Animals and materials
(1)A total of 20 adult New Zealand rabbits were randomly divided into the chitosan group and the control group, with 10 rabbits in each group. The rabbits were purchased from the Hubei Provincial Center for Disease Control and Prevention (Wuhan, Hubei, China). The average weight of the rabbits was 2.83 kg. The animals and procedures were approved by the Ethics Committee of Wuhan Fourth Hospital,and conducted following the relevant guidelines and regulations(Approval Number:20191947).
(2) Titanium rod prostheses purchased from Stryker Co. Ltd., USA, were cylindrical in shape (length, 2 cm; diameter, 0.5 cm) and sterilized using a high-pressure steam before use.
(3) Chitosan hydrogel was purchased from Shijiazhuang Yishengtang Medical Product Co. Ltd. in China. CMC was used as the main component and was configured with a physiological equilibrium solution with a concentration of 25 mg/ml. It was a colourless transparent viscous liquid that was stored in a sterile area and sealed in a 4°C refrigerator for single use. We diluted it according to the results of the CCK8 test and selected the concentration with the best cell proliferation ability for the experiment.
(4) Wuhan Fourth Hospital provided animal cages and an experimental operation platform.
Detection of the value-added ability of carboxymethyl chitosan
RAW264.7 cells that were in the logarithmic growth phase were used for the experiments. The cell density was adjusted to 5x103/ml with DMEM.A total of 0 (control group), 0.1, 0.2, 0.5, 1, 5, or 25 mg/mL carboxymethyl chitosan was added to cells in each well of a 96-well plate, and the plate was placed in an incubator for 24 h. A total of 10μL of cck8 reagent was added to each well, and the plate was incubated at 37 ℃ with 5% CO2 for 4 h. After incubation, the solution was mixed thoroughly, and the absorbance at 450 nm was measured with a microplate reader. Cell proliferation rate = absorbance value of experimental group-absorbance value of blank group / absorbance value of the control group-absorbance value of the blank group. The concentration with the least effect on cell activity was chosen for subsequent experiments.
Animal surgery
All rabbits were adaptively fed for 1 week before surgery. The animals were anaesthetized intramuscularly with xylazine hydrochloride 0.2 ml/kg. The rabbit was placed in a supine position on an operating table. The right knee was used as the surgical side. The sterile towel covered the surgical area, and the medial skin incision and paracondylar approach were used to expose the articular cartilage along the subcutaneous tissue and the joint capsule layer. A hole was drilled above the endpoint of the posterior cruciate ligament in the femoral intercondylar fossa to open the medullary cavity, and the medulla was expanded from 0.3 cm to 0.5 cm along the longitudinal axis of the femur with a depth greater than 2 cm. The titanium rod of the chitosan group was immersed in the CMC solution for half an hour and subsequently implanted in the femoral bone marrow cavity. Each layer of tissue was closed after the medullary cavity was flushed with saline(FIGURE 1).
Postoperative management
The principle of aseptic operation was followed, and 400,000 units of intramuscular injection of penicillin was administered twice a day for the first 3 days after operation. None of the animals had any lower extremity fixation.
Animal sacrifice and tissue harvest
All animals were euthanized with excess anesthetic after 12 weeks. Synovial tissue on the ipsilateral side of the knee joint was extracted and placed in 10% zinc formalin to prepare paraffin sections. The titanium rod segment with the right distal femur was collected, and the bone was cut off using a hacksaw 2 cm away from the knee joint surface. The distal part was stored frozen at -80°C, and hard tissue sections were prepared. The residual boundary membrane tissue around the two titanium rods was retained; one part was placed in ribonucleic acid (RNA) lysing solution which sealed and stored in liquid nitrogen, and the other part was placed in a 1.5-ml test tube which stored in -80°C refrigerators. Both were srored for reverse transcription polymerase chain reaction (RT-PCR) and western blotting (WB).
Radiological evaluation
The X-ray film of the right knee joint was irradiated to observe bone formation. Micro-computed tomography (CT) was performed to reconstruct the osteogenesis around the titanium rod, and bone tissue volume/total volume of bone tissue and prosthesis (BV/TV) was calculated[17].
