Senecavirus cetus a novel picornavirus isolated from cetaceans represents a major host switching to the marine environment

doi:10.21203/rs.3.rs-3900733/v1

Download PDF

Article

Senecavirus cetus a novel picornavirus isolated from cetaceans represents a major host switching to the marine environment

https://doi.org/10.21203/rs.3.rs-3900733/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Senecavirus A (SVA), an emerging virus that causes vesicular disease in swine, was, until recently, the only member of the Senecavirus genus (Picornaviridae). Here, we report the isolation and complete genome sequence of two isolates of cetacean picornavirus 1 (Senecavirus cetus), a novel picornavirus species of the Senecavirus genus from dead stranded cetaceans from Alaska. One isolate was from a harbor porpoise stranded in 2017, and another from a beluga whale, stranded in 2019. Whole-genome sequencing of Senecavirus cetus strains showed genome-wide nucleotide identity of 98.8% and a genome size of 7455 nucleotides. The Senecavirus cetus genomes are most similar to SVA with a 58.3% genome-wide pairwise nucleotide identity. Infection of eleven available cell lines from terrestrial and aquatic animals showed that beluga and sheep cells were susceptible to infection by Senecavirus cetus. Phylogenetic and ancestral state reconstruction analyses supported the novel virus being a member of the Senecavirus genus and provided the first evidence of Senecavirus-like picornavirus infecting marine mammals and likely descending from a terrestrial host ancestor. These discoveries provided important information on the evolutionary relationships and taxonomy of picornaviruses and increased our understanding of the genomic characteristics and potential host range of Senecavirus cetus.

Beluga (Delphinapterus leucas)

Cetacean

Harbor porpoise (Phocoena phocoena)

Host Switching

Picornaviridae

Senecavirus A

Virus Discovery

Virus phylogeny

Picornaviridae (Order Picornavirales) is a large, diverse family of small, non-enveloped, icosahedral RNA viruses with spherical 20–30 nm diameter nucleocapsids and a single-stranded, positive-sense RNA genome ranging between 6.7 and 10.1 kb in size¹. The highly diverse genome consists of a distinguishing characteristic long 5’ UTR with an internal ribosomal entry site (IRES) 250–450 nucleotide upstream of the translational start site, a single ORF encoding a polyprotein, a shorter 3’ UTR, and a poly-A tail. However, the genome of Dicipiiviruses (genus Dicipivirus) has two ORFs, each with its own IRES. Based on its secondary structure, most picornavirus IRES elements are currently classified into five types (I-V, IGR-IRES). Picornaviridae is constantly adding new members due to advances in next-generation sequence technology and testing of clinical and environmental samples² and is considered to include 68 genera and 158 species as of Sept. 11, 2023, date of the latest International Committee on the Taxonomy of Viruses (ICTV) master species list. Picornaviruses infect a wide range of hosts, including amphibians, reptiles, fish, birds, humans, and other mammalian species, including marine mammals. Infections are usually mild and subclinical, but more severe presentations include fever, diseases of the heart, nervous system, respiratory tract, gastrointestinal tract, liver, and vesicles on mucocutaneous tissues^2,3. Some examples of human diseases include the common cold associated with rhinovirus A, B, and C⁴, poliomyelitis caused by poliovirus⁵, and hepatitis A caused by hepatovirus⁶. Picornaviruses are also the cause of notable veterinary diseases, including foot-and-mouth disease (FMD), which causes enormous economic losses in swine and cattle industries worldwide⁷, and Senecavirus-associated vesicular disease (SAVD) of swine, which presents as clinically identical to FMD in swine, necessitating confirmatory diagnostic testing⁸.

Senecavirus A (SVA) was first isolated in the human primary embryonic retinoblastoma cell line PER.C6 as a rapidly growing tissue culture contaminant in 2002, likely from a contaminated porcine trypsin reagent. SVA is capable of in vitro growth in several cell lines, including those of porcine and non-porcine origin, i.e., porcine kidney-15 (PK-15), swine testis (ST), human primary embryonic retinoblastoma cell line (PER.C6), and a human lung cancer cell line (NCI-H1299). Purified virus sample and virus-infected PER.C6 cells revealed icosahedral particles of about 27 nm in diameter, consistent with other members of the Picornaviridae. Subsequently, more isolates were isolated, including an isolate from a buffalo (Bubalus bubalis) from China⁹, and genome sequencing confirmed it as a novel monotypic genus within the family Picornaviridae, and most closely related to the genus Cardiovirus¹⁰. Among SVA’s other notable attributes are that it is incapable of integrating into human genomic DNA during infection and its ability to selectively infect and kill human tumor cells after some genetic modification, making SVA an ideal virus for developing oncolytic virus cancer therapies¹¹.

It was not until 2007 that SVA was shown to be responsible for vesicular disease and lameness in a shipment of pigs from Manitoba, Canada¹². The vesicles were indistinguishable from those caused by FMD, swine vesicular disease (SVD), vesicular stomatitis (VS), and vesicular exanthema (VE), but when vesicle material was tested, they were only positive for SVA, confirming its ability to cause these clinical manifestations. It was also associated with new clinical presentations, such as diarrheal disease in newborn piglets and neonatal mortality, suggesting it was becoming more pathogenic¹³. From 2007 to 2015, SVA was detected sporadically in pigs in the USA and Brazil. However, after 2015, SVA spread rapidly to Asia, the UK, as well as Mexico, Colombia, and Chile in the Americas, causing severe problems in sows and finishing pigs in China, in addition to neonatal mortality¹⁴. To date, many aspects of SVA’s biology, including its origin, natural reservoirs and transmission pathways, remain unknown. However, the detection of SVA neutralizing antibody, SVA in mice small intestine, feces and genomic material in flies from unaffected farms suggest they may play a role in its epidemiology¹⁵.

