New Glycosyltransferase RpUGT2 from Rheum palmatum involved in the flavonoid glycoside Biosynthesis

doi:10.21203/rs.3.rs-3880617/v1

Download PDF

Research Article

New Glycosyltransferase RpUGT2 from Rheum palmatum involved in the flavonoid glycoside Biosynthesis

https://doi.org/10.21203/rs.3.rs-3880617/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Uridine diphosphate-dependent glycosyltransferases (UGTs) serve as key mediators in the glycosylation of plant metabolites, thereby inducing alterations in their physicochemical properties and bioactivities. Particularly, flavonoid glycosides are synthesized from aglycones through reactions catalyzed by typical UGTs. In our present investigation, we successfully cloned a novel UGT, RpUGT2, originating from Rheum palmatum, a highly regarded traditional Chinese herb known for its abundant genetic diversity. Sequence alignment and phylogenetic analysis indicated the close phylogenetic proximity of RpUGT2 to Vitis vinifera. The recombinant RpUGT2 protein, produced heterologously in Escherichia coli, displayed robust catalytic activity towards a spectrum of flavonoids. Mutational analyses revealed that specific amino acid sequence modifications could result in the loss of enzymatic activity in RpUGT2. This study has thus provided potential candidate genes, RpUGT2, for prospective applications in the metabolic engineering of flavonoid compounds in plants.

Rheum palmatum

glycosyltransferase

flavones

Site-directed mutagenesis

Flavonoids are a diverse and ubiquitous group of naturally occurring polyphenolic compounds found in the plant kingdom. They are characterized by a common carbon framework consisting of two benzene rings (A and B) connected by a three-carbon bridge (C) (Dixon et al. 1999; Dixon et al. 2010). This structure forms the basis for the numerous subclasses of flavonoids, which vary in the substitution patterns of hydroxyl, methoxyl, and other functional groups. Following the establishment of the fundamental flavone scaffold, these compounds frequently undergo modification through the enzymatic action of uridine diphosphate (UDP)-glycosyltransferases (UGTs), resulting in their existence as glycosides within plant systems (Rahimi et al. 2019).

Beyond their role in expanding the structural diversity of secondary metabolites in plants, glycosylation serves to enhance the solubility of compounds, impacting their bioavailability and biological activity in humans. This modification can also amplify specific biological effects, encompassing anti-HIV activity, tyrosinase inhibition, and anti-allergic properties (Xiao 2017). The glycosylation of glycosides within plants is orchestrated by the action of UGT, a member of the family 1 glycosyltransferases. UGTs possess the capability to transfer glycosyl moieties from UDP sugars to diverse substrates, notably including flavonoids (Yonekura-Sakakibara et al. 2011). These UGTs feature a characteristic plant secondary product glycosyltransferase (PSPG) motif comprised of 44 conserved amino acids located at the C-terminal region. This PSPG domain functions as a UDP-sugar-binding site (Jadhav et al. 2012).

Historically, medicinal plants have been esteemed for their therapeutic attributes and have held a substantial place in ethnomedicine and traditional healing practices (Jiao et al. 2011). Medicinal plant genetic resources are regarded as an invaluable asset. With the recent progress in genomics and transcriptomics, research in the field of medicinal plants has undergone a transformative evolution, necessitating a comprehensive exploration of gene functions.

Rheum palmatum, also referred to as Chinese rhubarb or "Da Huang" in the context of Traditional Chinese Medicine, boasts an extensive historical record of utilization within traditional Chinese, Tibetan, and Ayurvedic medicinal practices (Khattak et al. 2020). The imperative necessity lies in conducting gene function studies on R. palmatum, an endeavor that holds the promise of unveiling the plant's complete potential. In this study, we successfully identified a putative flavone UGT gene denoted as RpUGT2 within R. palmatum. Functional characterization studies unveiled its involvement in the in vitro biosynthesis of flavone glycosides. Furthermore, site-directed mutagenesis of RpUGT2 facilitated the identification of seven specific amino acids that exert a discernible influence on the glucosylation activity of RpUGT2, in comparison to the wild-type control enzyme. Our study thus offers valuable insights into the functional diversity and underlying biochemical mechanisms of RpUGT2 in the context of flavone glycoside biosynthesis.

