Animal and sample collection
Piglets (3 days) were provided by the animal experiment animal ranch of Northwest A&F University. According to the regulations of the Animal Protection Committee of Northwest A&F University, all pigs were killed in the slaughterhouse. Dissect the heart, liver, spleen, lung, kidney, dorsal longest muscle (LD) and subcutaneous white adipose tissue (SWAT), and rinse with phosphate buffered saline (PBS). The samples used for real-time quantitative PCR (RT-qPCR) were frozen and stored in liquid nitrogen.
Isolation and culture of porcine intramuscular preadipocytes
After the 3 days old piglets were sacrificed, the intramuscular preadipocytes in LD were extracted. Refer to this document for the specific operation method [27].
Transfection of mimics/inhibitor NC and miR-146a-5p mimic/inhibitor
Porcine intramuscular preadipocytes were seeded in 6-well, 12-well, 24-well or 96-well plates. When detecting cell proliferation, miR-146a-5p mimics or mimics negative control (MNC) (Ribobio, China) were transfected (50 nM) when the cell density reached 50–60%. During transfection, X-tremeGENE siRNA Transfection Reagent (Roche, USA) was mixed with Opti-MEM medium (Gibco, USA) for 5 minutes, then the two mixtures were mixed for 20 minutes and added to the cell culture medium, and the medium was replaced with fresh culture after 12 hours. Cells were harvested 24 hours after transfection for cell proliferation studies. When transfected with miR-146a-5p inhibitor, the method is the same as above, but the final concentration of miR-146a-5p inhibitor was 100 nM. For the differentiation of preadipocytes, the cells are transfected when the cell density reaches 70%. When cells grow to confluence after transfection, adipogenic differentiation begins by switching to differentiation medium.
Total RNA extraction, RNA reverse transcription and RT-qPCR
After obtaining the cells, the cells were lysed with Trizol reagent (TakaRa, Otsu, Japan) and the total RNA in the cells was extracted. The concentration of total RNA was measured by the NanoDrop 2000 (Thermo, Waltham, MA, USA). Then the reverse transcription kit (TakaRa, Otsu, Japan) was used to synthesize cDNA. The specific reverse transcription primers and procedures were used for miRNA inversion. About real-time quantitative PCR, the SYBR green kit was used and three replicates were set up, and then the PCR reaction was performed on the Bio-Rad iQTM5 system. GAPDH was used as the internal reference for all genes for standardized analysis. But when analyzing miR-146a-5p levels, U6 was used as an internal reference. Table 1 shows the primer sequences used for qPCR. The primer sequences used for qPCR were shown in Table 1.
Table 1
Primer sequences used in this study.
Gene | Forward (5′–3′) | Reverse (5′–3′) |
Cyclin B | AATCCCTTCTTGTGGTTA | CTTAGATGTGGCATACTTG |
Cyclin D | TACACCGACAACTCCATCCG | GAGGGCGGGTTGGAAATGAA |
Cyclin E | CAGAGCAGCGAGCAGGAGC | GCAAGCTGCTTCCACACCACAT |
P21 | AGGTCGGAGTGAACGGATTTG | AGGTCGGAGTGAACGGATTTG |
C/EBPβ | AGGTCGGAGTGAACGGATTTG | AGGTCGGAGTGAACGGATTTG |
PPARγ FABP4 SMAD4 TRAF6 GAPDH | AGGTCGGAGTGAACGGATTTG AGGTCGGAGTGAACGGATTTG TCACTATGAGCGGGTTGTCTC GGGAACGATACGCCTTACAA AGGTCGGAGTGAACGGATTTG | AGGTCGGAGTGAACGGATTTG AGGTCGGAGTGAACGGATTTG TCCTTCAGTGGGTAAGGACG CTCTGTCTTAGGGCGTCCAG AGGTCGGAGTGAACGGATTTG |
Western blots
Cell samples were lysed using radio immunoprecipitation assay (RIPA) buffer (Beyotime, China) supplemented with protease inhibitor (Pierce, WA, USA) and total protein was extracted. The total protein samples were separated by electrophoresis in SDS-polyacrylamide gel. Then transferred it to PVDF membranes (Millipore, Bedford, MA, USA). After blocking the membrane in 5% skim milk for 2 hours, the primary antibody was incubated overnight (4 °C) and the secondary antibody was incubated for 1.5 hours (4 °C). Protein bands were exposed with chemiluminescent reagents (Millipore, Bedford, MA, USA) and quantified using Image J. Following primary antibodies were used: Cyclin D (1:100; Santa Cruz, USA), Cyclin E (1:100; Santa Cruz, USA), PCNA (1:1000; CST, USA), P21 (1:100; Santa Cruz, USA), C/EBPβ (1:100; Santa Cruz, USA), PPARγ(1:100; Santa Cruz, USA), FABP4 (1:100; Santa Cruz Biotechnology, Dallas, TX, USA), TRAF6 (1:500; Aviva Systems Biology, USA), SMAD4 (1:100; Santa Cruz, USA), β-actin (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA), The secondary antibodies were anti-rabbit, anti-goat and anti-mouse antibodies (1:3000; Santa Cruz Biotechnology, Dallas, TX, USA). The targeted proteins were detected using the Gel Doc XR System (Bio-Rad, Hercules, CA, USA) as the instructions of the manufacturer.
