Endometrial Gene Expression Profiles of Infertile Women with Thin Versus Normal Endometrial Thickness on The Day of Oocyte Retrieval: A cross-sectional study

doi:10.21203/rs.3.rs-3878960/v1

To compare the expression of the endometrial FUT4, CDH2, SOX9, LGR5, POU5F1, PDGFRB, SUSD2, and MCAM genes, which are associated with different endometrial locations, between the thin endometrium and normal endometrial thickness. Between May 2022 and February 2023, we collected tissue samples from 20 infertile women who underwent controlled ovarian stimulation. The samples consisted of 10 thin endometrium (< 7 mm) samples and 10 normal endometrial thickness (≥ 7 mm) samples collected on the day of oocyte retrieval. The expression levels of the endometrial genes were analyzed using quantitative real-time polymerase chain reaction. There were no significant differences in the expression levels of FUT4, CDH2, SOX9, LGR5, POU5F1, PDGFRB, SUSD2, and MCAM genes between both groups (p = 0.912, p = 0.529, p = 0.481, p = 0.123, p = 0.796, p = 0.247, p = 0.063, p = 0.853 respectively). There were also no significant differences in gene expression profiles between the groups according to the history of endometrial surgery, estradiol level, type of gonadotropin, and drug used for oocyte triggering. The endometrial gene expression profiles associated with different endometrial locations on the day of oocyte retrieval were not different between thin and normal endometrial thickness groups.

Biological sciences/Physiology

Health sciences/Biomarkers

Health sciences/Medical research

Assisted Reproductive Techniques (ART) have undergone significant developments in recent years. Although the ART process has advanced significantly, there are still some problems that need to resolved. Successful implantation requires high quality embryos and a receptive endometrium. The receptive endometrium is defined as a healthy uterine environment containing the transformation of endometrial cells into decidua cells, which are appropriate for the implantation of blastocysts and the growth of the placenta ^[1]_.

Endometrial assessment is a crucial part of ART process. It helps determine endometrial receptivity, which is important for successful implantation and pregnancy. There are various methods of endometrial assessment that are used, such as endometrial thickness (EMT), pattern, volume, Doppler studies, or endometrial receptivity analysis. Among these methods, transvaginal ultrasonography (TVS) is the ideal noninvasive tool to evaluate the endometrium. It is safe, takes little time, and is easy to perform. Endometrial thickness is an important parameter that is routinely measured during IVF and ICSI cycles. EMT is directly correlated with increased circulating estrogen levels, which play a crucial role in the preparing of the endometrium for implantation ^[2].

EMT is related to endometrial receptivity and has been considered a prognostic factor for embryo transfers during IVF/ICSI treatment. EMT of 8-14 mm is considered optimal for the success IVF and ICSI. The thin endometrium is one of the potential problems of ART. Several studies have demonstrated that an EMT of at least 7 mm increases the pregnancy rate and reduces the risk of miscarriage compared to an EMT below 7 mm ^[3,4]. Data from a meta-analysis revealed that EMT of 7 mm or less resulted in a lower pregnancy rate, with an odds ratio of 0.42 (95% CI 0.27,0.67) ^[5]. Studies have reported that an EMT less than 7 mm occurs with an incidence of 0.7%-2.5% in fresh IVF cycles ^[4,6,7]. Also data from Reproductive Biology and Infertility Unit of Siriraj Hospital, the incidence of thin endometrium in the controlled ovarian stimulation cycle (COS) was 2%.

The endometrium is a highly complex tissue that lines the inner surface of the uterus. It is composed of two morphological layers: the functional and basal layers. The functional layer is the superficial layer and constitutes around two-thirds of the total EMT. It is composed of several distinct cellular compartments, including the luminal epithelium, glandular epithelium, stroma, and vascular compartments. The luminal epithelium is a layer of specialized epithelial cells that covers the surface of the endometrium. The glandular epithelium is composed of tubular structures called endometrial glands, which extend deep into the stroma. The stroma is a connective tissue matrix that provides structural support to the endometrium. It is composed of extracellular matrix and fibroblasts that differentiate during the decidualization process. The vascular compartments consist of small blood vessels, including spiral arteries, which are essential for endometrial function and provide nutrients to endometrial cells ^[8,9].

The causes of thin endometrium can be attributed to various factors, including medical conditions and certain medications. These include Asherman syndrome, previous endometrial surgery or curettage, pelvic radiation, clomiphene citrate, endometritis, septic abortion, Mullerian anomalies, hypoestrogenic stage, progestin or androgen used or idiopathic ^[2].