2.1. Chemical compounds and Plant Materials

Flavonoid compounds, UDP-glucose, chromatographic methanol, and formic acid were procured from Fisher Chemical. Rheum palmatum plants aged between one to three years were sourced from Longnan, Gansu province, China, situated at coordinates 34.1°N, 105.1°E.

2.2. RNA Extraction and Gene Cloning

Total RNA extraction from the leaves was accomplished utilizing the EASYspin Plus RNA isolation kit (Aidlab, Beijing, China). The coding sequences of RpUGT2 were derived via PCR, employing gene-specific primers (Table 1), and reverse transcription-polymerase chain reaction (RT-PCR) was conducted using R. palmatum RNA and the M-MLV 4 First-Strand cDNA Synthesis Kit (Biomed, Beijing, China). Subsequently, the amplified DNA fragments of RpUGT2 were inserted into the pET-32a vector, a process facilitated by the Seamless Cloning Mix Kit (Biomed, Beijing, China).

Table 1

List of primers sequences were used in this study
Primer name	Sequence (5′–3′)
pET-32a-RpUGT2_F	GCTGATATCGGATCCGAATTCATGAAGAAAGCGGAGTTGGTC
pET-32a-RpUGT2_R	GTGGTGGTGGTGGTGCTCGAGTCAGAGCTCCTCTCCAAAGAC
RpUGT2-H18A_F	GGCTGATACGAGAGCGCCGGCTCCCGGC
RpUGT2- H18A_R	GCCGGGAGCCGGCGCTCTCGTATCAGCC
RpUGT2-R317A_F	TTCAACCGGCGCTCTCACACCCGACGTCGTC
RpUGT2-R317A_R	GACGACGTCGGGTGTGAGAGCGCCGGTTGAA
RpUGT2-N370A_F	CGCTCTCCAAAGTCGAGGCCCAACCACAATGCGACA
RpUGT2-N370A_R	TGTCGCATTGTGGTTGGGCCTCGACTTTGGAGAGCG
RpUGT2-Q390A_F	GCATTGCTCCGTTGCGCTGCATACAACGGCC
RpUGT2-Q390A_R	GGCCGTTGTATGCAGCGCAACGGAGCAATGC
RpUGT2-G368A_F	CCAAAGTCGAGTTCCAAGCACAATGCGACACAAAC
RpUGT2-G368A_R	GTTTGTGTCGCATTGTGCTTGGAACTCGACTTTGG
RpUGT2-W369A_F	GCTCTCCAAAGTCGAGTTCGCACCACAATGCGACACAAAC
RpUGT2-W369A_R	GTTTGTGTCGCATTGTGGTGCGAACTCGACTTTGGAGAGC
RpUGT2-T140A_F	GGCGGCGCCTGAGGCGAAGAACACGTAAG
RpUGT2-T140A_R	CTTACGTGTTCTTCGCCTCAGGCGCCGCC

2.3. Phylogenetic analysis

The amino acid sequences encoding RpUGT2 were extracted through the online NCBI ORF finder tool. Multiple sequence alignment was conducted using DNAMAN software. Subsequently, a neighbor-joining (NJ) phylogenetic tree was established with MEGA 11 software (Tamura et al. 2021), utilizing ClustalW multiple alignments, with a bootstrap value of 1000.

2.4. Recombinant Protein Expression

The expression vector, pET-32a-RpUGT2, was introduced into Escherichia coli strain BL21(DE3). The bacterial culture carrying the plasmids was cultivated in Luria-Bertani (LB) liquid medium enriched with 100 µg/mL ampicillin, incubated at 37°C with continuous agitation at 180 rpm. When the optical density at 600 nm (OD600) reached approximately 0.5, induction was initiated with 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) at 16°C, maintained in incubators operating at 160 rpm for an additional 16 hours. Subsequently, bacterial cells were collected through centrifugation at 10,000 rpm for 20 minutes at 4°C and then reconstituted in a lysis buffer comprising 100 mM phosphate buffer (PBS, pH 7.4) and a 100 mM NaCl solution. Following cell disruption via sonication, cellular debris was pelleted at 4°C and 13,000 rpm for 40 minutes. Finally, the recombinant RpUGT2 present in the supernatant was purified for enzymatic assays using a HisTrap HP column (Smart-Life Sciences Biotechnology, Changzhou, China).

