Notch1 signaling pathway contributes to sorafenib resistance in hepatocellular carcinoma by modulating the cell cycle, mitochondrial function, and epithelial–mesenchymal transition

doi:10.21203/rs.3.rs-3909493/v1

Download PDF

Article

Notch1 signaling pathway contributes to sorafenib resistance in hepatocellular carcinoma by modulating the cell cycle, mitochondrial function, and epithelial–mesenchymal transition

https://doi.org/10.21203/rs.3.rs-3909493/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Sorafenib is the standard first-line molecular targeted therapy for advanced hepatocellular carcinoma (HCC); however, due to its high resistance rates, only a limited number of patients derive benefit from it. Therefore, it is crucial to investigate novel resistance mechanisms to overcome sorafenib’s acquired resistance.

In this study, two sorafenib-resistant HCC cell lines were established using the method of increasing concentrations. The activation of the Notch1 signaling pathway in drug-resistant cells and their parental counterparts was compared, and the impact of the Notch1 signaling pathway on the cell cycle, mitochondrial function, and epithelial–mesenchymal transition (EMT) in resistant cells was further investigated.

The Notch1 signaling pathway was aberrantly activated in sorafenib-resistant HCC cells, and the resistant cells exhibited enhanced proliferation, anti-apoptotic, migratory, and invasive capabilities. Mechanism exploration revealed that overactivation of the Notch1 signaling pathway reduced the efficacy of sorafenib in inhibiting the G1 phase of the cell cycle, inducing mitochondrial dysfunction, and inhibiting the EMT in HCC cells, leading to drug resistance. When the Notch1 signaling pathway was inhibited, resistant cells regained their sensitivity to sorafenib treatment. The mechanism of sorafenib resistance mediated by Notch1 signaling pathway may provide a new target for HCC treatment.

Sorafenib is an oral multikinase inhibitor that primarily plays antiproliferative and antiangiogenic roles by blocking the Raf/MEK/ERK signaling pathway and targeting the vascular endothelial growth factor receptor (VEGFR1-3), platelet-derived growth factor receptor (PDGFR), and mast/stem cell growth factor receptor (c-Kit). It is the first multikinase inhibitor approved for the first-line treatment of advanced HCC^[1]. However, patients treated with sorafenib either suffered from severe side effects or encountered disease progression soon after the initial response. Due to the high resistance rate to sorafenib, only a limited number of patients may benefit from the treatment^[2]. Therefore, it is important to investigate the underlying mechanisms of sorafenib resistance to enhance the prognosis of patients with advanced HCC.

Notch1 signaling pathway is an evolutionarily conserved pathway that regulates cell proliferation, differentiation, and apoptosis and determines cell fate ^[3]. As an oncogene, Notch1 is expressed in various malignant tumors and is closely associated with the proliferation, invasion, and metastasis of tumor cells. Our previous studies have found that Notch1 is overexpressed in HCC tissues, and this overexpression of Notch1 can result in liver function impairment and reduce the overall survival of patients^{[4, 5]}. Recently, increasing evidence indicates that the Notch1 signaling pathway is involved in the development of drug resistance in tumors. In ovarian and breast cancers, Notch1 overexpression is found to confer resistance to tumor cells against chemotherapeutic drugs^{[6, 7]}. However, whether Notch1 signaling is involved in the development of sorafenib resistance in HCC and its underlying mechanisms remains unclear. In this study, the activation of Notch1 signaling in sorafenib-resistant HCC cells was compared with that in parental HCC cells to determine whether Notch1 signaling contributes to the development of sorafenib resistance and to further investigate the underlying mechanisms by which Notch1 signaling influences this process.

1 Cell lines and cell cultures

HepG2 cells (CCTC-001-0014) and Huh7 cells (CTCC-003-0019) were acquired from Zhejiang Meisen Biological Co., LTD. HepG2-SR cells and Huh7-SR cells were derived from HepG2 cells and Huh7 cells using the concentration increment method and could grow stably in medium containing sorafenib at concentrations of 8 µM and 5 µM, respectively. HepG2/Huh7 cells were cultured in DMEM supplemented with 10% FBS, while HepG2-SR/Huh7-SR cells were cultured in DMEM supplemented with low concentrations of sorafenib and 10% FBS to sustain drug resistance.