Several picornaviruses have been characterized from phocids and a single cetacean. The majority of these viruses were described from metagenomic surveys, but some have been cultured, including harbor seal (Phoca vitulina) picornavirus (HsPV) and ribbon seal (Histriophoca fasciata) picornavirus (RsPV)¹⁶; ringed seal (Phoca hispida) picornavirus 1 (SePV-1)¹⁷, and Weddell seal (Leptonychotes weddellii)¹⁸. Whereas sub-Antarctic fur seal (Arctocephalus tropicalis) sakobuvirus, fur seal (Arctocephalinae spp.) picorna-like virus, South American fur seal (Arctocephalus australis) picornavirus¹⁹; harbor seal phopivirus, harbor seal Hepatovirus B²⁰; California sea lion (Zalophus californianus) sapelovirus 1 and 2²¹, Fur seal picorna-like virus from Arctocephalus gazelle²² have not been isolated in cell culture. A single report of a picornavirus having been cultured from a cetacean, the bottlenose dolphin Tursiops truncatus (bottlenose dolphin enterovirus) was previously described²³. The partial genome sequence of a picornavirus from a captive beluga, HMU-1, has also been reported²⁴. The role of marine mammal picornavirus infection in causing disease is presently unknown. SePV-1 was isolated from a nasal swab of a hunter-harvested, apparently healthy, ringed seal from arctic Canada¹⁷, while HsPV and RsPV were both isolated from dead stranded seals but what role the infection had in contributing to their death is unclear¹⁶. In this study, we report the first isolation of picornaviruses from harbor porpoise and beluga, sequenced the complete genomes, and performed phylogenetic/genetic analyses that demonstrated these cetacean picornaviruses represent a novel species.

2.1 Animals and Sample Collection

A 4–5-year-old male harbor porpoise (NMFS ID#2017026) was found dead on St Paul Island, Alaska, USA on May 11, 2017 in a moderate state of decomposition (Figs. 1–2). It was frozen and subsequently necropsied using standard techniques²⁵. Viral swab samples (rectal) were placed in viral transport media (Remel, Lenexa, KS) and frozen at -80℃. Tissue samples (adrenal, liver and spleen) were frozen in Whirl-pak bags at -80℃.

A 1.5 -2-year-old male beluga (Delphinapterus leucas) (NMFS ID #2019387) was found stranded dead, on September 2, 2019, at Campbell Creek, Turnagain Arm, Alaska (Figs. 1–2) in a mild state of autolysis and was necropsied the following day using standard techniques²⁵. Swabs and tissue samples (blowhole, rectal, genital, brain, lung, tonsil, pancreas, spleen and skin lesions) were placed in viral transport media (Remel, Lenexa, KS) and frozen at -80℃.

2.2 Virus Isolation and Transmission Electron Microscopy

Frozen tissue and swab samples from both animals were processed for virus isolation using a beluga kidney cell line (BWK) and the VeroDog.SLAMtag cell line, both of which have been successful in isolating viruses from belugas²⁶ and harbor porpoises^27,28. Flasks were incubated at 37º C and examined daily for cytopathic effects (CPE). Cells were passaged weekly (1:2) for BWK and (1:5) for VeroDog.SLAMtag for 4 weeks, at which time flasks not showing visible CPE were discarded. Media from flasks showing CPE was passed through a 0.45µm filter, diluted (1/100) and passaged onto fresh cells. After CPE was again observed, the presumed virus infected BWK flasks inoculated with the harbor porpoise liver and rectal swab presumptive isolates were processed for TEM as previously described²⁷.

2.3 Cell Line Susceptibility

Eleven cell lines derived from various species, tissues and organs were used to investigate the host range of the beluga brain isolate (Table 1). Twenty-five cm² flasks of each cell line were grown to confluence before being inoculated in duplicate with a 1/10, 1/100 or 1/1000 dilution of the virus passaged in BWK cells. After the virus was allowed to attach to the cells for one hour at 37^oC inoculum was removed and fresh media was added before being returned to the incubator. Flasks were examined microscopically daily for signs of CPE and passaged weekly for up to a month. Flasks showing CPE were frozen at minus 80^oC and subsequently tested by sequencing to confirm the presence of Senecavirus cetus .

Table 1

Animal cell lines used in this study
Cell line	Host	Tissue	Continuous or Primary (Finite)	Source	Media^*
BWK	Beluga (Delphinapterus leucas)	Kidney	Primary (Finite)	Developed in House	DMEM/F-12 + 10% FBS
BTEC	Beluga (Delphinapterus leucas)	Tracheal epithelium	Continuous	Developed in House	DMEM/F-12 + 4% FBS
OA3.Ts	Ovine (Ovis aries)	Testes	Continuous	ATCC CRL-6546	DMEM + 10% FBS
OA4.K/S1	Ovine (Ovis aries)	Kidney	Continuous	ATCC CRL-6549	DMEM + 10% FBS
Vero.DogSLAMtag	African green monkey (Chlorocebus sabaeus)	Kidney	Continuous	Dr. Yasuke Yanagi, Department of Virology, Kyushu University, Fukuoka, Japan	DMEM/F-12 + 4% FBS
RSM	Ringed seal (Pusa hispida)	Macrophage	Continuous	Developed in House	DMEM/F-12 + 4% FBS
RSPK	Ringed seal (Pusa hispida)	Kidney	Primary (Finite)	Developed in House	DMEM/F-12 + 10% FBS
CRFK	Domestic cat (Felis catus)	Kidney	Continuous	ATCC CCL-94	DMEM/F-12 + 4% FBS
PK-15	Swine (Sus scrofa)	Kidney	Continuous	ATCC CCL-33	AMEM + 5% Horse Serum
ST	Swine (Sus scrofa)	Testes	Continuous	ATCC CRL-1746	AMEM + 5% FBS
MDBK	Bovine (Bos taurus)	Kidney	Continuous	ATCC CCL-22	MEM + 5% Horse Serum
^*Media formulation abbreviation: AMEM - Alpha Modification of Eagle's Media; MEM - Minimal Essential Medium; DMEM/F-12 - Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12.

2.4 Genome Sequencing

2.4.1 Whole genome sequencing

Infected 75 cm² flasks of BWK displaying extensive CPE from the beluga and harbor porpoise isolates were frozen and submitted to the National Centre for Foreign Animal Disease (NCFAD), Canadian Food Inspection Agency, Winnipeg, MB, Canada.

Nucleic acid extraction was performed using a combination of the Direct-zol™ RNA Miniprep Plus Kit and Quick-DNA/RNA™ Viral Kit (Zymo Research, Irvine, CA), including an on-column DNase I treatment according to the manufacturer’s instructions. First-strand cDNA synthesis was done using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, Waltham, MA) with the inclusion of Endoh pseudorandom hexamers²⁹, while second-strand synthesis was done using the NEBNext® Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions.