2.5. Enzymatic Assays of RpUGT2

The enzymatic reactions were conducted within a 200 µL reaction volume, comprising 100 mM Tris-HCl buffer (pH 8.0), 5 mM UDPG, 0.5 mM acceptor substrate, and 50 µg of the purified enzyme. Simultaneously, the reaction mixture was combined with the lysate of E. coli BL21(DE3) induced with pET-32a, serving as a control. After a 12-hour incubation at 30°C, the reactions were halted by adding an equivalent volume of methanol. The upper organic phase was subjected to evaporation and subsequently reconstituted in methanol for subsequent evaluation via high-performance liquid chromatography (HPLC).

2.6. Influence of pH and temperature on glycosyltransferase activity

To investigate the influence of pH, the enzymatic reactions were executed in diverse reaction buffers, each with a distinct pH range: 5.0–6.0 (citric acid-sodium citrate buffer), 6.0–8.0 (Na₂HPO₄-NaH₂PO₄ buffer), 7.0–9.0 (Tris-HCl buffer), and 9.0–10.0 (Na₂CO₃-NaHCO₃ buffer). In terms of temperature, the reaction mixtures were subjected to incubation at varying temperatures within the range of 10°C to 50°C.

2.7. Molecular docking and Site-directed mutagenesis

The three-dimensional structure of RpUGT2 was predicted utilizing the Alphafold2 software, as previously elucidated (Yang et al. 2023). Molecular docking of the flavonoids with RpUGT2 structures was executed employing Schrödinger's Induced Fit Docking (IFD) module (Zhang et al. 2023). T For a deeper comprehension of the interactions between the protein and small molecules, PyMol was employed for analytical purposes.

A series of site-directed mutations were introduced by means of a site-directed mutagenesis kit (Aidlab, Beijing, China), employing pET-32a-RpUGT2 as the template. The PCR amplifications were conducted under the following user directions. The mutations were confirmed through sequencing, and the specific mutagenesis primers (Table 1). Purification of the mutant proteins was achieved using the same protocol as previously described for the native proteins.

3.1. Sequence analysis of RpUGT2

This confirmed sequence of RpUGT2 has been deposited in NCBI GenBank under the accession number MT834517. This sequence encompasses a complete open reading frame spanning 1425 base pairs, encoding a protein comprising 475 amino acids. The predicted molecular mass of RpUGT2 stands at 52.69 kDa, with an isoelectric point of 5.9.

Multiple sequence alignment analysis revealed that all these sequences share a conserved plant secondary product glycosyltransferases (PSPG) motif of 44 amino acids in their C-terminal region (Fig. 1). Furthermore, the C-terminus harbors a highly conserved HCGWNS motif (Fig. 1).

To delve into the evolutionary relationships between RpUGT2 and other plant glycosyltransferases, a phylogenetic tree was constructed. RpUGT2 exhibits its closest genetic relationship with Vitis vinifera (Fig. 2).

3.2. Enzymatic activity in vitro

To evaluate the glycosylation activity of RpUGT2, enzymatic assays were undertaken employing UDPG as the sugar donor and ten different flavonoid compounds as sugar acceptors. Notably, among the compounds tested, only kaempferol and isorhamnetin were identified as substrates for RpUGT2. These two compounds were catalyzed to yield glucosylated products characterized by enhanced polarity (Fig. 3).

3.3. Optimal pH and temperature of RpUGT2

We selected isorhamnetin and kaempferol as chemical substrates for RpUGT2 to determine the optimal pH and temperature conditions (Fig. 4). The optimal pH value for RpUGT2 was found to be 7.0, the optimal temperatures were 30°C.

The apparent Km value of RpUGT2 for kaempferol was determined to be 308.7 ± 3.213 µmol/L, with a Vmax of 58.68 ± 2.03 mmol·L^− 1·µg^− 1·min^− 1. For isorhamnetin, the apparent Km value of RpUGT2 was 355.9 ± 4.121 µmol/L, with a Vmax of 44.73 ± 2.83 mmol·L^− 1·µg^− 1·min^− 1 (Table 2).

