GO characterization
Commercially produced GO powder, purchased from Sigma-Aldrich (USA), was dispersed in pure water to prepare a stock solution (1 mg/mL). Before characterization and subsequent experiments, the stock solution was sonicated for 2 h (40 kHz, power 99%) using an ultrasonic processor (Biosafer, China). For characterization, the prepared GO sample was separately placed on mica and copper plates with 200 mesh grids for assessment via AFM (Bruker, USA) and TEM (Hitachi, USA). The structure of GO was assessed using Raman spectroscopy (Renishaw, UK) with a 514-nm laser. To acquire detailed information on its physicochemical properties, GO was dissolved in pure water, PBS, and complete culture medium for 12 h, 24 h, 3 d, 5 d, and 7 d. Then, the average hydrodynamic particle size and zeta potential were analyzed using DLS (Malvern, UK). For DLS measurements, 1.2 mL of GO sample solution in the cuvette accepted the light from the laser and the process of each sample was conducted at least 12 runs. The photodiode detector (Malvern, UK) was used to acquire the DLS signals and then processed with Zetasizer nanoapplication software (Malvern, UK).
Animal experimentation
Female C57BL/6 mice (6-8 weeks old and weighing 18-20 g), purchased from the Animal Research Center of Southern Medical University (Guangzhou, China), were housed in a specific pathogen-free facility. The mice were divided into four groups (n=5 per group): WT mice without DSS or GO treatment (WT group); WT mice treated with GO (WT-GO group); WT mice treated with DSS to induce colitis (DSS-WT group); and mice with DSS-induced colitis exposed to GO (DSS-GO group). To generate the acute colitis model, female C57BL/6 mice were administered 2.5% DSS (MP, USA) orally with drinking water for 5 days and then received normal drinking water for 3 days. Mice were exposed to GO separately via oral gavage at a dose of 60 mg/kg/day on days 2, 4, 6, and 8. During the process, the mice were monitored daily to observe for weight change, diarrhea, and rectal bleeding. A schematic representation of the animal protocol is provided in Fig. 2a.
H&E and TUNEL staining assay
Mice were sacrificed on day 9, and colon samples were collected and fixed in 4% paraformaldehyde, sectioned, and stained with H&E for examination using light microscopy. Histological scoring was conducted following a previously described system [58]. For the TUNEL assay, colon slices were stained with Reagent 1 (TdT) and Reagent 2 (dUTP) at a mass ratio of 2:29 following the instruction of the TUNEL kit for 1 h before nuclear staining with 4',6-diamidino-2-phenylindole dihydrochloride (DAPI, Beyotime, China). After washing with PBS thrice, fluorescence microscopy (Nikon, Japan) was conducted to observe the apoptotic cells in the intestinal tract and collect images (UV excitation wavelength 330-380 nm, emission wavelength 420 nm; FITC green light excitation wavelength 465-495 nm, emission wavelength 515-555 nm).
Cell culture
A human colon epithelium cell line, the FHC cell line, purchased from the American Type Culture Collection (ATCC, VA) was used as an ideal in vitro model of IECs because it could form a confluent layer, thus allowing us explore the cell membrane integrity [59]. FHC cell line was maintained in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco, USA). FHC cells were cultured in a humidified atmosphere at 37°C with 5% CO2.
Cell viability and membrane integrity assay
Cell counting kit (CCK)-8 (Dojingdo, Japan) and LDH assays were performed to evaluate the cell viability and cell membrane integrity, respectively. FHC cells were seeded in 96-well plates at a density of 5 × 103 cells/per well and incubated overnight for adherence. GO was introduced into cells at various concentrations (10, 25, 50, 100, and 200 µg/mL) for 24 h or incubated with 25 and 50 µg/mL GO for 6, 12, and 24 h to investigate the cytotoxic effect of GO on FHC cells in concentration and time aspects, untreated cells served as the control group. For DSS-stimulated inflammation in vitro, FHCs were administered 1% DSS dissolved in RPMI-1640 for 0 h (ctrl group) or 4 h (DSS group) prior to co-incubation with GO (GO and DSS+GO group), which was reported previously [59]. For the CCK-8 assay, at the end of treatment, the culture medium was removed and the cells were washed with PBS three times. Precisely 10 µL of CCK-8 working buffer was added to each well and incubated for an additional 1 h at 37 °C. The optical density of each well at 450 nm was read using a microplate reader (Molecular Device, USA). For the LDH assay, after 24 h of co-incubation with GO as indicated above, the 96-well plate was centrifuged (400 g, 5 min) and 60 µL of supernatant from each well was separately transferred to another 96-well plate following the manufacturer’s instructions. The optical density of each well was read using a microplate reader at 490 nm.