High-throughput sequencing was conducted using a combination of short and long-read sequencing technologies. For short-read sequencing, library preparation and enrichment were done following the ViroCap pan-vertebrate viral targeted enrichment method as previously described^30–32 following the Nimblegen SeqCap EZ HyperCap Workflow User’s Guide (Roche, Basel, Switzerland). The resulting library was sequenced on an Illumina MiSeq using a V3 flow cell and 600-cycle kit (Illumina, San Diego, CA). For long-read sequencing, library preparation was done using the Rapid PCR Barcoding Kit – SQK-RPB004 (Oxford Nanopore Technologies, Oxford, United Kingdom) according to the manufacturer’s instructions, and the resulting library was sequenced on an Oxford Nanopore Technologies GridION using a SpotON Flow Cell – FLO-MIN106D (Oxford Nanopore Technologies, Oxford, United Kingdom).

Rapid amplification of cDNA ends (RACE) was used to capture the 5’ and 3’ ends of the genomes with the SMARTer® RACE 5’/3’Kit following the manufacturer’s protocol (Takara Bio, Mountain View, CA). Genome specific primers were designed approximately 1.5kb from the assembled ends of the coding region using Primer3 (v0.4.0)³³. The RACE primer sequences and characteristics are listed in Table 2. The amplified 5’ and 3’ RACE products were sequenced using the Native Barcoding sequencing kit - SQK-NBD114.96 (Oxford Nanopore Technologies, Oxford, United Kingdom) according to the manufacturer’s instructions and sequenced as described above using a SpotON Flow Cell – FLO-MIN114.

Table 2

5’/3’ RACE Primer Information
Primer name	Sequence	Tm (℃)	Product Size
CPV1_5’_RACE	CGCGGTTGTGTGGGAATAGGGCTG	68	2.1kb
CPV1_3’_RACE	CTTCCCCTCCGCAACAGCCCCATC	69	1.7kb

2.4.2 Confirmatory sequencing of infected cell lines

Presence of Senecavirus cetus in the infected cell lines displaying CPE from the susceptibility testing was confirmed using long-read high-throughput sequencing. Nucleic acid extraction and cDNA synthesis were performed following the same procedures as described above. Library preparation was performed using the Native Barcoding Kit - SQK-NBD114.96 (Oxford Nanopore Technologies, Oxford, United Kingdom) according to the manufacturer’s instructions. The final resulting libraries were sequenced on an Oxford Nanopore Technologies PromethION 24 sequencing platform using a PromethION FLO-PRO114M flow cell. Adaptive sampling strategy was used to deplete off-target reads during sequencing runs; reference genomes of domestic sheep (Ovis aries; RefSeq: GCF_016772045.2) and beluga whale (Delphinapterus leucas; RefSeq: GCF_002288925.2) were used as references for host depletion.

2.5 Phylogenetic and Genetic Analyses

2.5.1 Raw data processing and genome organization

Raw Illumina sequence data was initially processed utilizing an in-house developed, automated classification pipeline; nf-villumina (v2.0.1)³⁴ as previously described^30,35. Raw Nanopore sequencing data was first basecalled using Guppy (v6.4.6) and super-accurate basecalling with a minimum q score cutoff of 10. 5’/3’ RACE Kit 14 Nanopore data was further processed with Duplex Tools (v0.3.2)³⁶ to identify duplex read candidates prior to re-basecalling with Guppy (v6.4.6). Following, the basecalled data was subject to adapter trimming using Porechop (v0.2.4)³⁷ and read length filtering with chopper (v0.5.0)³⁸ before consensus sequence generation using an in-house developed pipeline, nf-virontus (v1.0.1)³⁹. Assembled contigs from both Illumina and Nanopore were further processed and analyzed in Geneious Prime (v2023.2.1) for both iterative mapping on medium-low sensitivity and 5 iterations and sequence alignment using MAFFT (v7.309)⁴⁰. The resulting 5’/3’ RACE contigs and CPV1 contigs were checked for sequence overlap and the final consensus was manually edited to generate the full length genome. A combination of ORF finder, Protein BLAST and MAFFT alignments were used to annotate the CPV1 genome. Total depth of coverage (Fig. 4A) was calculated by mapping both Illumina and Nanopore sequencing data against the complete CPV1 genome in Geneious Prime (v2023.2.1).

2.5.2 Pairwise identity analysis

Pairwise identity calculations for select members from the subfamily Caphthovirinae was done using the Sequence Demarcation Tool Version 1.2 (SDTv1.2)⁴¹. ORF1 nucleotide and amino acid sequences were aligned using the default MAFFT settings in SDTv1.2 while not selecting the “Cluster sequences using a neighbor joining tree” option. A custom scale range of 29–100% pairwise identity was specified.

2.5.3 Phylogenetic analysis

The phylogenetic position of the novel cetacean picornavirus was assessed using the whole genomes and the P1 and 3Dpol gene sequences, two genomic regions conventionally used in the classification and phylogenetics of Picornaviridae. To construct the whole genome phylogenetic dataset, we used full genome data of all recognized genera of the family Picornaviridae (as of March 2023) and supplemented that data with available sequences of unclassified picornaviruses isolated from marine mammals (accessed on March 05, 2023). To assess the phylogenetic placement of the novel cetacean picornavirus relative to the closest species identified by the BLAST search, SVA, we included a total of ten SVA full genome sequences representing virus isolates from various geographical locations as well as the partial genome of a recently described novel picornavirus member of the Senecavirus genus isolated from pangolin. The final phylogenetic data set included 180 sequences. A more refined analysis was performed using the P1 and 3Dpol nucleotide sequences for all recognized genera within the subfamily Caphthovirinae, including SVA and the novel cetacean picornavirus. Details of the sequence records downloaded from GenBank and used in the study are provided in Supplementary Table 1. Multiple sequence alignment was performed using ClustalW⁴² v.1.8 implemented in BioEdit v.7.2.5^43,44 under the default settings.

Phylogenetic analysis was performed using maximum likelihood implemented in IQ-Tree web server 1.6.12^45,46. The best-fit model of sequence evolution was selected based on the Bayesian information criterion (BIC) score⁴⁷ calculated by ModelFinder⁴⁸, which recovered GTR + F + I + G4 as the best-fit model for both P1 and 3Dpol data sets. Maximum likelihood analyses were performed under the default settings with all model parameters estimated by the program. Node support was estimated by ultrafast bootstrap⁴⁹ and the SH-aLRT test⁵⁰ with 1,000 replicates each.

2.5.4 Recombination analysis

Genome recombination has been reported in a wide range of picornaviruses. To assess potential genome recombination in Senecavirus cetus, we performed a series of recombination analyses using the RDP5 v.5.30 software⁵¹ under the default settings and with the p-value cut-off set to 0.01. Five recombination detection methods (RDP, GENECONV, 3Seq, MaxChi, Chimaera) were used for the initial identification of putative recombination events in the whole genome sequence alignment. The identified recombination events were then checked with BootScan. Recombination events that were detected by all methods were selected as plausible.