Target prediction and luciferase activity assay
The target genes of miR-146a-5p were predicted with Target-Scan 7.0. For the dual-reporter assay, we constructed a wild-type and mutant psiCHECK-2-reporter vector containing the target genes SMAD4 and TRAF6 3′ UTR region (TongYng). HEK293T was seeded in a 48-well plate and cotransfected with miRNA mimics or the negative control with psiCHECK-2–SMAD4 (or TRAF6)-reporter vector or mutant vector. After 48 h of transfection, the relative luciferase activity of Renilla compared with firefly was measured.
EDU imaging assay
We used the Cell-Light™ EdU Apollo® 567 In Vitro Imaging Kit and configured the mixed solution according to the instructions. The preadipocytes in the normal growth stage were treated with 50 µM EDU medium for 2 h. After the cells were fixed with 4% paraformaldehyde, they were stained with Apollo reaction solution. Then cell nucleus was stained with Hoechst. Nikon TE2000 microscope (Nikon, Tokyo, Japan) was used to take pictures, and the data was analyzed using Image J.
Cell Counting kit 8 (CCK8) analysis
Preadipocytes were seeded to 96-well plate in a number of 4 × 103 cells. Preadipocytes were transfected with miR-146a-5p mimics / inhibitor or mimics / inhibitor negative control with 3 repetitions. After treatment for 24 h we switched the cells to culture medium containing 10% CCK solution for 2 h at 37 °C followed by measuring absorbance at 490 nm.
Flow cytometry
After 24 hours of cell treatment, first wash 3 times with PBS, then fix the cells with 70% alcohol at -20 °C overnight, then treat with RNaseA at 37 °C (1 mg/mL, 40 min), and stained with propidium iodide (PI) at 4 °C (50 mg/mL, 1 h). The samples were detected using a FACS Calibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). The proliferation index (PI) shows the proportion of mitotic cells among the 10,000 cells examined.
Oil Red O, BODIPY and AdipoRed staining
For Oil Red O staining, cells were fixed in a 4% paraformaldehyde solution for 30 minutes, induced with 60% Oil Red O for 30 minutes, and washed three times with PBS, and then the cells were visualized by phase-contrast microscope (IS-Elements software, Nikon ECLIPSE, Tokyo, Japan). Oil Red O was extracted with 100% isopropanol, and its relative concentration was determined by measuring the absorbance at 510 nm. After being fixed in 4% paraformaldehyde solution for 15 min, cells were stained with BODITY (1 µg/mL; Life Technologies, Carlsbad, CA, USA) or AdiopRed (30 µl / ml; Lonza, USA) for 20 min; the sections were washed with PBS three times for 5 min each. For nuclear visualization, DAPI (4′,6-diamidino-2-phenylindole; Roche) was incubated for 10 min, then the section was rinsed with PBS. After treatment, the sections were observed under fluorescence microscope (Nikon, Tokyo, Japan).
Bioinformatics analysis
The sequences of miRNAs were searched for at miRBase (http://www. mirbase.org/). Sequence alignment using MAGA software. The 3’UTR sequences of E2F3 and P55PIK were downloaded from NCBI. Target genes of miRNA were predicted by TargetScan 7.0 Human (http://www.targetscan.org).
Statistical analysis
All charts were created using GraphPad Prism 6.0 and the data represent the mean ± SEM. The significance of differences between the groups was assessed using the Student’s t test or one-way analysis (*, P༜0.05; **, p༜0.01).