Bone and synovial tissue staining and analysis
The synovial tissue of the knee joint was treated with paraffin sections and stained with haematoxylin and eosin (HE). Bone containing titanium rods was processed by non-decalcified hard tissue sections. The non-decalcified bone tissue retained the structure of the trabecular bone and accurately reflected bone growth, which was convenient for the study of bone growth and absorption. Bone tissue was cut into 50-micron sheet structures and cut along the long axis of the femur using a thin slicer. The hard sections were subjected to Van Gieson (VG) and Von Kossa staining. Based on the VG staining, the bone-prosthesis contact rate(B-PCR, the length of the circumference of the bone in contact with the prosthesis/total circumference of the prosthesis[18]) and bone volume percentage (BVP, squares of the bone tissue in a1 mm area around the prosthesis/total squares of the 1mmarea around the prosthesis[19]) were analysed. Von Kossa staining can be used to measure the number and area of calcium salt deposit islands (CSDIs) around the prosthesis[20].
Western blotting
The tissue stored in liquid nitrogen was moved to an Eppendorf tube, and lysis buffer was added to lyse the cells. The protein concentration was quantified using a bicinchoninic acid (BCA) protein concentration determination kit. A 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)gel was prepared, the protein sample was loaded, electrophoresis was performed, the proteins were transferred to a membrane, and the membrane was blocked and incubated with the indicated antibodies, namely, mouse monoclonal antibody matrix metalloproteinase-9 precursor (MMP9,Abcam,Ab58803) and osteocalcin (OCN,Abcam,Ab13420), rabbit polyclonal antibody OPG(Bioss,Bs-20624R) and RANKL(Bioss,Bs-2064R), and rabbit polyclonal β-actin, at 4°C. After 24 h, membranes were rinsed and subsequently incubated with horseradish peroxidase (HRP)-labelled goat anti-mouse(Wuhan Boster Biological Technology.,LTD,BA1051) and goat anti-rabbit(Wuhan Boster Biological Technology.,LTD,BA1054) secondary antibodies for 2 h at room temperature. Membranes were developed in a dark room with the electrochemiluminescence (ECL) light-emitting kit. The Bio-Rad Gel Imaging System was used to collect the images and to perform greyscale scanning analysis of the images.
Real-time polymerase chain reaction
Total RNA was extracted using TRIzol reagent, and 2μg of total RNA was used for the reverse transcription reaction. The reverse transcription conditions were as follows: 25℃ for 5 min, 50℃ for 15 min, 85℃ for 5 min, and 4℃ for 10 min. Two microlitres of the above reaction solution was used for PCR, and the following PCR conditions were used: 50℃ for 2 min, 95℃ for 10 min, 95℃ for 30 s, and 60℃ for 30 s, with a total of 40 cycles. The primers were designed using Primer Premier 5.0 software and verified by Blast. The primer sequences are listed in Table 1. Five microlitres of the amplified product was used for analysis by 1% agarose gel electrophoresis, pictures were taken under an ultraviolet light, and the greyscale value was determined using ImageJ 1.45s software. The relative expression level of the target messenger RNA (mRNA) is expressed as the ratio of the greyscale values of the target band and the internal reference, namely, glyceraldehyde 3-phosphate dehydrogenase.
Table 1 Primer sequence
Gene
|
Upstream Primer
|
Downstream Primer
|
MMP9
|
GTACTCGACCTGTACCAGCG
|
TTCAGGGCGAGGACCATAGA
|
OCN
|
AGCAAAGGTGCAGCCTTTGT
|
GCGCCTGGGTCTCTTCACT
|
OPG
|
GGAACCCCAGAGCGAAATACA
|
CCTGAAGAATGCCTCCTCACA
|
RANKL
|
CAGAAGATGGCACTCACTGCA
|
CACCATCGCTTTCTCTGCTCT
|
GAPDH
|
ATGGGGAAGGTGAAGGTCG
|
GGGGTCATTGATGGCAACAATA
|
Statistical analysis
Image-Pro Plus (IPP) 6.0 was used for graphics and data processing. Data analysis was performed using Graph Pad Prism 6.03 data results for standard deviation analysis. The data model used one-way analysis of variance, with a p value of 0.05 considered statistically significant.