Detection of inflammatory cytokines
Colon samples were collected for the detection of inflammatory cytokines. In vitro, 500 µL FHC cells were seeded on 12-well plates at a density of 5 × 104 cells/well and incubated overnight. Then, cells were pretreated with 1% DSS for 0 h or 4 h, followed by 50 µg/mL GO treatment for another 24 h. Total RNA from colon tissues and cells were extracted using Trizol reagent (Gibco, USA) and quantified using the NanoDrop spectrophotometer (Thermo Fisher, USA). Quantitative real-time PCR (qPCR) was conducted and analyzed using LightCycler 480 (Roche, Switzerland). The inflammatory cytokine primers used are listed in Table 2.
Table 2. The primers of inflammatory cytokines used in the study.
Gene name
|
Organism
|
Primer sequence
|
GAPDH
|
Mus musculus
|
GGGTCCCAGCTTAGGTTCAT
|
TACGGCCAAATCCGTTCACA
|
IL-6
|
Mus musculus
|
TTCACAAGTCGGAGGCTTA
|
CAAGTGCATCATCGTTGTTC
|
IL-10
|
Mus musculus
|
GGAAGAGAAACCAGGGAGA
|
CCACAGTTTTCAGGGATGA
|
IL-17
|
Mus musculus
|
TTCACTTTCAGGGTCGAGA
|
GGGGTTTCTTAGGGGTCA
|
IFN-γ
|
Mus musculus
|
ACTGGCAAAAGGATGGTG
|
GTTGCTGATGGCCTGATT
|
GAPDH
|
Homo sapiens
|
CCTTCCGTGTCCCCACT
|
GCCTGCTTCACCACCTTC
|
IFN-γ
|
Homo sapiens
|
CCGCTACATCTGAATGACCTG
|
TGGCTTTTCAGCTCTGCATC
|
TNF-α
|
Homo sapiens
|
CCTCTCTCTAATCAGCCCTCTG
|
GAGGACCTGGGAGTAGATGAG
|
IL-17
|
Homo sapiens
|
GGATGTTCAGGTTGACCATCAC
|
TCCCACGAAATCCAGGATGC
|
TEM observations of GO uptake and mitochondrial structure
Exactly 1 × 106 FHC cells were cultured in 6-well plates and exposed to GO or LPS as indicated. The cells were collected via centrifuging after 24 h of incubation and fixed with 3% glutaraldehyde, post-fixed in osmium tetroxide, dehydrated in ethanol, and then polymerized using epoxy resin. GO uptake as well as the intracellular mitochondrial structure were observed via high-resolution ht7700 TEM (Hitachi, Japan).
Confocal microscopy and flow cytometry of GO uptake
According to a previously established method [60], the prepared GO suspension was mixed with FITC-BSA (FITC/BSA = 5:1, Bioss Inc., China) at a mass ratio of 1:1 and incubated overnight at 37°C in the dark. The mixture was centrifuged at 12,000 g for 30 min at 4°C and washed briefly with PBS. Then, the pellet was resuspended in the culture medium and added to FHC cultures, which were seeded on sterile coverslips inside culture dishes. Twenty-four hours later, the cells were washed with PBS and fixed with 4% paraformaldehyde, followed by 0.1% Triton X-100 permeabilization. Finally, prior to nuclear staining with DAPI, cells were incubated with rhodamine phalloidin (100 nM) for cytoskeleton staining. After washed thrice with PBS, cells were observed under an FV1000 confocal laser scanning microscope (Olympus, Japan). FV10-ASW 3.0 Viewer software was used to analyze the acquired images.