2.5.5 Ancestral state reconstruction

The ancestral state reconstruction analysis was performed for the host habitat type to evaluate the most likely routes of evolutionary transitions between aquatic and terrestrial hosts. Character mapping and state reconstruction were performed in R using phytools⁵² v.1.9–16. Character history was inferred by stochastic character mapping with 1000 replicates and sampling character histories from their posterior probability distribution for the IQ-TREE phylogenetic tree including all recognized species within the Picornaviridae.

3.1 Pathology

Beluga Whale 2019387– Grossly, this male, subadult beluga had punctuate skin ulcers on the head and body, focal ulcerative and proliferative skin lesions, (Fig. 2A, B) signs of possible blunt trauma to the right side body and head, an incompletely healed umbilicus, pulmonary lymphadenopathy, and pancreatitis.

Histopathology revealed moderate, chronic lymphoplasmacytic and eosinophilic dermatitis with some lesions having intranuclear viral inclusion bodies suggestive of herpesvirus. There was also chronic, moderate to severe lymphohistiocytic multifocal pleuropneumonia – likely related to lungworms. The tonsil was reactive, and the thymus had acute mild multifocal random suppurative thymitis with lymphocytolysis and mild thymic atrophy. There was lymphocytolysis in the hilar lymph node, mild, multifocal degenerative myopathy, serous atrophy of fat, severe chronic ductal pancreatitis with intralesional trematode eggs and mild eosinophilic (parasite-related) enteritis. The immediate cause of death was determined to be blunt trauma or possible live stranding with chronic pleuropneumonia, poor body condition, dermatitis and parasitism as contributing factors.

Ancillary diagnostics revealed the lung to be positive for Erysipelothrix rhusiopathiae (large numbers), Streptococcus dysgalactiae and Vibrio sp. (very small numbers) by culture and negative for morbillivirus and influenza virus by PCR. Heart and spleen were positive for Erysipelothrix spp. bacteria by PCR suggesting this animal was also septic for Erysipelothrix sp. Skin lesions were negative for poxvirus and positive for beluga alphaherpesvirus²⁶ (Fig. 2) by PCR and sequencing.

Harbor Porpoise 2017026—Grossly this male, subadult harbor porpoise had trauma to the head including a missing tongue and lower jaw most consistent with killer whale predation (Fig. 2C, D). There was also poor body condition, severe pulmonary edema, bronchopneumonia due to nematodes and bacteria, chronic cholangiohepatitis and pancreatitis due to heavy trematode infection and gastritis due to heavy nematode infection. The cause of death was determined to be predation of an animal in poor condition with pre-existing disease.

3.2 Virus Isolation and Transmission Electron Microscopy

Harbor porpoise rectal swabs and liver samples inoculated onto BWK cells showed the development of granular CPE after five- and six-days post-infection (DPI), respectively. The beluga brain sample developed a similar CPE after 26 DPI. In all cases, CPE developed very quickly, with the cell monolayer being completely destroyed after an additional 48 hours of incubation. None of the VeroDog.SLAMtag-infected flasks showed any signs of CPE after four weeks of incubation.

In ultrathin sections of BWK cells infected with liver isolate dense cytoplasmic clusters of viral particles were observed (Fig. 3A). They consisted of individual non-enveloped virions ~ 25 nm in diameter (Fig. 3B). Usually these areas contained multiple vesicles 130–270 nm in diameter typical for picornavirus replication sites. In BWK cells infected with rectal swab isolate virus particles were dispersed in cytosol of completely lysed cells (Fig. 3C,D).

3.3 Cell Line Susceptibility

CPE developed in all the infected flasks of the BWK cell line after 48 hours and the BTEC cell line after 9 DPI. Both cell lines originated from beluga. The two cell lines derived from sheep (OA3.Ts and OA4.K/S1) also showed CPE after 9 DPI. None of the other cell lines tested showed visible signs of CPE after growth and passage for one month (Table 3).

Table 3

Animal cell line susceptibility results. Results marked as “cpe” (cytopathic effect) indicate complete destruction of the cell sheet at the indicated time point (DPI - days post infection); results marked as negative indicate no visible signs of cytopathic effect at the end time point of the testing.
	Dilution
	1/10	1/100	1/1000	Uninfected Control
BWK	cpe 48 hours	cpe 48 hours	cpe 48 hours	negative
BTEC	cpe 9 DPI	cpe 9 DPI	cpe 9 DPI	negative
OA3.Ts	cpe 9 DPI	cpe 9 DPI	cpe 9 DPI	negative
OA4.K/S1	cpe 9 DPI	cpe 9 DPI	cpe 9 DPI	negative
Vero.DogSLAMtag	negative	negative	negative	negative
RSM	negative	negative	negative	negative
RSPK	negative	negative	negative	negative
CRFK	negative	negative	negative	negative
PK-15	negative	negative	negative	negative
ST	negative	negative	negative	negative
MDBK	negative	negative	negative	negative

3.3 Genome Sequencing

3.3.1 Whole genome sequencing

The whole genome of the Senecavirus cetus (CPV1, beluga brain) isolated from the brain of a stranded dead beluga (Delphinapterus leucas) from Alaska, USA, in 2019 was 7455 nt in length. The genome organization of CPV1 and the depth of coverage is shown in Fig. 4. A total of 1.79 million reads mapped across the CPV1 genome with a mean depth of coverage of 167,903x. CPV1’s genome has a 697 nt 5’UTR, followed by a 6642 nt that encodes a 2214 aa polyprotein and a 116 nt 3’UTR. The polyprotein has a typical 4-3-4 arrangement that codes for the structural proteins followed by non-structural proteins. Comparative genomic analysis of the complete coding genome for CPV1 found that conserved motifs present within members of the Picornaviridae family were present, including the Walker A motif (GxxGxGKS/T), 3C proteinase motif (GxCGx10-15GxH) and 3D polymerase motifs (KDE, DxxxxD, PSG, YGDD, FLKR).

