by journal
19 Nov, 2020

You are reading this latest preprint version

Prevalence and molecular characterization of Group B streptococcus in pregnant women from hospitals in Ohangwena and Oshikoto regions of Namibia.

Status:

Journal Publication

Version 2

Abstract

Background

Results

Discussion

Conclusions

Methods

Abbreviations

Declarations

References

Status:

Journal Publication

Version 2