Flow cytometry was also conducted to detect the uptake of GO by FHC cells. 1 × 106 FHC cells were cultured in 6-well plates and then were exposed to FITC-BSA or FITC-BSA-GO, untreated cells served as control group. After 24 hours of treatment, cells were collected and washed by PBS for 2 times, and then these samples were analyzed by flow cytometry immediately.
Cell apoptosis assay
FHC cells were cultured in 6-well plates (1 × 106 cells per well). To assess the potential toxic responses to GO with respect to cell inflammation, FHC cells were treated with 1% DSS for 0 or 4 h to stimulate inflammation at the cellular level, followed by co-incubation with or without GO (50 µg/mL) for an additional 24 h. To test the toxic effects of GO on IECs, FHC cells were incubated in the presence or absence of either GO (0, 25, and 50 µg/mL) or LPS (10 µg/mL) for 24 h. To further explore the potential mechanism in vitro, FHC cells were treated with 100 µM MC (Selleck, USA), 400 µM NAC (MCE, USA), or 10 µM Com.C (MCE, USA) for 1 h before GO incubation (0 or 50 µg/mL). After incubation as indicated, cells were harvested and washed with PBS three times followed by centrifugation (3000 rpm, 5 min). The cell pellet was suspended in 400 µL of binding buffer to achieve a density of 1 × 106 cells/mL. The sample solution was then incubated with 5 µL Annexin V-FITC (Beyotime, China) for 15 min in the dark followed by an additional incubation with 10 µL propidium iodide (PI, Beyotime, China) for 5 min. Apoptotic cells were then detected using flow cytometry.
MMP measurement
Briefly, cells were seeded in a 12-well plate at a density of 5 × 104 cells/well and treated with GO at concentrations of 0, 25, and 50 µg/mL, and the cells treated with 10 µg/mL LPS (Sigma-Aldrich, USA) were included in the positive control group. After exposure to GO or LPS, cells were incubated with JC-1 buffer mixture solution (Beyotime, China) for 20 min at 37°C according to the manufacturer’s instructions. Fluorescence microscopy and flow cytometry (BD Biosciences, USA) were used to measure the ratio of green (JC-1 monomer)/red (JC-1 aggregates) fluorescence. The increased ration reflected the decrease of MMP.
ROS generation assay
Intracellular ROS production was measured using the DCFHDA assay kit (Beyotime, China). Specifically, to explore the effect of GO on ROS generation under conditions of DSS-induced inflammation in vitro, 1 mL of FHC cells (at a density of 5 × 104 cells/mL) was cultured in 12-well plates, incubated with 1% DSS for 0 or 4 h, and then exposed to GO treatment at 50 µg/mL. To detail the potential mechanisms, 1 mL FHC cells at density of 5 × 104 cells/mL seeded in 12-well plates were separately treated with LPS and GO (0, 25, and 50 µg/mL) with or without MC and NAC. At the end of treatment, FHC cells were harvested by centrifugation and stained with DCFHDA for 30 min in the dark at 37°C. The fluorescence intensity was analyzed using fluorescence microscopy and flow cytometry.
Western blot analysis
A total of 30 µg of protein was separated using 10% SDS-PAGE and transferred to a PVDF membrane, which was then blocked with 5% w/v BSA. Membranes were probed with the indicated primary antibodies including rabbit polyclonal antibodies against cytochrome c (Cytc), cleaved caspase-3 (c-cas3), Bcl-2, phosphorylated (p)-AMPKa (Thr172), p-PI3K, PI3K, p-AKT, AKT, p-p53, and p53 (Cell Signaling Technology, USA) along with mouse monoclonal antibodies against Bax and AMPK (Proteintech, China), and GAPDH was used to normalize protein expression. Appropriate secondary antibodies conjugated to horseradish-peroxidase (HRP) were then added and incubated for 1 h. The antigen-antibody complex was detected using an enhanced chemiluminescence reagent (Millipore, USA). The gray intensity of the bands on the western blots was analyzed using the ImageJ software (NIH, Bethesda, USA).
Statistical analysis
The experimental data were presented as the mean ± standard error of the mean (SEM). Differences among the data for the different groups were analyzed using one-way ANOVA. P-values less than 0.05 and 0.01 were considered significant, as indicated.