2 Cell viability assay

Cells were seeded into 96-well plates for drug intervention. After 48 h of intervention, 10 µL of CCK-8 solution was added to each well. After incubation for 2 h, the absorbance at 450 nm in each group was measured using a microplate reader.

3 Cell clone formation assay

Cells were seeded into 6-well plates for drug treatment and then cultured for 14 days. After incubation, cells in the well plates were washed with PBS, fixed with a fixative, stained with crystal violet, photographed, and colone stacks were counted.

4 Cell cycle assay

After drug intervention, 1 × 10⁶ cells from each group were collected by trypsin digestion, and 1 ml of DNA staining solution and 10 ul of permeabilization solution were added. Incubation at room temperature in the dark for 30 min, followed by detection using flow cytometry.

5 Apoptosis test

After drug intervention, approximately 1x10⁶ cells from each group were collected by trypsin digestion, stained with ANNEXIN V-FITC and propidium iodide, incubated at room temperature for 5 min, and analyzed by flow cytometry.

6 Cell scratch test

Cell lines in the logarithmic growth phase were seeded into 6-well plates. When the cell confluency reached 80%, the tip of the 200 µl plastic pipette was perpendicular to the horizontal line for creating scratches and was washed with PBS. The cells were examined at 0 and 48 h post-scratch using an inverted microscope.

7 Transwell experiment

Complete medium (600 µl) was added to the lower chamber, and 1 × 10⁴ cells were added to the upper chamber. After 48 h, the cells were washed with PBS, fixed with a fixative solution, stained with crystal violet, and observed under an inverted microscope.

8 Measurement of mitochondrial membrane potential using the JC-1 assay

The cells of each group were lysed and collected using digestive enzymes. A 0.5 ml cell suspension was prepared, to which 0.5 ml of JC-1 staining solution was added. The mixture was then incubated at 37℃ for 20 min, followed by centrifugation at 600 g and 4℃ for 4 min. The resulting cell pellet was collected, resuspended in 1 ml of JC-1 staining buffer, and subsequently analyzed by flow cytometry.

9 Detection of reactive oxygen species (ROS) levels using the DCFH-DA method

The cells were suspended in DCFH-DA solution with a final concentration of 10 µM, incubated at 37℃ for 30 min in the dark, and ROS levels in the cells were detected by flow cytometry.

10 RT-PCR

Total RNA was extracted from cultured cells using TRIzol reagent. A 1-µL RNA solution was used to determine RNA quality and concentration using a Multiskan SkyHigh full-wavelength microplate reader. Reverse transcription was then carried out using an RT kit. Relative gene expression was analyzed using a Bio-Rad CFX96 quantitative PCR instrument and the 2^−ΔΔCT method. The following primer pairs were used: Notch1 forward: GCCTTTGTGCTTCTGTTCTTC and reverse: CTTCTTCTTGCTGGCCTCA; Jagged-1 forward: CTGCCGTTGCAGAAGTAAGA and reverse: CAGATCCAAGCCACAGTTAAGA; HES-1 forward: GTCAACACGA CACCGGATAA and reverse: TTCAGCTGGCTCAGACTTTC; E-cadherin forward: GCCAGGAAATCACATCCTACA and reverse: TGGCAGTGTCTCTCCAAATC; N-cadherin forward: TTCGGGTAATCCTCCCAAATC and reverse: CCACAATCC TGTCCACATCT; Vimentin forward: GCTCGTCACCTTCGTGAATA and reverse: AGTTTGGAAGAGGCAGAGAAA.

11 Western blotting

Protein samples were subjected to SDS-PAGE and then transferred to a PVDF membrane (Millipore). Membranes were blocked in 5% skim milk for 1 h at room temperature and incubated with primary antibodies overnight at 4℃. After washing with TBST, the membranes were incubated with the corresponding secondary antibodies for 1 h at room temperature. Finally, images were captured and analyzed using the Tanon automatic chemiluminescence imaging system.