The process that regulates the proliferation and transformation of endometrial cells in the functionalis layer is partly controlled by gene expression. Multiple mechanisms can control gene expression. Transcriptional regulation involves regulating the activity of RNA polymerase and the binding of transcription factors to the promoter regions of genes to regulate the synthesis of mRNA molecules from DNA. Post-transcriptional regulation includes alternative splicing, RNA editing, and RNA degradation in the control of the stability and processing of mRNA molecules after transcription. Translational regulation involves the binding of regulatory proteins to the 5' or 3' untranslated regions of mRNA or the modulation of translation initiation factors to control the efficacy and rate of translation of mRNA molecules into proteins. Post-translational regulation includes protein folding, phosphorylation, acetylation, ubiquitination, and other modifications that control the stability, localization, and activity of newly synthesized proteins ^[10].

According to Tempest et al. ^[11,12] and Cousins et al. ^[13] studies, they reported highly expressed endometrial genes at different locations, including FUT4, CDH2, and SOX9 at the basalis; LGR5 at the luminal epithelium; POU5F1 at the stroma; and PDGFRB, SUSD2, and MCAM at the perivascular region. The goal of this study was to compare the expression of these genes in patients with thin endometrium (EMT < 7mm.) and normal endometrial thickness (EMT ≥ 7mm.), to identify any differences that may be associated with a thin endometrium. The results of the study may have implications for the treatment of infertility in women with thin endometrium. By understanding the underlying genetic factors that contribute to a thin endometrium and may be able to develop more effective treatment strategies to improve the chances of successful implantation and pregnancy.

Baseline characteristics

In the study, twenty participants were recruited between May 2022 and February 2023 and divided into two groups: ten participants in the thin endometrium (TEM) group, and ten participants in the normal endometrium (NET) group. Each volunteer provided an endometrial sampling on the day of oocyte retrieval, which was used to examine the expression of various genes associated with different locations within the endometrium.

Descriptive statistics were used to analyze the baseline characteristics of the study participants. The mean age of the TEM group was 38.5 ± 2.71 years, while the NET group had a mean age of 37.5 ± 4.48 years. The major causes of infertility were male factors and unexplained infertility while 35% of the participants had a history of endometrial surgery. Each participant received individualized ovarian stimulation using gonadotropin, which included HMG, rFSH, or a combination of rFSH and LH. The mean total dose of gonadotropin was 2,485 ± 94.59 IU in the TEM group and 2,355 ± 153.56 IU in the NET group. The most used trigger for ovulation and final maturation was hCG, which was used in 55% of cases. The mean endometrial thickness was 6.1 ± 0.34 mm in the TEM group and 12.2 ± 0.49 mm in the NET group. The mean estradiol level on the day of oocyte retrieval, which is an indicator of ovarian function and provides information about the endometrial stimulation, was 1,254.1 ± 223.9 pg/ml in the TEM group and 1,109.5 ± 128.1 pg/ml in the NET group. (Table 2.)

qPCR analysis

Data obtained from qPCR analysis showed no significant difference in median fold change (2^-ΔΔCt) representing the expression of endometrial genes at different locations, including basalis (FUT4, CDH2, SOX9), luminal epithelium (LGR5), stroma (POU5F1), and perivascular region (PDGFRB, SUSD2, MCAM), between the group with TEM and the group with NET (Figure 1). The statistic results are presented in Table 3.

When considering factors that could affect gene expression profiles, such as previous endometrial surgery or uterine curettage, there was no significant difference in gene expression profiles between the group with a history of these procedures and the group without a history, as shown in Table 4. Similarly, there were no significant difference in gene expression profiles regardless of the type of gonadotropin used, including hMG, rFSH, or a combination of rFSH and LH, as shown in Table 5. Additionally, there were no significant difference in gene expression profiles regardless of the use of hCG, GnRHa or a combination of hCG and GnRHa for the trigger of ovulation or final maturation, as shown in Table 6. When estradiol levels were divided into three ranges (E2 ≤ 750, n = 6; 751 -1,500, n = 8; and > 1,500, n = 6) on the day of oocyte retrieval, there was no significant difference in gene expression profiles between the different ranges, as shown in Table 7.

Endometrial quality is one of crucial factors associating to IVF success rate. The endometrial thickness relates to embryo implantation especially the receptivity of the endometrium serving as a prognostic factor for embryo transfers during IVF/ICSI treatment. Nowadays, thin endometrium is a potential problem that may arise during ART treatment. Several studies have shown that an endometrial thickness (EMT) less than 7 mm was associated with a decreased pregnancy rate ^[3-5]. The objective of this study was to compare the expression of endometrial genes between thin endometrium (TEM) and normal endometrial thickness (NET) to identify any differences that may be associated with a TEM. These findings might be shed light on the etiology of TEM and the future treatment coping this problem.