BLAST analysis of the CPV1 sequence shows Seneca Valley virus (species Senecavirus A, SVA isolate USA/MI16-038766/2016 polyprotein gene, accession MN812958.1) as the top match. CPV1 and the SVA top match showed an ORF1 pairwise nucleotide identity of 58.29% and an ORF1 amino acid identity of 51.32% (Table 4). Additionally, the genomes shared approximately 40.5% and 44.5% nucleotide identity for the 3Dpol and P1 protein coding regions, respectively. The nucleotide and amino acid identity, and phylogenetic analysis (Figs. 5–6), suggest CPV1 should be classified as a new member within the Senecavirus genus.

Table 4

Comparison of *Senecavirus cetus* (beluga brain) polyprotein coding region to closest BLAST matches
Species name	GenBank accession	Percent Identity
Species name	GenBank accession	Nucleotide	Amino Acid
Senecavirus cetus	OR416239	-	-
Senecavirus A	MN812958	58.3	51.8
Pangolin senecavirus	OL519620	53.7	49.7

Two isolates very similar to the novel CPV1 were also isolated and sequenced from a stranded dead harbor porpoise (Phocoena phocoena) (Table 5). The CPV1 (porpoise rectal) isolate showed an ORF1 pairwise nucleotide identity of 100% and an ORF1 amino acid identity of 100% to CPV1 (beluga brain). In comparison, the CPV1 (porpoise liver) isolate showed an ORF1 pairwise nucleotide identity of 98.8% and an ORF1 amino acid identity of 99.0% to CPV1 (beluga brain) (Fig. 4).

Table 5

Summary of the three *Senecavirus cetus* isolates described in this study
Species name/acronym	Isolate ID	Country of Isolate	Host/isolation source	GenBank accession
Senecavirus cetus/CPV1	Alaska / 2019	USA	Delphinapterus leucas (Beluga whale) / Brain	OR416239
	Alaska / 2017	USA	Phocoena phocoena (harbor porpoise)/Liver	OR416237
	Alaska / 2017	USA	Phocoena phocoena (harbor porpoise)/Rectum	OR416238

3.3.2 Confirmatory sequencing of infected cell lines

Sequencing of the infected cell lines confirmed the presence of Senecavirus cetus in the cell cultures showing CPE. Quality-checked and filtered reads obtained from the confirmatory sequencing were assembled to the reference genomes of the original Senecavirus cetus isolates using nf-virontus v.1.1.0³⁹. Assembled genomes showed 100% nucleotide identity to the beluga brain (OR416239) and harbor porpoise rectal (OR416238) isolates.

3.4 Phylogenetic and Genetic Analyses

Phylogenetic analyses recovered Senecavirus cetus isolates forming a well-supported monophyletic group placed as a sister to a clade comprising a monophyletic SVA and a recently described member of the Senecavirus genus isolated from pangolin. This placement was consistent across the results of the whole genome, P1, and 3Dpol data set analyses (Figs. 6; Supplemental Fig. 1). Mischivirus and Cardiovirus were the two most closely related picornavirus lineages to the clade comprising SVA and Senecavirus cetus. Overall, picornaviruses isolated from marine mammals show broad phylogenetic distribution (Fig. 7; Supplemental Fig. 1) across multiple picornavirus subfamilies. Recombination analysis of the whole genome data set (n = 180 taxa) showed no evidence of recombination events in the genome of Senecavirus cetus and in neither of the other picornaviruses isolated from the aquatic hosts (Table 6). The ancestral state reconstruction suggested a terrestrial host habitat as the most likely state at the root of the Picornaviridae tree (Fig. 7). The inferred terrestrial origin of picornaviruses could, in part, be due to the fact that the majority of the diversity of this group of viruses has been described from terrestrial mammals representing a sampling bias. The most likely origin of the picornaviruses isolated from aquatic mammals was attributed to terrestrial mammals in nearly all cases, including the novel Senecavirus cetus reported herein. Additionally, a transition from an avian host to an aquatic mammal was identified in the case of Penguin megrivirus isolated from a Weddell seal¹⁸.

Table 6

Picornaviruses isolated and/or directly sequenced from aquatic and semi-aquatic mammal hosts.
Virus	Genus	Hosts	Isolate or direct sequencing	Reference
Senecavirus cetus	Senecavirus	beluga whale (Delphinapterus leucas), harbor porpoise (Phocoena phocoena)	isolate	This study
Phopivirus	Hepatovirus	harbor seal (Phoca vitulina)	sequencing	²⁰
Fur seal picorna-like virus	unclassified	Antarctic fur seal (Arctocephalus gazella)	not specified	na (direct submission; KY926885.1)
Seal picornavirus type 1	Aquamavirus	Ringed seal (Pusa hispida)	isolate	¹⁷
Penguin megrivirus	Megrivirus	Weddell seal (Leptonychotes weddellii)	not specified	na (direct submission; MN453782.1)
Picornavirus HMU-1	unclassified	beluga whale (Delphinapterus leucas)	sequenced	²⁴
Bottlenose dolphin enterovirus	Enterovirus	bottlenose dolphin (Tursiops truncatus)	isolate	²³
California sea lion sapelovirus 1	Sapelovirus	California sea lion (Zalophus californianus)	sequenced	²¹
California sea lion sapelovirus 2	Sapelovirus	California sea lion (Zalophus californianus)	sequenced	²¹

This paper describes the isolation and genomic sequences of two strains of a novel cetacean picornavirus, Senecavirus cetus. The two strains were isolated from a stranded dead beluga and a harbor porpoise in Alaska, USA, but two years and 1000 km apart. The genomic sequences of the two strains share 98.8% pairwise nucleotide identity and show the highest nucleotide identity (~ 53%) with SVA. SVA is an emerging swine virus that has been spreading and causing vesicular disease in pig populations in North America since its first detection in the 1980s and is now reported in the Americas, Asia, and the UK. Therefore, discovering a new Senecavirus species in marine mammals from Alaska highlights potential risks for animal health and food security in the region. Specifically, both beluga whales and harbor porpoise are preyed on by other marine predators such as orcas⁵³, seals⁵⁴, and sharks⁵⁵, as well as by polar bears, a keystone Arctic species known to hunt and scavenge belugas^56–58. Additionally, cetaceans, including belugas and porpoises, serve as an important food source for indigenous people^59,60. The potential risks and impacts of the novel virus described in the present study remain to be investigated, but this work provides initial insight that may begin to address these concerns. Interestingly, the beluga had vesicular lesions throughout the carcass, resembling those caused by SVA in pigs. In addition to being found in pigs and the cetaceans reported in this study, a partial genome of a Seneca-like virus was recovered from a metagenomics study of the lung tissue of pangolins, family Manidae of the order Pholidota⁶¹ indicating that Seneca-like viruses may have a broader host range among terrestrial species.