12 Statistical Analysis

Statistics were expressed using mean ± SD and interquartile range, and comparisons between two groups were performed using independent samples t-test and Mann–Whitney U test. Multigroup comparison was performed using one-way ANOVA. Differences were considered statistically significant at P < 0.05.

Creation and confirmation of sorafenib-resistant HCC cell lines

To address the clinical challenge of sorafenib resistance, two sorafenib-resistant cell lines (HepG2-SR and Huh7-SR) were developed by long-term exposure of the original HCC cells (HepG2, Huh7) to sorafenib. Compared with HepG2/Huh7 cells, HepG2-SR/Huh7-SR cells exhibited significant morphological changes. HepG2/Huh7 cells showed an epithelial-like sheet morphology, whereas HepG2-SR/Huh7-SR cells showed a pronounced spindle-shaped morphology (Fig. 1). The IC50 value of sorafenib in HepG2-SR cells was 26.18 ± 0.75 µM, which was higher than that in HepG2 cells (7.02 ± 0.35 µM), indicating a drug resistance index of 3.73 (Fig. 2A). The IC50 value of sorafenib in Huh7-SR cells was 16.23 ± 0.55 µM, which was higher than that in Huh7 cells (4.63 ± 0.24 µM), indicating a drug resistance index of 3.51 (Fig. 2B).

Sorafenib-resistant HCC cells exhibit enhanced proliferation, antiapoptotic properties, and increased migratory and invasive capabilities

Cell cloning experiments showed that the clonal formation rate of HepG2-SR cells (74.40% ± 6.34%) was significantly higher than that of HepG2 cells (11.98% ± 1.51%) (P < 0.001)(Fig. 3A). Cell apoptosis experiments showed that the apoptosis rate of HepG2 cells was 33.27% ± 1.59%, whereas that of HepG2-SR cells decreased to 2.50% ± 0.78% (P < 0.001) (Fig. 3B). The migratory and invasive capabilities of cells were assessed using cell scratch and Transwell assays. The cell scratch assay revealed that the scratch healing rate of HepG2-SR cells after 48 h was 56.67% ± 3.21%, which was significantly greater than that of HepG2 cells (6.67% ± 3.21%) (P < 0.001) (Fig. 3C). The Transwell experiment showed that the perforation number of HepG2-SR cells (253.00 ± 17.44) was significantly higher than that of HepG2 cells (34.67 ± 8.50) (P < 0.001) (Fig. 3D). Similarly, consistent results were observed in Huh-7 SR cells (Fig. 3).

Notch1 signaling pathway is aberrantly activated in sorafenib-resistant HCC cells

Aberrant activation of Notch1 signaling pathway is closely associated with drug resistance in tumor cells. This study explored the activation status of Notch1 signaling pathway in sorafenib-resistant HCC cells. The results indicated that HepG2-SR/Huh7-SR cells exhibited increased expression of Notch1, Jagged1, and Hes1 mRNA compared to the progenitor HepG2/Huh7 cells (Fig. 4A), and similar findings were observed at the protein level (Fig. 4B). This indicated that the Notch1 signaling pathway was overactivated in sorafenib-resistant HCC cells.

Blockade of the Notch1 signaling pathway enhances the inhibitory effect of sorafenib on resistant HCC cells.

This study further evaluated the effects of the Notch1 signaling pathway on the proliferation, apoptosis, migration, and invasion of HepG2-SR/Huh7-SR cells. RBPJ Inhibitor-1 (a Notch1 signaling pathway inhibitor) successfully inhibited the Notch1 signaling pathway (Fig. 5). The results indicated that the clonal formation rate of HepG2-SR/Huh7-SR + RBPJ Inhibitor-1 cells (Notch1 inhibition group) was significantly reduced compared to HepG2-SR/Huh7-SR cells (P < 0.001) (Fig. 6A). The apoptosis rate of HepG2-SR/Huh7-SR + RBPJ Inhibitor-1 cells was significantly higher than that of HepG2-SR/Huh7-SR cells (P < 0.05) (Fig. 6B). The cell scratch healing rate of HepG2-SR/Huh7-SR + RBPJ Inhibitor-1 cells was significantly reduced compared to HepG2-SR/Huh7-SR cells (P < 0.01) (Fig. 6C). The cell perfuration number of HepG2-SR/Huh7-SR + RBPJ Inhibitor-1 cells was significantly lower than that of HepG2-SR/Huh7-SR cells (P < 0.001) (Fig. 6D).