Twenty volunteers were recruited to examine the expression of various genes associated with variety locations within the endometrium. The genes of interest were selected included FUT4, CDH2, SOX9, LGR5, POU5F1, PDGFRB, SUSD2, and MCAM reflecting to the different characters of endometrial cells. These genes are known to be highly expressed in specific areas of the endometrium, including the basalis, luminal epithelium, stroma, and perivascular regions. In this study, samples were grouped according to the ultrasonographic finding of endometrial thickness TEM group (EMT < 7 mm.) and NET group (EMT ≥ 7 mm.).

In the study, gene expressions in the late proliferative phase of the endometrium on the day of oocyte retrieval between the TEM and NET groups were compared. Interestingly, the baseline characteristics of the two groups were comparable. The results showed did not show significant differences in gene expression between these two groups. Furthermore, various factors that could contribute to gene expression were examined, including previous endometrial surgery or uterine curettage, the type of gonadotropin used, the type of drug used to trigger of ovulation and final maturation, and estradiol levels on the day of oocyte retrieval. However, none of these factors was found to have a significant impact on gene expression in different locations of the endometrium.

This result is plausible, as numerous genes are involved in the regulation of EMT. Other genes that were not investigated in this research may contribute to TEM. Compared to other studies, the study from Alfer et al. ^[14] did evaluate the expression steroid hormone receptors by immunohistochemistry in patients with subfertility with TEM (n=11) compared to fertile women (n=11). The results showed that in the late proliferative phase of TEM, the estrogen and progesterone receptor gene was normally expressed, while in the mid secretory phase they were downregulated. Moreover, Gao et al. ^[15] did identify the expressions of the estrogen receptor and progesterone receptor gene by immunohistochemistry in subfertility patients with TEM (n=18) compared to fertile women (n=21). Their results showed that in the late proliferative phase of TEM, the estrogen receptor was significantly decreased in the stromal and glandular cells, but no significant differences were observed for the expression of the progesterone receptor. In our study, thin endometrium in the secretory phase, the estrogen receptor was significantly decreased in the stromal cells, but again no significant differences were observed for the expression of the progesterone receptor. Zhu et al. ^[16] evaluated the PDZ-binding kinase (PBK), which is related to cell division and cell cycle, in patients with TEM (n=7) compared to matched controls (n=7). The results showed that in the late proliferative phase of TEM, cell proliferation was suppressed and PBK expression was decreased in human endometrial stromal cells, to which inflammation and reactive oxygen species contributed. As a result, the expression of endometrial genes may differ depending on the stage of the endometrial cycle. However, the studies mentioned above were not conducted in COS cycles, which differs from this study that was conducted in the COS cycle.

During folliculogenesis, the rising level of estradiol has a direct effect on gene expression and may explain the differences observed in gene expression patterns^[17]. It should be noted that this study examined gene expression during COS, which typically results in supraphysiological estradiol levels. This contrasts with natural cycle, where estradiol levels typically range between 200-300 pg/ml. It is possible that the use of supraphysiological levels of estradiol in this study may have contributed to the lack of differences in gene expression between the TEM and NET groups.

Similarly, in case of artificial endometrial preparation failure with persistent TEM, high doses of exogenous estrogen are often used to try to regulate gene expression, increase endometrial proliferation, and increase EMT. However, in some cases, even high doses of estrogen may not be effective in increasing EMT. This suggests that other factors beyond estrogen and gene expression may also play a role in determining endometrial function and thickness.

Furthermore, TEM may be caused by other mechanisms that affect proliferation or even the mesenchymal to epithelial transition. These mechanisms may include abnormal angiogenesis, epigenetic aberrations, abnormal post-transcriptional or post-translational modifications of genes. Estrogen has induced rapid calcium influx and efflux via the membrane estrogen receptor ^[18]. Calcium dynamics leads to activation of kinase pathways such as MAPK/ERK, which are the result of endometrial migration and proliferation ^[19]. Furthermore, estrogen promotes angiogenesis by activating G protein-coupled estrogen receptor mediated effects on 6-phosphofructo-2-kinase/ fructose-2,6-biphosphatase 3, a crucial glycolysis enzyme. Therefore, dysfunction in the non-genomic pathway may be a cause of abnormal cell activity, and possibly TEM.

Studies have demonstrated that the endometrium contains both gonadotropin receptors and hCG receptors ^[20,21]. A study was conducted to evaluate the effect of gonadotropin types on the endometrium in murine models. The results indicated that recombinant FSH may have a more pronounced inhibitory effect on endometrial stromal cell proliferation compared to urinary FSH ^[22]. However, analysis of data from the current study by grouping according to the type of gonadotropin used, the type of drug used to trigger ovulation and final maturation, no changes were observed in the gene expression profiles.

The strength of this study lies in the selection of genes based on different endometrial locations and diversity, as well as the exclusion of other endometrial pathologies to focus specifically on idiopathic TEM. The use of a single investigator to measure embryo transfers is also a strength.