Table 2

The kinetic parameters of recombinant RpUGT1 using kaempferol and isorhamnetin as substrates and UDP-glucose as donor substrate.
Substrate	K_m (µM)	V_max(mM·µg^− 1·min^− 1)	K_cat (S^− 1·10^− 3)	K_cat/K_m (M^− 1S^− 1)
Kaempferol	308.7 ± 3.213	58.68 ± 2.03	0.68 ± 0.32	453.97
Isorhamnetin	355.9 ± 4.121	44.73 ± 2.83	0.70 ± 0.25	508.4

3.4. Molecular docking

The binding model between RpUGT2 and kaempferol is depicted in Fig. 5A. Kaempferol exhibits a favorable steric complementarity with the binding site of RpUGT2. Additionally, hydrogen bond interactions have been established between RpUGT2 and kaempferol. Specifically, the oxygen atoms in the three phenolic hydroxyl groups of kaempferol, acting as hydrogen bond donors, engage in hydrogen bond interactions with the oxygen atoms of Gly368, Asn370, His16, and Arg317, respectively.

The binding model between RpUGT2 and isorhamnetin is illustrated in Fig. 5B. In this case, hydrogen bond interactions have formed between RpUGT2 and isorhamnetin. The oxygen atom in the carbonyl group of isorhamnetin, functioning as a hydrogen bond acceptor, engages in hydrogen bond interactions with nitrogen atoms of Arg317 and Trp369. Furthermore, the hydrogen atom in one of the hydroxyl groups of isorhamnetin, acting as a hydrogen bond donor, establishes hydrogen bonds with the oxygen atoms of Glu390 and Thr140.

3.5. Site-directed mutagenesis of RpUGT2 protein

To discern the critical residues within the sugar acceptor active site, molecular docking simulations were conducted for kaempferol and isorhamnetin, respectively. Based on the docking outcomes, seven specific sites were selected for subsequent examination employing alanine scanning mutagenesis. The catalytic activities of these mutants were assessed using the aforementioned positive substrates. High-performance liquid chromatography (HPLC) analyses revealed that when residues H18, R317, G368, N370, Q390, W369, and T140 were substituted with alanine, the protein's glycosylation activity was entirely abolished for all the tested substrates. These findings strongly suggest that these 7 residues play a pivotal role in determining the binding of the UDPG donor and, consequently, the glycosylation activity of RpUGT2.

UGT genes play a pivotal role in flavonoid biosynthesis, and extensive research has elucidated various UGTs in diverse plant species, including Arabidopsis, corn, soybean, and tea (Yin et al. 2017; Funaki et al. 2015; Lu, Guo, et al. 2023). In the course of our investigation, a UGT-like sequence was successfully cloned from R. palmatum. The analysis of RpUGT2 revealed a robust conservation of key residues, notably encompassing the characteristic 44-residue PSPG motif. These attributes closely mirror the typical features observed in glycosyltransferases within higher plants, thereby substantiating their functional roles as glycosyltransferases (Yu et al. 2020; Lu et al. 2023).

Our investigation confirmed the enzymatic activity of RpUGT2 towards a range of flavonoids through in vitro biochemical assays. RpUGT2 exhibited a pronounced substrate specificity, displaying notably high specificity for flavonol aglycones, specifically kaempferol and isorhamnetin. Notably, UGTs in various plant species are known to partake in flavonoid biosynthesis, each showcasing distinct substrate specificities. For example, GT04F14 in kudzu (Pueraria montana) and UGT73F2 in soybean recognize isoflavones, flavones, and flavonol aglycones as substrates, while MeUGT1 and MpalUGT1 in liverwort recognize quercetin, kaempferol, myricetin, and isorhamnetin (Dhaubhadel et al. 2008; He et al. 2011). In Lathyrus japonicus seeds, UGTs have been demonstrated to interact with flavonol substrates (Yin et al. 2017).

Through our analysis of enzyme kinetic parameters, it was evident that RpUGT2 exhibited a notably higher affinity for kaempferol, as indicated by low Km and high kcat/Km values, when compared to its affinity for isorhamnetin (Table 1). It is also noteworthy that the catalytic efficiency values (kcat/Km) of RpUGT2 towards flavonols surpassed those of previously identified UGTs from Astragalus membranaceus. Specifically, the kcat/Km value for isorhamnetin with RpUGT2 (453.97 M^− 1 s ^− 1) was 2.1 times higher than that for AmUGT88E29 (220.42 M^− 1s^− 1) and approximately 2.8 times higher than that for AmUGT88E30 (165.40 M^− 1s^− 1). (Hao et al. 2023).