The Notch1 signaling pathway contributes to sorafenib resistance by influencing the cell cycle

The underlying mechanisms leading to drug resistance following activation of the Notch1 signaling pathway were further investigated. Sorafenib interferes with the proliferation of HCC cells and arrests cancer cells in the G1 phase, thereby inhibiting cell division. This study further explored the effect of the Notch1 signaling pathway on the cell cycle. The results showed that the number of HepG2/Huh7-SR cells inhibited in the G1 phase of the cell cycle was significantly lower than that of HepG2/Huh7 cells(P < 0.001), and the proliferation index (PI) of HepG2/Huh7-SR cells was significantly higher than that of HepG2/Huh7 cells (P < 0.01). These results suggest that sorafenib’s efficacy in inhibiting the G1 phase of the cell cycle in drug-resistant HCC cells is reduced, leading to increased cell proliferation. However, when the Notch1 signaling pathway was inhibited, sorafenib regained its efficacy in arresting the G1 phase of the cell cycle in resistant cells (P < 0.01), and the proliferation index (PI) was also significantly reduced (P < 0.01) (Fig. 7).

The NOTCH1 signaling pathway contributes to sorafenib resistance by impacting mitochondrial function.

Previous studies have found that sorafenib can kill HCC cells by inducing mitochondrial dysfunction, activating intracellular ROS production and accumulation, and finally causing cellular oxidative stress damage. This study demonstrated that the mitochondrial membrane potential of HepG2-SR cells was significantly greater than that of HepG2 cells when treated with sorafenib (p < 0.001), and intracellular ROS levels were significantly reduced (p < 0.05) (Fig. 8A, Fig. 9A). This suggests that sorafenib’s capacity to induce oxidative stress damage in resistant cells was diminished. We further investigated whether the Notch1 signaling pathway is a crucial pathway contributing to changes in mitochondrial function. After inhibiting the Notch1 signaling pathway in drug-resistant cells, the mitochondrial membrane potential was significantly decreased (p < 0.001), the intracellular ROS levels were significantly increased (p < 0.05), and sorafenib regained its efficacy in inducing mitochondrial dysfunction in drug-resistant cells (Fig. 8A, Fig. 9A). The same results were obtained in Huh7 and Huh7-SR cells (Fig. 8B, Fig. 9B).

Notch1 signaling pathway leads to sorafenib resistance by affecting EMT

EMT plays a key role in cell migration and invasion. The influence of the Notch1 signaling pathway on EMT was further investigated. The results showed that compared with HepG2/Huh7 cells, the mRNA and protein levels of N-cadherin and Vimentin in HepG2-SR/Huh7-SR cells were significantly increased, whereas the mRNA and protein levels of E-cadherin were significantly decreased. After inhibiting the Notch1 signaling pathway, the mRNA and protein expression levels of mesenchymal markers (N-cadherin and Vimentin) in HepG2-SR/Huh7-SR cells were significantly reduced, while the expression levels of epithelial markers (E-cadherin) were significantly elevated (P < 0.05) (Fig. 10).

In patients with HCC, the emergence of acquired drug resistance significantly diminishes the therapeutic effectiveness of sorafenib. Despite the tremendous efforts that researchers have made, the mechanisms of sorafenib resistance remain incompletely understood, and strategies to overcome sorafenib resistance have yet to be identified. In this study, we found that the Notch1 signaling pathway was overractivated in sorafenib-resistant HCC cells. Aberrant activation of Notch1 signaling pathway could enhance the proliferation, antiapoptosis, invasion, and metastasis of tumor cells by affecting the cell cycle, mitochondrial function, and EMT process, thus generating drug resistance. Inhibiting the Notch1 signaling pathway restored the sensitivity of resistant HCC cells to sorafenib therapy.