One limitation of this study is that it only examined gene expression during the late proliferative phase of TEM under COS. Therefore, the results may not be applicable to natural cycles or artificial endometrial preparations. Another limitation is that the study only used a specific method of transcriptional analysis, which is a qPCR technique, and did not examine other methods based on protein expressions.

Although the current study may not have demonstrated a direct correlation between gene expression and EMT, future research may provide new insights into the underlying mechanisms. Other factors, such as epigenetic modifications or environmental influences, may also contribute to endometrial thickness. It might be interesting to continue investigating and researching these topics to acquire a better understanding of TEM. Future research should deeply investigate the gene expression of TEM during both natural and artificial endometrial preparation cycles, particularly during the late proliferative and early secretory phases. To better evaluate endometrial function, it is also recommended to study a large sample size and incorporate various genes or techniques, such as proteomic, metabolomic, or microbiomic analysis.

The relative expression of the endometrial genes associated with different endometrial locations including FUT4, CDH2, and SOX9 at the basalis; LGR5 at the luminal epithelium; POU5F1 at the stroma; and PDGFRB, SUSD2, and MCAM at the perivascular region, on the day of oocyte retrieval were not different between thin and normal endometrial thickness groups.

This cross-sectional study was conducted in accordance with the Declaration of Helsinki at the Department of Obstetrics and Gynecology, Faculty of Medicine Siriraj Hospital, Mahidol University. The study protocol and all methods were approved by the Siriraj Institutional Review Board, Faculty of Medicine Siriraj Hospital, Mahidol University, with a certificate of approval no. Si 183/2022 before enrolling participants. All methods were carried out in accordance with relevant guidelines and regulations.

The recruited women diagnosed with infertility between the ages of 18 and 45 years who underwent treatment with the GnRH antagonist protocol for COS and planned to undergo frozen-thaw embryo transfer at the Reproductive Biology and Infertility Unit, Department of Obstetrics and Gynecology, Faculty of Medicine Siriraj Hospital. Patients were excluded if they had any endometrial pathologies such as polyps, synechiae, submucous myomas, infections, hyperplasia, cancer, or congenital uterine anomalies, as well as cervical stenosis or cervical cancer, adenomyosis, endometriomas, hydrosalpinx, previous uterine radiation, active STD infection, bleeding disorder, or if they were currently using clomiphene citrates, aromatase inhibitors, progestins, or androgens. All participants were informed and provided their consent prior to enrollment in the study.

The researcher invited patients who are seeking IVF treatment at the Reproductive Biology and Infertility Unit, Department of Obstetrics and Gynecology, Faculty of Medicine Siriraj Hospital, to participate in a research project during the first to third day of their menstrual cycle. The researcher will provide the patients with a clear understanding of the details of participation in the research project, research objectives, the research process, and the method of collecting research data. Additionally, the researcher will explain the patient confidentiality processes in place to ensure privacy. Patients are informed of the study procedure to enable them to make an informed decision about participation. Informed consents were obtained from all participants.

The patient undergoes the COS process to determine the dosage and duration of the drug intake at the discretion of the treating physician. On the day of oocyte retrieval, individuals who meet the inclusion and exclusion criteria of the research project are invited to participate. They will receive a document explaining the research and must sign a letter of consent before beginning the oocyte collection process. Patients who decide to participate in the research project will be identified as research participants and a sticker will be placed in front of their medical history file in the Reproductive Biology and Infertility Unit.

Before starting the oocyte retrieval process, the same research assistant will measure the EMT using TVS, along with the assessment of endometrial pathology by saline infusion sonohysterography (SIS), for all participants in the study. A 10 ml blood sample is also be collected to check the hormone estradiol level. The attending nurse will administer parenteral sleeping drugs and pain relievers.

After the oocyte retrieval process, another research assistant who was unaware of the EMT of the participants performed an endometrial biopsy. The same research assistant collects endometrial samples for all study participants in the study. Once the tissues are extracted, they are placed in normal saline solution. The coinvestigators collected the endometrial tissue and placed it in a prepared solution tube, which is immediately delivered to the laboratory for gene expression investigation. The participant will be terminated from the study if the collected endometrial specimen is insufficient for quantitative real-time polymerase chain reaction (qPCR) analysis or if the collection of endometrial samples has been unsuccessful.

Endometrial gene expression analysis was carried out at the Center of Reproductive and Stem Cell Biology, Department of Obstetrics and Gynecology, Faculty of Medicine, Siriraj Hospital. The primers for FUT4, CDH2, SOX9, LGR5, POU5F1, PDGFRB, SUSD2, and MCAM genes were designed based on the PubMed gene database and using the primer-BLAST tool available on the NCBI database. The primers for the genes of interest (Table 1.) were ordered from Pacific Science CO., LTD, Thailand.