The factors contributing to the emergence and evolution of the novel cetacean picornavirus are unknown. However, geographical, ecological and other factors can contribute to spill-over events and drive virus evolution. Recombination and mutations are driving factors for the great diversity of picornaviruses. RNA recombination is observed in all studied picornavirus genera². Phylogenetic analysis using the P1 and 3Dpol genomic regions shows Senecavirus cetus clusters with Senecavirus A. Mishivirus, with bats as natural hosts, and Cardiovirus, found in humans, were the two most closely related lineages to the clade comprising SVA and Senecavirus cetus. Overall, picornaviruses isolated from marine mammals show broad phylogenetic distribution, suggesting independent introductions and evolution in marine mammals. The ancestral state reconstruction shown here, indicated that the origin of the picornaviruses in aquatic mammals traces back to terrestrial ancestors and, in a single case, to an avian host (Fig. 7). The latter is most likely to be the case of horizontal transmission between host species as Weddell seals share habitat and feed on penguins in Antarctica^62,63. Among the terrestrial to aquatic host transition cases, diverse phylogenetic patterns were observed where aquatic picornaviruses were inferred to descend from and be closely related to picornaviruses isolated from hosts across multiple deeply divergent lineages of mammals. Phopivirus, a distinct picornavirus species isolated from harbor seals, was inferred to share the most recent common ancestry with picornaviruses of small insectivore mammals such as hedgehogs and shrews. Together with other closely related Hepatovirus species of bats and rodents, these viruses form a group that includes human hepatitis A virus. Another picornavirus species isolated from harbor and ribbon seals is co-generic and most closely related to the bear picornavirus described from an Asian black bear⁶⁴. Similarly, aquatic picornaviruses from the subfamily Ensavirinae were found to be closely related to picornaviruses from phylogenetically diverse mammal hosts. PicoV-HMU-1 is a novel picornavirus discovered recently through metagenomics sequencing of swabs from captive belugas in an Ocean Park in China²⁴. The PicoV-HMU-1 genome is most closely related to an unclassified bat picornavirus. Such a remarkably broad host range across diverse lineages of animals could indicate that the origin of the currently known picornaviruses predates the radiation of vertebrates. This is consistent with the previously proposed idea of the ancient origin of picorna-like viruses that predates the radiation of eukaryotes⁶⁵ and an even earlier origin of their replication apparatus tracing back to the pre-cellular world⁶⁶. However, tracing the origin of picornaviruses in aquatic hosts is greatly complicated by the sampling challenges associated with this type of habitat. This could also be a potential reason why no recombination events were detected in genomes of picornaviruses isolated from marine hosts, since recombination detection approaches rely on the presence of the recombination donors (or closely related sequences) in a data set for recombination events to be identified.

To date, picornaviruses have been reported in five of seven vertebrate classes. However, genetic factors that influence the host range and pathogenicity for fish, avian, mammalian, and other picornaviruses are poorly understood. Due to the lack of data, the evolutionary history of aquatic mammalian picornaviruses will benefit from further knowledge of unsampled viral diversity. The genome sequences reported here will allow the development of diagnostic tests that will facilitate the investigation of archived, surveillance, and opportunistic samples and provide insight into the prevalence of picornaviruses in the host populations and the environment that can further shed light on the evolutionary mechanisms of picornaviruses. Many picornaviruses have been identified in the stools of animals and are known to be environmentally stable, suggesting this may be a plausible mechanism for cross-species spread. Likely scenarios for host switching include: 1) between sympatric species that inhabit terrestrial and marine environments; 2) marine species that come in contact with and thus become infected through fecal contamination of environmental sources; 3) carnivores or scavengers infected through the diet after consuming infected animals. A prominent example of host switching in another family of the Picornavirales (Caliciviridae) is the transmission of San Miguel Sea Lion (vesicular exanthema) virus to domestic pigs that were fed sea lion meat at farms in the US⁶⁷. In swine hosts, the virus caused swine vesicular disease clinically similar to the Foot-and-Mouth disease caused by a picornavirus within the Aphthovirus genus of Picornaviridae. Cell line susceptibility studies revealed that only ones derived from beluga (BWK and BTEC) and sheep (OA3.Ts and OA4.K/S1) were susceptible to infection by Senecavirus cetus. In contrast, SVA causes CPE in a variety of mammalian and livestock cell lines, including the swine cell lines ST and PK-15 and the bovine cell line MDBK⁶⁸, but these cell lines were unable to support the growth of the Senecavirus cetus. These results may indicate a further adaptation to the marine environment.

Unlike PicoV-HMU-1 and other picornaviruses with only sequences available, we report the first Senecavirus cetus isolates. The virus isolates can facilitate biochemical and molecular investigations into the functional analysis of transcription and translational regulatory sites, encoded proteins, precise poly-protein processing sites, host-virus interactions, host range, and zoonotic potential of Senecavirus cetus.

Acknowledgements

The authors acknowledge the Marine Mammal Health and Stranding Program (MMHSP) permit 18786 and funding from Prescott grant numbers NA15NMF4390053 and NA19NMF4390158 (to KBH) used to support the stranding effort and the Tribal Government of St. Paul Island for the harbor porpoise; funding from the Canadian Safety and Security Program project CSSP-2018-TA-2362, CFIA project 2721, Genomics and Bioinformatics Initiative GenARCC project, and Laboratories Canada project “Enhancing the throughput for genomics of known, emerging, and unknown viruses in wild and cultured terrestrial and aquatic animals: infectious disease surveillance, outbreak investigations and applications to support a one health approach” (to OL). The authors would like to acknowledge CFIA NCFAD’s Reagent Development Unit (Mariko Moniwa and team) for providing some of the mammalian cell lines and also Dr. Shawn Babiuk, Michelle Nebroski, Joe Rudar, Peter Kruczkiewicz, and Hai Nguyen for reviewing and providing feedback on the manuscript.

Author contributions

OL and ON conceived, designed the study and drafted the paper with contributions and editing by all authors; NR and KBH collected the specimens and conducted the pathology investigation; ON conducted the virus isolation and cell line susceptibility tests; VLP collected the EM data and analysis; DS and OV collected genomic data and performed the bioinformatics analysis.

Competing interests

The authors have no competing interests.