Aberrant activation of Notch1 signaling pathway is closely related to the occurrence, development, and metastasis of HCC. Upregulation of Notch1 can increase the carcinogenic potential of HCC cells. The expression of Notch1 was positively associated with AFP concentration but inversely associated with the level of differentiation of hepatoma cells^[8]. The expression of Notch1 was also associated with the TNM stage of HCC patients, with higher levels of Notch1 observed in those at TNM stages III-IV^[9]. Furthermore, patients with elevated Notch1 expression in tumor tissues had poorer overall survival^[10]. Jagged1 is an important ligand in the Notch1 signaling pathway, which controls cell proliferation and differentiation and plays an important role in various malignancies. Jagged1 is highly expressed in HCC tissues^[11]. HCC patients with a higher copy number variation of Jagged1 have reduced overall survival^[12], and tumor cells with elevated Jagged1 expression are more prone to developing extrahepatic metastases. Jagged1 is an independent prognostic factor for extrahepatic metastasis^[13]. Hes1 is a basic helix-loop-helix transcriptional repressor that inhibits the expression of downstream target genes, including tissue-specific transcriptional activators, and is one of the primary targets of Notch1 signaling^[14]. Our previous study found that Hes-1 was strongly expressed in HCC tissues, and the expression level of Hes-1 was inversely correlated with patient survival^{[4, 5]}. It has also been discovered that HCC patients with HES1 overexpression are more prone to recurrence after radical surgery^[15]. However, the relationship between Notch1 signaling pathway and sorafenib resistance remains unclear. This study found that the mRNA and protein expression levels of Notch1, Jagged1, and Hes1 were significantly elevated in sorafenib-resistant HCC cells, suggesting that the Notch1 signaling pathway was overactivated in these cells.

Next, the potential mechanism of the Notch1 signaling pathway contributing to sorafenib resistance was further investigated. Abnormal proliferation of malignant tumors is associated with dysregulation of the cell cycle. Understanding how to control the progression of the cell cycle and inhibit it has become crucial in the treatment of malignant tumors^[16]. This study found that sorafenib could inhibit the cell cycle of original HCC cells in the G1 phase, thereby inhibiting the proliferation of HCC cells and achieving antitumor effects. However, in drug-resistant cells with aberrant activation of the Notch1 signaling pathway, sorafenib’s efficacy in inhibiting the G1 phase of the cell cycle was significantly reduced, resulting in heightened cell proliferation. When inhibiting the Notch1 signaling pathway, sorafenib regained its ability to inhibit the G1 phase of the cell cycle in resistant cells, thereby inhibiting cell proliferation.

As a crucial organelle ubiquitously present in cells, mitochondria not only supply energy for the normal metabolic processes of cells but also play a role in various cellular functions, including protein synthesis, genetic processes, immune responses, redox reactions, autophagy, and drug resistance. Damage to mitochondrial function or structure can lead to the production of ROS and the release of apoptosis-inducing factors in cells, thus resulting in cellular damage and apoptosis. Sorafenib can induce oxidative stress in hepatocellular carcinoma cells by causing mitochondrial dysfunction, thereby promoting HCC cell death. The alteration in mitochondrial function may be another significant factor contributing to sorafenib resistance^[17]. Therefore, this study compared the differences in mitochondrial function between original HCC cells and sorafenib-resistant HCC cells. It was found that in sorafenib-resistant cells with aberrant activation of the Notch1 signaling pathway, the efficacy of sorafenib in inducing mitochondrial dysfunction was significantly reduced, and its capacity to induce apoptosis was diminished, leading to drug resistance. However, when the Notch1 signaling pathway was inhibited, sorafenib regained its detrimental effect on the mitochondria of drug-resistant cells, mitochondrial membrane potential significantly decreased, and intracellular ROS accumulation was observed. These effects ultimately led to mitochondrial dysfunction and oxidative stress injury, thereby inducing the death of tumor cells.