Endometrial tissue samples were washed with normal saline to remove all blood and then frozen in liquid nitrogen, which was kept at -80°C until the RNA extraction procedure was conducted.

The RNA extraction procedure involved homogenizing the tissue sample (10 mg) using a micropestle and performing RNA extraction using the GenElute^® Total RNA Purification Kit (Sigma-Aldrich Co. LLC, Germany) following the manufacturer's protocol. For cDNA synthesis, the iScript^® Reverse Transcription Supermix (Bio-rad Laboratories, Inc., USA) was used according to the manufacturer's protocol.

To perform qPCR analysis, the LightCycler^® 480 system and the Roche SYBR Green I Master kit were used to evaluate mRNA expression according to the manufacturer's protocol. The results from qPCR were cycle threshold (CT) and gene expression data were analyzed using the 2^-ΔΔCt quantitative method to estimate relative fold change values. Following each qPCR run, the melting curves were analyzed to confirm the specificity of the primers, which was indicated by the presence of a single band and no artifacts of primer-dimer.

The primary outcome of this study was to compare the expression of endometrial gene of infertile women who underwent COS between thin and normal endometrial thickness on the day of oocyte retrieval. Secondary outcomes were to compare endometrial gene expression according to the history of endometrial surgery, the type of gonadotropin, the type of oocyte triggering, and the level of estradiol.

The sample size for this study was calculated based on a pilot study involving 10 participants, with a dropout rate of 10%, a β level of 0.02, and an α level of 0.05. Twenty participants were required (10 participants in each group). Data were analyzed using SPSS version 26. To assess the normality of continuous data, Shapiro-Wilk or histogram plots were employed. Continuous data was analyzed using either Student’s t-test or the Mann-Whitney U test. On the other hand, categorical data was analyzed using the Chi-squared test or Fisher’s exact test. One-way analysis of variance (ANOVA) was used to identify significant differences between the means of two or more groups. A p-value < 0.05 was considered statistically significant.

Funding

This work was supported by Siriraj Grant for Research Development, Faculty of Medicine Siriraj Hospital, Mahidol University [Grant number R016531038].

Conflict of interest

The authors declare that they do not have any conflicts of interest and have not received an honorarium from any institute or company.

Zenclussen, A.C. & Hammerling, G.J. Cellular Regulation of the Uterine Microenvironment That Enables Embryo Implantation. Front Immunol 6, 321 (2015).
Liu, K.E., Hartman, M. & Hartman, A. Management of thin endometrium in assisted reproduction: a clinical practice guideline from the Canadian Fertility and Andrology Society. Reprod Biomed Online 39(1):49-62 (2019).
Kumbak, B. et al. Outcome of assisted reproduction treatment in patients with endometrial thickness less than 7 mm. Reprod Biomed Online. 18(1), 79-84 (2009).
Wu, Y. et al. Endometrial thickness affects the outcome of in vitro fertilization and embryo transfer in normal responders after GnRH antagonist administration. Reprod Biol Endocrinol. 12, 96 (2014).
Kasius, A. et al. Endometrial thickness and pregnancy rates after IVF: a systematic review and meta-analysis. Hum Reprod Update. 20(4), 530-541 (2014).
Bu, Z. & Sun, Y. The Impact of Endometrial Thickness on the Day of Human Chorionic Gonadotrophin (hCG) Administration on Ongoing Pregnancy Rate in Patients with Different Ovarian Response. PLoS One. 10(12), e0145703 (2015).
Shufaro, Y., Simon, A., Laufer, N. & Fatum, M. Thin unresponsive endometrium--a possible complication of surgical curettage compromising ART outcome. J Assist Reprod Genet. 25(8), 421-425 (2008).
Beier, H.M. & Beier-Hellwig, K. Molecular and cellular aspects of endometrial receptivity. Hum Reprod Update. 4(5), 448-458 (1998).
Diedrich, K., Fauser, B.C., Devroey, P., Griesinger, G. & Evian Annual Reproduction Workshop, G. The role of the endometrium and embryo in human implantation. Hum Reprod Update. 13(4), 365-377 (2007).
Alberts, B. et al. Molecular Biology of The Cells. (Oxford University Press, Oxford; 2003).
Tempest, N. et al. Novel microarchitecture of human endometrial glands: implications in endometrial regeneration and pathologies. Hum Reprod Update. 28(2), 153-171 (2022).
Tempest, N., Baker, A.M., Wright, N.A. & Hapangama, D.K. Does human endometrial LGR5 gene expression suggest the existence of another hormonally regulated epithelial stem cell niche? Hum Reprod. 33(6), 1052-1062 (2018).
Cousins, F.L., Pandoy, R., Jin, S. & Gargett, C.E. The Elusive Endometrial Epithelial Stem/Progenitor Cells. Front Cell Dev Biol. 9, 640319 (2021).
Alfer, J et al. Insufficient Angiogenesis: Cause of Abnormally Thin Endometrium in Subfertile Patients? Geburtshilfe Frauenheilkd. 77(7), 756-764 (2017).
Gao, M. et al. Abnormal expression of estrogen receptor is associated with thin endometrium. Gynecol Endocrinol. 35(6), 544-547 (2019).
Zhu, Q. et al. Down-regulation of PBK inhibits proliferation of human endometrial stromal cells in thin endometrium. Reprod Biol Endocrinol. 20(1), 25 (2022).
Yu, K. et al. Estrogen receptor function: impact on the human endometrium. Front Endocrinol. 13, 827724 (2022).
Morley, P., Whitfield, J.F., Vanderhyden, B.C., Tsang BK & Schwartz, J.L. A new, nongenomic estrogen action: the rapid release of intracellular calcium. Endocrinology. 131(3), 1305-1312 (1992).
Zhao, L. & Brinton, R.D. Estrogen receptor alpha and beta differentially regulate intracellular Ca(2+) dynamics leading to ERK phosphorylation and estrogen neuroprotection in hippocampal neurons. Brain Res. 1172, 48-59 (2007).
La Marca, A., Carducci Artenisio, A., Stabile, G., Rivasi, F. & Volpe, A. Evidence for cycle-dependent expression of follicle-stimulating hormone receptor in human endometrium. Gynecol Endocrinol. 21(6), 303-306 (2005).
Tapia-Pizarro, A. et al. hCG activates Epac-Erk1/2 signaling regulating Progesterone Receptor expression and function in human endometrial stromal cells. Mol Hum Reprod. 23(6), 393-405 (2017).
Kim, YJ. et al. Proliferation Profile of Uterine Endometrial Stromal Cells during In Vitro Culture with Gonadotropins: Recombinant versus Urinary Follicle Stimulating Hormone. Tissue Eng Regen Med. 16(2), 131-139 (2019).