Knipe, D. M. & Howley, P. Fields Virology. (Wolters Kluwer Health. Lippincott Williams and Wilkins, Philadelphia, USA, 2013).
Zell, R. Picornaviridae—the ever-growing virus family. Arch. Virol. 163, 299–317 (2018).
Zell, R. et al. ICTV Virus Taxonomy Profile: Picornaviridae. J. Gen. Virol. 98, 2421–2422 (2017).
Jacobs, S. E., Lamson, D. M., St. George, K. & Walsh, T. J. Human Rhinoviruses. Clin. Microbiol. Rev. 26, 135–162 (2013).
Minor, P. D. Polio eradication, cessation of vaccination and re-emergence of disease. Nat. Rev. Microbiol. 2, 473–482 (2004).
Cuthbert, J. A. Hepatitis A: Old and New. Clin. Microbiol. Rev. 14, 38–58 (2001).
Jamal, S. M. & Belsham, G. J. Foot-and-mouth disease: past, present and future. Vet. Res. 44, 116 (2013).
Maggioli, M. F. et al. Persistent Infection and Transmission of Senecavirus A from Carrier Sows to Contact Piglets. J. Virol. 93, e00819-19 (2019).
Zhou, X. et al. Buffalo-Origin Seneca Valley Virus in China: First Report, Isolation, Genome Characterization, and Evolution Analysis. Front. Vet. Sci. 8, (2021).
Hales, L. M. et al. Complete genome sequence analysis of Seneca Valley virus-001, a novel oncolytic picornavirus. J. Gen. Virol. 89, 1265–1275 (2008).
Luo, D. et al. Senecavirus A as an Oncolytic Virus: Prospects, Challenges and Development Directions. Front. Oncol. 12, (2022).
Pasma, T., Davidson, S. & Shaw, S. L. Idiopathic vesicular disease in swine in Manitoba. Can. Vet. J. 49, 84 (2008).
Segalés, J., Barcellos, D., Alfieri, A., Burrough, E. & Marthaler, D. Senecavirus A: An Emerging Pathogen Causing Vesicular Disease and Mortality in Pigs? Vet. Pathol. 54, 11–21 (2017).
Liu, F., Wang, Q., Huang, Y., Wang, N. & Shan, H. A 5-year review of Senecavirus A in China since its emergence in 2015. Front. Vet. Sci. 7, 567792 (2020).
Joshi, L. R. et al. Detection of the Emerging Picornavirus Senecavirus A in Pigs, Mice, and Houseflies. J. Clin. Microbiol. 54, 1536–1545 (2016).
Rodrigues, T. C. et al. Genomic characterization of picornaviruses isolated from ribbon (Histriophoca fasciata) and harbor (Phoca vitulina) seals. Front. Vet. Sci. 7, 554716 (2020).
Kapoor, A. et al. A Highly Divergent Picornavirus in a Marine Mammal. J. Virol. 82, 311–320 (2008).
Aasdev, A. et al. Three complete genome sequences of Penguin megrivirus from ornithogenic soil, Adelie penguin and Weddell seal of Antarctica. bioRxiv 858043 (2019).
Kluge, M. et al. Metagenomic survey of viral diversity obtained from feces of Subantarctic and South American fur seals. PLoS One 11, e0151921 (2016).
Anthony, S. J. et al. Discovery of a Novel Hepatovirus ( Phopivirus of Seals) Related to Human Hepatitis A Virus. mBio 6, e01180-15 (2015).
Li, L. et al. The Fecal Viral Flora of California Sea Lions. J. Virol. 85, 9909–9917 (2011).
Krumbholz, A., Groth, M., Esefeld, J., Peter, H.-U. & Zell, R. Genome Sequence of a Novel Picorna-Like RNA Virus from Feces of the Antarctic Fur Seal ( Arctocephalus gazella ). Genome Announc. 5, e01001-17 (2017).
Nollens, H. H. et al. New recognition of Enterovirus infections in bottlenose dolphins (Tursiops truncatus). Vet. Microbiol. 139, 170–175 (2009).
Wang, G. et al. Identification and genome analysis of a novel picornavirus from captive belugas (Delphinapterus leucas) in China. Sci. Rep. 11, 21018 (2021).
Geraci, J. R. & Lounsbury, V. J. Marine Mammals Ashore: A Field Guide for Strandings. (National Aquarium in Baltimore, 2005).
Nielsen, O., Burek-Huntington, K. A., Loseto, L. L., Morell, M. & Romero, C. H. Alphaherpesvirus: Isolation, Identification, Partial Characterisation, Associated Pathologic Findings and Epidemiology in Beluga Whales (Delphinapterus leucas) in Alaska and Arctic Canada. Arct. Sci. AS-2017-0043 (2017) doi:10.1139/AS-2017-0043.
Emelianchik, A. et al. Characterization of a novel rhabdovirus isolated from a stranded harbour porpoise (Phocoena phocoena). Virus Res. 273, 197742 (2019).
Rodrigues, T. C. et al. Characterization of an alphavirus isolated from a stranded harbor porpoise (Phocoena phocoena) from Alaska. Virus Res. 291, 198187 (2021).
Endoh, D. et al. Species-independent detection of RNA virus by representational difference analysis using non-ribosomal hexanucleotides for reverse transcription. Nucleic Acids Res. 33, e65–e65 (2005).
Fisher, M. et al. Discovery and comparative genomic analysis of elk circovirus (ElkCV), a novel circovirus species and the first reported from a cervid host. Sci. Rep. 10, 19548 (2020).
Wylie, T. N., Wylie, K. M., Herter, B. N. & Storch, G. A. Enhanced virome sequencing using targeted sequence capture. Genome Res. 25, 1910–1920 (2015).
Papineau, A. et al. Genome Organization of Canada Goose Coronavirus, A Novel Species Identified in a Mass Die-off of Canada Geese. Sci. Rep. 9, 5954 (2019).
Untergasser, A. et al. Primer3—new capabilities and interfaces. Nucleic Acids Res. 40, e115–e115 (2012).
Kruczkiewicz, P. peterk87/nf-villumina. https://github.com/peterk87/nf-villumina (2020).
Fisher, M. et al. Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete Mutorquevirus genome. Sci. Rep. 13, 3703 (2023).
Duplex Tools. Oxford Nanopore Technologies (2023).
Wick, R. rrwick/Porechop. https://github.com/rrwick/Porechop (2020).
De Coster, W. & Rademakers, R. NanoPack2: population-scale evaluation of long-read sequencing data. Bioinformatics 39, btad311 (2023).
Kruczkiewicz, P. peterk87/nf-virontus. https://github.com/peterk87/nf-virontus (2020).
Katoh, K. & Standley, D. M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772–780 (2013).
Muhire, B. M., Varsani, A. & Martin, D. P. SDT: a virus classification tool based on pairwise sequence alignment and identity calculation. PloS One 9, e108277 (2014).
Thompson, J. D., Higgins, D. G. & Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680 (1994).
Hall, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98 (1999).
Hall, T., Hall, T. & Alzohairy, D. A. M. BioEdit: An important software for molecular biology. GERF Bull Biosci 2, (2011).
Nguyen, L.-T., Schmidt, H. A., Von Haeseler, A. & Minh, B. Q. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32, 268–274 (2015).
Trifinopoulos, J., Nguyen, L.-T., von Haeseler, A. & Minh, B. Q. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 44, W232–W235 (2016).
Schwarz, G. Estimating the dimension of a model. Ann. Stat. 461–464 (1978).
Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K., Von Haeseler, A. & Jermiin, L. S. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods 14, 587–589 (2017).
Hoang, D. T., Chernomor, O., von Haeseler, A., Minh, B. Q. & Vinh, L. S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 35, 518–522 (2018).
Guindon, S. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321 (2010).
Martin, D. P. et al. RDP5: a computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 7, veaa087 (2021).
Revell, L. J. phytools: an R package for phylogenetic comparative biology (and other things). Methods Ecol. Evol. 217–223 (2012).
Cosentino, A. M. First record of Norwegian killer whales attacking and feeding on a harbour porpoise. Mar. Biodivers. Rec. 8, e108 (2015).
Stringell, T. et al. Predation of harbour porpoises (Phocoena phocoena) by grey seals (Halichoerus grypus) in Wales. Aquat. Mamm. 41, 188 (2015).
Turnbull, S. D. & Dion, D. White shark (Carcharodon carcharias) attack on a harbor porpoise (Phocaena phocaena) in the Bay of Fundy, Canada. Northeast. Nat. 19, 705–707 (2012).
Rugh, D. J. & Shelden, K. E. Polar bears, Ursus maritimus, feeding on beluga whales, Delphinapterus leucas. Can. Field Nat. 107, 235–237 (1993).
Laidre, K. L., Stirling, I., Estes, J. A., Kochnev, A. & Roberts, J. Historical and potential future importance of large whales as food for polar bears. Front. Ecol. Environ. 16, 515–524 (2018).
Smith, T. G. & Sjare, B. Predation of belugas and narwhals by polar bears in nearshore areas of the Canadian High Arctic. Arctic 43, 99–102 (1990).
Harwood, L. A., Norton, P., Day, B. & Hall, P. A. The harvest of beluga whales in Canada’s Western Arctic: Hunter-based monitoring of the size and composition of the catch. Arctic 10–20 (2002).
Waugh, D. et al. Inuvialuit traditional ecological knowledge of beluga whale (Delphinapterus leucas) under changing climatic conditions in Tuktoyaktuk, NT. Arct. Sci. 4, 242–258 (2018).
Ning, S. et al. Novel putative pathogenic viruses identified in pangolins by mining metagenomic data. J. Med. Virol. 94, 2500–2509 (2022).
Lee, W. Y., Jung, J.-W., Chung, H. & Kim, J.-H. Weddell seal feeds on Adélie Penguins in the Ross Sea, Antarctica. Polar Biol. 42, 1621–1624 (2019).
Casaux, R., Carlini, A., Corbalán, A., Bertolin, L. & DiPrinzio, C. The diet of the Weddell seal Leptonychotes weddellii at Laurie Island, South Orkney Islands. Polar Biol. 32, 833–838 (2009).
Wang, H. et al. Asian black bear (Ursus thibetanus) picornavirus related to seal aquamavirus A. Arch. Virol. 164, 653–656 (2019).
Koonin, E. V., Wolf, Y. I., Nagasaki, K. & Dolja, V. V. The Big Bang of picorna-like virus evolution antedates the radiation of eukaryotic supergroups. Nat. Rev. Microbiol. 6, 925–939 (2008).
Gromeier, M., Wimmer, E. & Gorbalenya, A. E. Chapter 12 - Genetics, Pathogenesis and Evolution of Picornaviruses. in Origin and Evolution of Viruses (eds. Domingo, E., Webster, R. & Holland, J.) 287–343 (Academic Press, London, 1999). doi:10.1016/B978-012220360-2/50013-1.
Smith, A. W., Akers, T. G., Madin, S. H. & Vedros, N. A. San Miguel sea lion virus isolation, preliminary characterization and relationship to vesicular exanthema of swine virus. Nature 244, 108–110 (1973).
Buckley, A., Crawford, L., Hoffman, K. & Falkenberg, S. Experimental Senecavirus A Infection of Bovine Cell Lines and Colostrum-Deprived Calves. Viruses 14, 2809 (2022).