The divergence in nucleotide sequences among glycosyltransferases contributes significantly to the array of functions they perform (Hu et al. 2002). The structural insights into glycosyltransferases are pivotal in the exploration of their structure and mechanisms. Previous investigations have indicated that the N-terminal amino acid residues of glycosyltransferase-encoded proteins are associated with acceptor binding, while the C-terminal amino acid residues are closely linked to donor recognition (Paquette et al. 2003; Bonisch et al. 2014). In our study, site-directed mutagenesis targeted at single positions (H18A, R317A, G368A, N370A, Q390A, W369A, and T140A) resulted in a loss of glucosylation activity for RpUGT2. This substantiates the impact of amino acids proximal to both the C-terminus and N-terminus on enzymatic activity (Jing et al. 2019).

To summarize, our investigation has unveiled a candidate gene within R. palmatum with the capacity to generate biologically active flavonoid glycosides upon expression in E. coli. Moreover, the homology modeling of RpUGT2 has offered a comprehensive understanding of its secondary and 3D structure, encompassing active site residues, hydrogen bond formation, and substrate binding mechanisms. Our findings have contributed to the identification of functional flavonoid UGTs, thus augmenting the genetic resources available for flavonoid biosynthesis.

Data availability

All data generated or analyzed during this study are included in this published article.

Funding

This work was financially supported by National Natural Science Foundation (82204567, 81973430), Hebei Natural Science Foundation (H2023201005), Shaanxi Provincial Key Industry Innovation Chain (Group) Project (2021ZDLSF04-01), China University Student Innovation and Entrepreneurship Training Program Project (202310075016).

Conflict of Interest statement

The authors declare no potential conflict of interest.

Author information

Authors and Affiliations

College of Traditional Chinese Medicine, Hebei University, Baoding, China

Jianzhen Zou, Jing Zou, Shiwen Zhang, Mengmeng Liu

College of Pharmacy and Shaanxi Qinling Application Development and Engineering Center of Chinese Herbal Medicine, Shaanxi University of Chinese Medicine, Xi’ an 712046, China

Gang Zhang

Contributions

JZZ and JZ contributed to the study conception and design. Data collection and experiments were performed by SWZ and GZ. GZ and JZZ analyzed the data. The first draft of the manuscript was written by MML and JZZ, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to MML.

Ethics declarations

Conflict of interest

The authors declare no potential conflict of interest.