EMT is a fundamental biological process that transforms polarized epithelial cells into mesenchymal cells, reorganizing the cytoskeleton of tumor cells and endowing them with the ability to migrate and invade^[18]. Activation of EMT is one of the common mechanisms leading to drug resistance in multiple cancers, including HCC. The occurrence of EMT is closely associated with the activation of a series of signaling pathways, among which the Notch1 signaling pathway plays a significant role. In pancreatic cancer, overexpression of Notch1 induces an EMT phenotype by upregulating mesenchymal markers such as ZEB1, CD44, EpCAM, and Hes1, thereby promoting tumor recurrence and metastasis^[19]. In breast cancer, the anti-human NICD monoclonal antibody 602.101 suppresses EMT, curtails cell proliferation, and promotes cell apoptosis by repressing the ligand-induced expression of Notch1 downstream target genes (such as HES1, HES5, and HEY-L)^[20]. In this study, we observed that compared with parental HCC cells, the levels of the mesenchymal markers N-cadherin and Vimentin were significantly upregulated in drug-resistant HCC cells with aberrant activation of the Notch1 signaling pathway, whereas the level of the epithelial marker E-cadherin was significantly downregulated. Drug-resistant cells exhibited an enhanced EMT phenotype and increased migratory and invasive capabilities. Inhibiting the Notch1 signaling pathway could reverse the EMT phenotype of drug-resistant cells, restore the inhibitory effect of sorafenib on the migration and invasion of drug-resistant cells, and reduce resistance to sorafenib.

In conclusion, the Notch1 signaling pathway is aberrantly activated in sorafenib-resistant HCC cells, which enhances their proliferation, antiapoptotic properties, migration, and invasive capabilities by influencing the cell cycle, mitochondrial function, and EMT process, leading to drug resistance. After inhibiting the Notch1 signaling pathway, the sensitivity of resistant HCC cells to sorafenib therapy was restored. The mechanism of sorafenib resistance mediated by Notch1 signaling pathway may provide a new target for HCC treatment. The combination of Notch1 inhibitors and sorafenib is expected to overcome sorafenib resistance.

Data availability

All the data in this research are available under reasonable request by contacting the corresponding author.

Acknowledgements

This work was supported by [Natural Science Foundation of Hebei Province] [Grant numbers (H2020206589)] and (Department of Health of Hebei Province) [Grant numbers (20230846)].

Author contributions

Y.F and M.Z. conceived the study. M.Z. designed the study, conducted the experiments, interpreted the data, and wrote the manuscript. J.F.S., X.L.D., L.L.M., J.F.W., G.J.H. prepared the samples and contributed to the interpretation of the results. X.H., X.L.Y., N.L., and J.J.H. revised important intellectual content. All authors have approved the fnal version of the manuscript.

Competing interests

The authors declare no competing interests.