No competing interests reported.

Download PDF

Reviews received at journal
08 May, 2024
Reviewers agreed at journal
08 May, 2024
Reviewers agreed at journal
17 Apr, 2024
Reviews received at journal
15 Apr, 2024
Reviewers agreed at journal
07 Apr, 2024
Reviewers agreed at journal
23 Feb, 2024
Reviewers agreed at journal
22 Feb, 2024
Reviewers agreed at journal
30 Jan, 2024
Reviewers agreed at journal
30 Jan, 2024
Reviewers invited by journal
30 Jan, 2024
Editor assigned by journal
30 Jan, 2024
Submission checks completed at journal
29 Jan, 2024
First submitted to journal
26 Jan, 2024

You are reading this latest preprint version

Senecavirus cetus a novel picornavirus isolated from cetaceans represents a major host switching to the marine environment

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Animals and Sample Collection

2.2 Virus Isolation and Transmission Electron Microscopy

2.3 Cell Line Susceptibility

2.4 Genome Sequencing

2.4.1 Whole genome sequencing

2.4.2 Confirmatory sequencing of infected cell lines

2.5 Phylogenetic and Genetic Analyses

2.5.1 Raw data processing and genome organization

2.5.2 Pairwise identity analysis

2.5.3 Phylogenetic analysis

2.5.4 Recombination analysis

2.5.5 Ancestral state reconstruction

3. Results

3.1 Pathology

3.2 Virus Isolation and Transmission Electron Microscopy

3.3 Cell Line Susceptibility

3.3 Genome Sequencing

3.3.1 Whole genome sequencing

3.3.2 Confirmatory sequencing of infected cell lines

3.4 Phylogenetic and Genetic Analyses

4 DISCUSSION

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1