Cell culture and treatments
The mouse ameloblast-like cell line (LS8) was kindly donated by Malcolm L. Snead (Department of Biomedical Sciences, University of Southern California) cultured in DMEM supplemented with 10% FBS and 100 units/ml penicillin, and 100 mg/ml streptomycin (Invitrogen, CA, USA). The incubator atmosphere was humidified and adjusted at 5% CO2 and 95% air at 37°C. When reached 70–80% confluence, the cells were incubated with serum-free medium containing the indicated concentrations (0~2 mM) of NaF. After the treatment, the cells were incubated for 24 hours or 48 hours at 37°C.
Chemicals and antibodies and antibodies
Rabbit Anti-phospho-p44/42 ERK (#9101), rabbit Anti-phospho-MEK (#9154), Anti-ERK (#9102), and GAPDH (#97166) were purchased from Cell Signaling (Beverly, MA, USA). MKP-1 (#373841) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). All antibodies were used at a dilution ratio of 1:500~1:1000 for western blot analysis. Inhibitor PD98059 was purchased from Cell Signaling (Boston, MA, USA). Activator curcumin was purchased from Sigma Aldrich Fluka (St. Louis., MO, USA). The inhibitor and activator were dissolved separately in dime thylsulfoxide (DMSO, Sigma, MO, USA) immediately before use. Anti-rabbit and anti-mouse secondary antibody were purchased from Zhongshan Biological Manufacture (Zhongshan Co., Ltd, Beijing, China). Dulbecco’s modified Eagle’s medium (DMEM) was supplied by Thermo Scientific Company (Logan, Utah, USA). Fetal bovine serum (FBS) was supplied by Gibco (GIBCO, Invitrogen, CA, USA), Lipofectamine 2000 Transfection Reagent was purchased from Invitrogen (Carlsbad, CA, USA). Trizol Reagent was purchased from Invitrogen (Carlsbad, CA, USA). MKP-1-mus-773 siRNA that specifically target mouse MKP-1 and control siRNA, or FAM-labeled negative control siRNA were purchased from Gene Pharma (Gene Pharma Co., Ltd, Shanghai, China). All procedures were conducted with approval from the Ethics Committee at Xi’an Jiaotong University, Xi’an, China.
Transient transfection siRNA
SiRNA-MKP-1 purchased form Shanghai jima pharmaceutical technology co. LTD. At 40% confluence, LS8 cells were transfected with silencing RNA (siRNA) against MKP-1, using Lipofectamine 2000 transfection reagent (Invitrogen, CA, USA) according to the manufacturer’s instruction. Briefly, MKP-1-siRNA was diluted in serum-free culture medium with the transfection reagent, mixed by vertexing and incubated for 20 minutes at room temperature to allow the formation of the transfection complex. Then the MKP-1-siRNA was added to the cells for 24 hours. The effectiveness of gene silencing was monitored by measuring the MKP-1 levels in relation to GAPDH, as analyzed by qRT-PCR for mRNA expression level. Cells transfected with MKP-1-siRNA, were further exposed to NaF for 24 hours. The mRNA expression level of c-myc, CREB, Elk-1 was determined by using qRT-PCR.
Protein extraction
Cells were washed with chilled PBS and lysed in ice-cold RIPA buffer as previously described [5], consisting of 50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM EDTA, 10 mM EGTA, 2 mM sodium pyrophosphate, 4 mM paranitrophenyl phosphate, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 2 µg/ml leupeptin and 2 µg/ml pepstatin. Cell lysate was collected using a cells scraper (Corning, Acton, MA) and the homogenates sonicated on ice for 30 min. The lysate was collected by centrifugation at 12,000×g for 15 min at 4°C. The protein content was determined using a BCA protein assay kit (Pierce, Rockford, IL) by extrapolation to dye binding for a standard series of known protein concentration using spectrophotometry.
Western blotting
A volume of supernatant corresponding to an equal mass of protein for each experimental condition was mixed with loading buffer (5-sodium dodecyl sulfate, 5% v/v) and denatured by heating the samples at 95°C for 5 min. Lysate proteins were resolved to size by electrophoresis using 10-12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to 0.22 µm polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA) using a semi-dry blotting system (Bio-Rad, Hercules, CA, USA). Non-specific absorption by the membranes was blocked by incubation with 5g% (w/v) skin milk in Tris-buffered saline (TBS, 500 mM NaCl, 20 mM Tris-HCl pH 7.5) with 0.05% (v/v) Tween-20 for 2 hours. Samples were incubated overnight with one of the following primary antibodies at 4°C: Anti-phospho-ERK and total ERK (1:1000), Anti-phospho-MEK (1:1000), Anti-MKP-1 (1:500), GAPDH (1:1000), each diluted in TBS with 5% (v/v) bovine serum containing 0.1% Tween-20 for 24 hours at room temperature with gentle shaking. The membranes were washed using 0.1% Tween-20 TBS three times for 10 min each and incubated with horseradish peroxidase conjugated anti-rabbit or anti-mouse secondary antibody (1:10000), as appropriate for each primary antibody, for 1 hour at room temperature. After washing in TBS-0.1% Tween-20 three times, an enhanced chemiluminescence kit (Millipore, MA, USA) was used to detect immunoreactive protein bands. Blots were immuno-detected with an anti-GAPDH antibody (1:1000) to confirm equal mass of protein loaded among samples. The intensity for each immunoreactive protein band was quantified using a Quantity One densitometer (BioRad, Hercules, USA).
RNA Extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
The total RNA of the cells was extracted using Trizol reagent (Carlsbad, CA, USA) according to the manufacturer's instruction. The quality and quantity of the isolated RNA was examined using a NanoDrop 2000/2000C spectrophotometer with measuring absorbance at 260/280nm. First-strand c-DNA synthesis was performed on 2 µg of total RNA using reverse transcription with Real Master Mix (Thermo Fisher Scientific, Logan, Utah, USA). QRT-PCR was performed in a 10 µL reaction mixture system using an Applied Bio systems 7500 Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) with an initial denaturation of 5 min at 95°C, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s, and 72°C for 30 s. Primers used in the amplification were designed and synthesized by Gene Pharma (Gene Pharma Inc., Shanghai, China). The sequences of the PCR primers were as follow: MKP-1 F:5' CCCCTGAGTACTAGTGTGCCTGAC 3', MKP-1 R:5' AGCTGAAGTTC GGGGAGATGATAC 3';C-myc F:5' GCT GCA TGA GGA GAC ACC 3', c-myc R:5' GTG CGG AGG TTT GCT GTG 3'; CREB F:5' ACA GAT TGC CAC ATT AGC 3', CREB R:5' GGACTTGTGGAGACTGGA 3' ; Elk-1 F:5' ATATCATCCGCAAGGTG AGC3', Elk-1 R:5' ATGGCCGAGGTTACAGACAC3' ; GAPDH F:5' GCTGA GTATGTCGTGGAGT3, 'GAPDH R:5' GTTCACACCCATCACAAAC3; were used as the internal control. A melting curve analysis was performed on each amplicon to ensure amplification of a single PCR product. The relative expression levels were calculated using the comparative threshold cycle (△△CT) method.
Statistical analysis
Statistical analyses were performed using SPSS software, Version 18.0 (SPSS Inc; Chicago, IL). All data were expressed as mean ± standard deviation (SD) with each experiment performed in triplicates. Differences among groups were tested by one-way ANOVA or two-way ANOVA, and the T test was used for two individual comparisons. For all analyses, two-tailed p values of less than 0.05 were considered significant.