Fornari, F., Giovannini, C., Piscaglia, F. & Gramantieri, L. Elucidating the molecular basis of sorafenib resistance in HCC: current findings and future directions. J Hepatocell Carcinoma. 8, 741-757 (2021).
Gauthier, A. & Ho, M. Role of sorafenib in the treatment of advanced hepatocellular carcinoma: An update. Hepatol Res. 43, 147-154 (2013).
Tian, T. et al. MicroRNA-760 Inhibits Doxorubicin Resistance in Hepatocellular Carcinoma through Regulating Notch1/Hes1-PTEN/Akt Signaling Pathway. J Biochem Mol Toxic. 32, e22167 (2018).
Shi, J. et al. Matrine promotes hepatic oval cells differentiation into hepatocytes and alleviates liver injury by suppression of Notch signalling pathway. Life Sci. 261, 118354 (2020).
Shi, J. et al. Matrine prevents the early development of hepatocellular carcinoma like lesions in rat liver. Exp Ther Med. 18, 2583-2591 (2019).
Qian, X.Q. et al. Notch1 Affects Chemo-resistance Through Regulating Epithelial-Mesenchymal Transition (EMT) in Epithelial Ovarian cancer cells. Int J Med Sci. 17, 1215-1223 (2020).
Wang, B. et al. Extracellular Vesicles Carrying miR-887-3p Promote Breast Cancer Cell Drug Resistance by Targeting BTBD7 and Activating the Notch1/Hes1 Signaling Pathway. Dis Markers. 2022, 5762686 (2022).
Lu, C.J. et al. Dihydromyricetin-mediated inhibition of the Notch1 pathway induces apoptosis in QGY7701 and HepG2 hepatoma cells. World J Gastroenterol. 23, 6242-51 (2017).
Wang, X.Q. et al. Notch1-Snail1-E-cadherin pathway in metastatic hepatocellular carcinoma. Int J Cancer. 131, 163-72 (2012).
Zhou, L. et al. The significance of Notch1 compared with Notch3 in high metastasis and poor overall survival in hepatocellular carcinoma. Plos One. 8, e57382 (2013).
Kunanopparat, A., Hirankarn, N., Issara-Amphorn, J., Tangkijvanich, P. & Sanpavat, A. The expression profile of Jagged1 and Delta-like 4 in hepatocellular carcinoma. Asian Pac J Allergy Immunol. 39, 44-52 (2021).
Kawaguchi, K. et al. Jagged1 DNA Copy Number Variation Is Associated with Poor Outcome in Liver Cancer. Am J Pathol. 186, 2055-67 (2016).
Xue, T.C. et al. Spatial localization of the JAG1/Notch1/osteopontin cascade modulates extrahepatic metastasis in hepatocellular carcinoma. Int J Oncol. 45, 1883-90 (2014).
Giovannini, C. et al. CDKN1C/P57 Is Regulated by the Notch Target Gene Hes1 and Induces Senescence in Human Hepatocellular Carcinoma. Am J Pathol. 181, 413-22 (2012).
Zou, J.H. et al. Prognostic significance of hes-1, a downstream target of Notch signaling in hepatocellular carcinoma. Asian Pac J Cancer Prev. 16, 3811-6 (2015).
Song, X. et a1．Identification of potential hub genesrelated to the progression and prognosis of hepatoeellular carcinoma through integrated bioinformatics analysis．Oncologyreports. 43, 133-146 (2020).
Li, Y. et al. Sorafenib induces mitochondrial dysfunction and exhibits synergistic effect with cysteine depletion by promoting HCC cells ferroptosis. Biochem Bioph Res Co. 534, 877-884 (2020).
Saitoh, M. Transcriptional regulation of EMT transcription factors in cancer. Semin Cancer Biol. 97, 21-29 (2023).
Bao, B. et al. Notch-1 induces epithelial-mesenchymal transition consistent with cancer stem cell phenotype in pancreatic cancer cells. Cancer Lett. 307, 26-36 (2011).
Sharma, A., Paranjape, A.N., Rangarajan, A. & Dighe, R.R. et al. A monoclonal antibody against human Notch1 ligand-binding domain depletes subpopulation of putative breast cancer stem-like cells. Mol Cancer Ther. 11, 77-86 (2012).

No competing interests reported.

Download PDF

Editorial decision: Revision requested
14 Oct, 2024
Reviews received at journal
08 Oct, 2024
Reviewers agreed at journal
27 Sep, 2024
Reviews received at journal
21 Mar, 2024
Reviewers agreed at journal
11 Mar, 2024
Reviewers invited by journal
07 Feb, 2024
Editor assigned by journal
07 Feb, 2024
Editor invited by journal
07 Feb, 2024
Submission checks completed at journal
07 Feb, 2024
First submitted to journal
29 Jan, 2024

You are reading this latest preprint version

Notch1 signaling pathway contributes to sorafenib resistance in hepatocellular carcinoma by modulating the cell cycle, mitochondrial function, and epithelial–mesenchymal transition

Status:

Version 1

Abstract

Figures

Background

Materials and methods

10 RT-PCR

Results

Creation and confirmation of sorafenib-resistant HCC cell lines

Sorafenib-resistant HCC cells exhibit enhanced proliferation, antiapoptotic properties, and increased migratory and invasive capabilities

Notch1 signaling pathway is aberrantly activated in sorafenib-resistant HCC cells

The Notch1 signaling pathway contributes to sorafenib resistance by influencing the cell cycle

Notch1 signaling pathway leads to sorafenib resistance by affecting EMT

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1