Bonisch F J, Frotscher S, Stanitzek E, Ruhl M, Wust O, Bitz W, Schwab. (2014) A UDP-Glucose:Monoterpenol Glucosyltransferase Adds to the Chemical Diversity of the Grapevine Metabolome. Plant Physiology 165: 561-81.
Dhaubhadel S, M Farhangkhoee, R. Chapman (2008) Identification and characterization of isoflavonoid specific glycosyltransferase and malonyltransferase from soybean seeds. Journal of Experimental Botany 59: 981-994.
Dixon RA, Pasinetti G M (2010) Flavonoids and isoflavonoids: from plant biology to agriculture and neuroscience. Plant Physiology 154: 453-457.
Dixon RA, Steele CL (1999) Flavonoids and isoflavonoids - a gold mine for metabolic engineering. Trends Plant Science 4: 394-400.
Funaki A, Waki T, Noguchi A, Kawai Y, Yamashita S, Takahashi S, Nakayama T (2015) Identification of a Highly Specific Isoflavone 7--glucosyltransferase in the soybean ( (L.) Merr.) Plant and Cell Physiology 56: 1512-20.
Hao Y, Fu J, Zhang JZ, Du NH, Ta H, Zhu TT, Wang HL, Lou HX, Cheng AX (2023) Identification and Functional Characterization of UDP-Glycosyltransferases Involved in Isoflavone Biosynthesis in Astragalus membranaceus. Journal of Agricultural and Food Chemistry 71: 12775–12784.
He X, Blount JW, Ge S, Tang Y, Dixon RA (2011) A genomic approach to isoflavone biosynthesis in kudzu (Pueraria lobata). Planta 233: 843-55.
Hu Y, Walker S (2002) Remarkable structural similarities between diverse glycosyltransferases. Chemical Biology 9: 1287-96.
Jadhav SK, Patel KA, Dholakia BB, Khan BM (2012). Structural characterization of a flavonoid glycosyltransferase from Withania somnifera. Bioinformation 8: 943-949.
Jiao Y, Wickett NJ, Ayyampalayam S, Chanderbali A S, Landherr L, Ralph PE et al. (2011) Ancestral polyploidy in seed plants and angiosperms. Nature 473: 97-100.
Jing T, Zhang N, Gao T, Zhao M, Jin J, Chen Y et al. (2019) Glucosylation of (Z)-3-hexenol informs intraspecies interactions in plants: A case study in Camellia sinensis. Plant, Cell & Environment 42: 1352-1367.
Khattak, Aamir K, Syeda MH, Shahzad SM (2020) General overview of phytochemistry and pharmacological potential of Rheum palmatum (Chinese rhubarb). Innovare Journal of Ayurvedic Sciences, 8: 1-5.
Lu M, Guo J, Dong D, Zhang M, Li Q, Cao Y, Dong Y, Chen C, Jin X (2023) UDP-glycosyltransferase gene SlUGT73C1 from Solanum lycopersicum regulates salt and drought tolerance in Arabidopsis thaliana L. Functional & Integrative Genomics, 23: 320.
Lu X, Huang LJ, Scheller HV, Keasling JD (2023) Medicinal terpenoid UDP-glycosyltransferases in plants: recent advances and research strategies. Journal of Experimental Botany 74: 1343-1357.
Paquette S, Moller BL, Bak S (2003) On the origin of family 1 plant glycosyltransferase. Phytochemistry 62: 399-413.
Rahimi S, Kim J, Mijakovic I, Jung KH, Choi G, Kim SC, Kim YJ (2019) Triterpenoid-biosynthetic UDP-glycosyltransferases from plants. Biotechnology Advances 37: 107394.
Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution, 38: 3022-3027.
Xiao J (2017) Dietary flavonoid aglycones and their glycosides: Which show better biological significance?. Critical Reviews in Food Science and Nutrition 57: 1874-1905.
Yang Y, Hu Y, Yao F, Yang J, Ge L, Wang P, Xu X (2023) Virtual screening and activity evaluation of human uric acid transporter 1 (hURAT1) inhibitors. RSC Advance 13: 3474-1386.
Yin QG, Shen GA, Di SK, Fan CY, Chang ZZ, Pang YZ (2017a) Genome-Wide Identification and Functional Characterization of UDP-Glucosyltransferase Genes Involved in Flavonoid Biosynthesis in Glycine max. Plant and Cell Physiology 58: 1558-1572.
Yonekura-Sakakibara K, Hanada K (2011) An evolutionary view of functional diversity in family 1 glycosyltransferases. Plant Journal 66: 182-193.
Yu XF, Liu J, Wan JQ, Zhao L, Liu YR, Wei Y, Ouyang Z (2020) Cloning, Prokaryotic Expression, and Enzyme Activity of a UDP-Glucose Flavonoid 3-O-Glycosyltransferase from Mulberry (Morus alba L.) Leaves. Pharmacognosy Magazine, 16: 441-447.
Zhang Y, Vass M, Shi D, Abualrous E, Chambers JM, Chopra N, Higgs C, Kasavajhala K, Li H, Nandekar P, Sato H, Miller EB, Repasky MP, Jerome SV (2023) Benchmarking Refined and Unrefined AlphaFold2 Structures for Hit Discovery. Journal of Chemical Information and Modeling 63: 1656-1667.

Download PDF

Editorial decision: Major revisions
30 Mar, 2024
Reviewers agreed at journal
18 Feb, 2024
Reviewers invited by journal
15 Feb, 2024
Editor invited by journal
02 Feb, 2024
Editor assigned by journal
25 Jan, 2024
First submitted to journal
23 Jan, 2024

You are reading this latest preprint version

New Glycosyltransferase RpUGT2 from Rheum palmatum involved in the flavonoid glycoside Biosynthesis

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1. Chemical compounds and Plant Materials

2.2. RNA Extraction and Gene Cloning

2.3. Phylogenetic analysis

2.4. Recombinant Protein Expression

2.5. Enzymatic Assays of RpUGT2

2.6. Influence of pH and temperature on glycosyltransferase activity

2.7. Molecular docking and Site-directed mutagenesis

3. Results

3.1. Sequence analysis of RpUGT2

3.2. Enzymatic activity in vitro

3.3. Optimal pH and temperature of RpUGT2

3.4. Molecular docking

3.5. Site-directed mutagenesis of RpUGT2 protein

4. Discussion

Declarations

References

Status:

Version 1