Table 1. Primer of interested gene
Gene	Forward Primer	Reverse Primer	Annealing temp. (°C)	Amplicon size (bp)
FUT4	5'- AGGGGGTTCTTCCTCACCTT -3'	5'- ATATGGCCTGTGGCAGATGG -3'	59	105
CDH2	5'- GACGGTTCGCCATCCAGAC -3'	5'- TCGATTGGTTTGACCACGG -3'	56	67
SOX9	5'- AGCGAACGCACATCAAGAC -3'	5'- GCTGTAGTGTGGGAGGTTGAA -3'	58	110
LGR5	5'- CACCTCCTACCTAGACCTCAGT -3'	5'- CGCAAGACGTAACTCCTCCAG -3'	61	94
POU5F1	5’- ACATCAAAGCTCTGCAGAAAGAACT-3’	5’-CTGAATACCTTCCCAAATAGAACCC -3’	56	127
PDGFRB	5'- TGGTGCTCACCATCATCTCC -3'	5'- CACCTTCCATCGGATCTCGTAA -3'	59	80
SUSD2	5'- CAGCTACCAGAGATGGCGAGTGG -3'	5'- CCTCTCGGAAGTCATCGCTCAGG -3'	61	134
MCAM	5'- ATCGCTGCTGAGTGAACCACAG -3'	5'- CTACTCTCTGCCTCACAGGTCA -3'	58	123
ACTB	5'- ATGTGGCCGAGGACTTTGATT -3'	5'- AGTGGGGTGGCTTTTAGGATG -3'	58	107

Table 2. Descriptive statistics of the baseline characteristics.
	Statistic	Thin endometrium (N=10)	Normal endometrium (N=10)	p-value
Age (yr)	Mean (SD)	38.47 (2.71)	37.51 (4.48)	0.571
BMI (kg/m²)	Mean (SD)	22.45 (3.77)	23.11 (2.91)	0.881
Cycle length (day)	Mean (SD)	28.3 (1.7)	30.0 (2.4)	0.081
AFC	Mean (SD)	7.50 (1.29)	9.80 (1.30)	0.218
AMH (ng/ml)	Mean (SD)	1.75 (0.38)	2.14 (0.41)	0.353
Cause of infertility Tubal factor Male factor Unexplained	N (%)	1 (10) 3 (30) 6 (60)	1 (10) 5 (50) 4 (40)	0.809
Previous endometrial surgery or uterine curettage	N (%)	4 (40)	3 (30)	1.000
Type of gonadotropin hMG rFSH rFSH + LH	N (%)	3 (30) 4 (40) 3 (30)	2 (20) 5 (50) 3 (30)	1.000
Dose of gonadotropin (IU)	Mean (SD)	2485 (94.59)	2355 (153.56)	0.579
Type of oocyte triggering hCG GnRHa hCG+GnRHa	N (%)	5 (50) 1 (10) 4 (40)	6 (60) 1 (10) 3 (30)	1.000
Endometrial thickness (mm.)	Mean (SD)	6.10 (0.34)	12.18 (0.49)	0.000
Number of follicles more than 17 mm on day of oocyte retrieval	Mean (SD)	6.80 (0.69)	8.40 (0.91)	0.275
Estradiol level on day of oocyte retrieval (pg/ml) ≤ 750 750 – 1500 > 1500	Mean (SD) N (%)	1254.10 (223.89) 4 (40) 2 (20) 4 (40)	1108.50 (128.09) 2 (20) 6 (60) 2 (20)	0.853
BMI = body mass index, AFC = antral follicle count, AMH = Anti-Mullerian Hormone, hMG = human menopausal gonadotrophin, rFSH = recombinant follicle-stimulating hormone, LH = luteinizing hormone, hCG = human chorionic gonadotropin, GnRHa = gonadotropin releasing hormone, MII = Metaphase II, MI = Metaphase I, GV = germinal vesicle

Table 3. Relative mRNA expression of endometrial genes which are associated with different endometrial locations.
Gene	Location	Median fold change (2^-ΔΔ^Ct) (P₂₅,P₇₅)		P-value
Gene	Location	Thin endometrium (N=10)	Normal endometrium (N=10)	P-value
FUT4	Basalis	0.6762 (0.3872,0.8355)	0.4966 (0.3720,0.8533)	0.912
CDH2	Basalis	0.0796 (0.0441,0.1470)	0.0577 (0.0265,0.1309)	0.529
SOX9	Basalis	1.9243 (0.7849, 2.7088)	1.1614 (1.0376,1.8875)	0.481
LGR5	Luminal epithelium	1.0698 (0.3545,3.2941)	0.2740 (0.1182,0.9136)	0.123
POU5F1	Stroma	0.7213 (0.2418,1.7985)	0.7075 (0.3359, 3.2108)	0.796
PDGFRB	Perivascular	0.2831 (0.1452,0.5071)	0.4135 (0.1760,1.0905)	0.247
SUSD2	Perivascular	0.7519 (0.4450,1.0625)	1.3181 (0.7930,2.8350)	0.063
MCAM	Perivascular	1.2794 (0.0960,2.4335)	1.1132 (0.3262,2.1369)	0.853

Table 4. Relative mRNA endometrial gene expression at different endometrial locations associated with previous endometrial surgery or uterine curettage.
Gene	Location	Median fold change (2^-ΔΔ^Ct) (P₂₅,P₇₅)		P-value
Gene	Location	Yes (N=7)	No (N=13)	P-value
FUT4	Basalis	0.5362 (0.3363,0.7616)	0.5799 (0.3946,0.9229)	0.246
CDH2	Basalis	0.0722 (0.0448,0.1568)	0.0766 (0.0317,0.1017)	0.573
SOX9	Basalis	1.8100 (1.1890,2.6230)	1.1220 (0.7077,2.0710)	0.241
LGR5	Luminal epithelium	0.4889 (0.1578,0.9527)	0.8024 (0.1491,1.3570)	0.629
POU5F1	Stroma	1.4448 (0.3199,3.3290)	0.5460 (0.2690,1.5770)	0.522
PDGFRB	Perivascular	0.2253 (0.1364,0.6435)	0.3815 (0.2360,0.5245)	0.250
SUSD2	Perivascular	0.9803 (0.5341,2.0850)	0.9715 (0.5153,1.4230)	0.351
MCAM	Perivascular	1.1120 (0.4189,2.2300)	1.2810 (0.0788,2.4840)	0.781

Table 5. Relative mRNA endometrial gene expression at different endometrial locations that divided by the type of gonadotropin.
Gene	Location	Median fold change (2^-ΔΔ^Ct) (P₂₅,P₇₅)			P-value
Gene	Location	hMG (N=5)	rFSH (N=9)	rFSH+LH (N=6)	P-value
FUT4	Basalis	0.4033 (0.2659,0.7641)	0.6998 (0.4468,1.0250)	0.5799 (0.3146,0.7568)	0.501
CDH2	Basalis	0.0686 (0.0298,0.1554)	0.0821 (0.0363,0.1255)	0.0758 (0.0372,0.1414)	0.971
SOX9	Basalis	1.3170 (1.1040,2.3120)	1.6700 (0.5214,2.5460)	1.2390 (0.9405,2.8330)	0.571
LGR5	Luminal epithelium	0.9571 (0.2411,5.1110)	0.4175 (0.1384,7.0540)	0.8004 (0.0858,1.3000)	0.500
POU5F1	Stroma	0.5471 (0.2373,1.0000)	0.8370 (0.3376,2.2390)	1.8680 (0.3257,3.4090)	0.263
PDGFRB	Perivascular	0.1795 (0.0891,0.7075)	0.3606 (0.2784,0.5286)	0.3618 (0.2048,0.9175)	0.902
SUSD2	Perivascular	1.0040 (0.2843,1.8040)	0.8390 (0.5745,2.3580)	1.2160 (0.8103,1.7940)	0.709
MCAM	Perivascular	0.5440 (0.1182,1.5480)	1.4640 (0.4839,2.6550)	1.0420 (0.2932,2.5760)	0.519
hMG = human menopausal gonadotrophin, rFSH = recombinant follicle-stimulating hormone, LH = luteinizing hormone

Table 6. Endometrial gene expression according to different endometrial locations associated with the type of drug for oocyte triggering.
Gene	Location	Median fold change (2^-ΔΔ^Ct) (P₂₅,P₇₅)			P-value
Gene	Location	hCG (N=11)	GnRHa (N=2)	hCG + GnRHa (N=7)	P-value
FUT4	Basalis	0.6998 (0.4863,0.9054)	0.5663 (0.3781,0.7544)	0.4439 (0.3540,0.6527)	0.654
CDH2	Basalis	0.0759 (0.0223,0.1459)	0.0518 (0.0280,0.0757)	0.0773 (0.0649,0.1604)	0.769
SOX9	Basalis	1.3040 (0.0570,2.1790)	1.5280 (0.3737,2.6820)	1.7490 (0.8236,2.4450)	0.383
LGR5	Luminal epithelium	0.6613 (0.1084,1.2000)	0.5306 (0.1216, 0.9395)	0.8992 (0.1657,1.3850)	0.849
POU5F1	Stroma	1.0720 (0.4403,2.5200)	1.7600 (0.1256,3.3950)	0.4863 (0.2303,0.6057)	0.350
PDGFRB	Perivascular	0.5249 (0.4024,0.9138)	0.1380 (0.1320,0.1439)	0.2290 (0.1657,0.2711)	0.179
SUSD2	Perivascular	1.0040 (0.4937,2.3670)	1.0260 (0.9571,1.0940)	0.6552 (0.3698,1.2690)	0.639
MCAM	Perivascular	1.3660 (0.3772,2.6570)	1.3090 (0.0694,2.5490)	0.7186 (0.1071,1.4640)	0.141
hCG = human chorionic gonadotropin, GnRHa = gonadotropin releasing hormone

Table 7. Endometrial gene expression according to different endometrial locations associated with the Estradiol level on the day of oocyte retrieval.
Gene	Location	Median fold change (2^-ΔΔ^Ct) (P₂₅,P₇₅)			P-value
Gene	Location	E2 ≤ 750 pg/ml (N=6)	E2 751-1,500 pg/ml (N=8)	E2 > 1,500 pg/ml (N=6)	P-value
FUT4	Basalis	0.6612 (0.3873,0.7994)	0.4783 (0.3765,1.0730)	0.5695 (0.3280,0.7689)	0.702
CDH2	Basalis	0.1139 (0.0445,0.2037)	0.0789 (0.0523,0.1017)	0.0355 (0.0206,0.0932)	0.241
SOX9	Basalis	1.7410 (0.9600,2.6560)	1.4220 (1.0220,2.1640)	1.1940 (0.7111,2.7090)	0.833
LGR5	Luminal epithelium	0.8092 (0.3546,1.2460)	0.5109 (0.1291,10.1300)	0.5856 (0.1107,3.2090)	0.469
POU5F1	Stroma	0.8829 (0.5911,1.5870)	1.1160 (0.2690,3.2180)	0.3423 (0.1735,2.3180)	0.735
PDGFRB	Perivascular	0.4518 (0.2302,0.7407)	0.3879 (0.2024,1.3490)	0.1865 (0.1061,0.4017)	0.250
SUSD2	Perivascular	0.8542 (0.3731,2.4190)	1.0050 (0.6552,3.0850)	0.9803 (0.7527,1.1380)	0.533
MCAM	Perivascular	0.2753 (0.0574,2.0280)	1.2810 (0.6231,2.3590)	1.6630 (0.5563,2.4340)	0.547
E2 = estradiol

No competing interests reported.

Endometrial Gene Expression Profiles of Infertile Women with Thin Versus Normal Endometrial Thickness on The Day of Oocyte Retrieval: A cross-sectional study

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Conclusion

Methods

Declarations

References

Tables

Additional Declarations

Status:

Version 1