Leonurine exerts anti-inflammatory effects in LPS-induced endometritis by modulating the mouse JAK-STAT/PI3K-Akt/PPAR signalling pathway based on transcriptomic analysis

doi:10.21203/rs.3.rs-3917336/v1

Download PDF

Research Article

Leonurine exerts anti-inflammatory effects in LPS-induced endometritis by modulating the mouse JAK-STAT/PI3K-Akt/PPAR signalling pathway based on transcriptomic analysis

https://doi.org/10.21203/rs.3.rs-3917336/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Endometritis is a common disease in postpartum cows characterized by delayed uterine recovery due to inflammation of the endometrium. Although antibiotics and hormones are commonly used for treatment, they have their limitations. One potential alternative is the use of motherwort extract, specifically leonurine, which has been found to possess anti-inflammatory properties. However, the exact molecular mechanism of action remains unclear. To address this gap in knowledge, this study aimed to investigate the effects of leonurine on LPS-induced endometritis in mice using an experimental mouse model. Through transcriptomic analysis, it was discovered that leonurine modulates multiple signaling pathways, including JAK-STAT/PI3K-Akt, and influences the expression of key genes such as PRLR, SOCS2, COL1A1, and AKT1. Furthermore, leonurine effectively reduces the levels of inflammatory cytokines, such as tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), and interleukin-1beta (IL-1β), which play a crucial role in the regulation of acute endometritis. Additionally, leonurine helps maintain cholesterol homeostasis and attenuates inflammation through the PPAR signaling pathway by modulating genes like CYP27A1, HMGCS1, and SCD2. These findings suggest that leonurine has a protective effect against LPS-induced endometritis and its anti-inflammatory properties involve multiple pathways and targets, potentially mediated by the regulation of signaling pathways such as JAK-STAT/PI3K-Akt/PPAR.

Leonurine

Anti-inflammatory

LPS-induced endometritis

Signalling pathway

Endometritis is an inflammation of the lining of the uterus in domestic animals. It is common in cattle(Denis and Dubuc 2015), horses(Marta et al. 2019), sheep(Nani et al. 2020), camels(Jamal et al. 2020), but also in dogs(G.C.W. England et al. 2021) and pigs(Michał et al. 2019). Often occurs a few days after parturition, if not treated in time, the inflammation is easy to spread, can cause uterine plasma membrane or uterine periostitis, and often turn into chronic inflammation, so that the estrous cycle is disrupted, resulting in reproductive problems, and ultimately lead to long-term infertility, to the development of dairy farming has caused huge economic losses. Endometritis occurs in domestic animals for a variety of reasons, mainly related to infection with pathogenic microorganisms. Gram-negative bacteria are the main bacteria that cause endometritis, pathogenic microorganisms enter the uterus through various routes and multiply in the uterus, causing inflammation of the uterine mucosa. Lipopolysaccharide (LPS) is an outer membrane component of the cell wall of Gram-negative bacteria and is widely used in inflammatory models including acute lung injury, mastitis and endometritis(Wu et al. 2016;Wu et al. 2016;Liang et al. 2018). During the development of endometritis, LPS induces neutrophil activation leading to the release of inflammatory cytokines, which cause endometrial damage, and a number of studies have shown that inhibiting these inflammatory cytokines has a potential therapeutic effect on endometritis. Currently, irrigation, antibiotics and hormones are commonly used for the treatment of endometritis. However, they have drawbacks such as unsatisfactory therapeutic effect, drug resistance and drug residues. Therefore, screening natural drug candidates with low side effects from traditional Chinese medicine for the prevention and treatment of endometritis in domestic animals may be a solution for the clinical control of endometritis.

Motherwort is a traditional medicinal herb. It is widely used to treat conditions such as diabetes, menstrual disorders and bronchitis.Alkaloids are the main pharmacological basis of motherwort, and the main active compound is leonurine, which has a wide range of pharmacological activities in cardiovascular, neurological and uterine disorders, and is closely related to the traditional functions of motherwort(Md. Abu Sayed et al. 2016;Miao et al. 2019). Leonurine ameliorates chondrocyte and cartilage damage in mice by promoting autophagy and/or inhibiting inflammatory responses, and reduces IL-1β-induced inflammatory responses through the PI3K/AKT/NF-κB pathway(K. Sun et al. 2020). Leonurine shows nephroprotective effects in LPS-induced AKI in mice by inhibiting LPS-induced TLR4/NF-κB activation and pro-inflammatory cytokine production(Xu et al. 2014). In RA fibroblast-like synoviocytes, treatment with leonurine led to a decrease in pro-inflammatory cytokines such as IL-1β, IL-6, IL-8 and TNF-α. It also attenuated TNF-α-induced NF-kB signalling, preventing nuclear translocation of NF-κBp65 subunits, and inhibited migration and invasion of RA-FLS(Li et al. 2017). In mastitis treatment, leonurine exerts anti-inflammatory effects by inhibiting TLR4 expression and NF-κB activation as well as p38, ERK and JNK phosphorylation to upregulate IL-10 expression and downregulate TNF-α, IL-6, iNOS and COX-2 expression(Song et al. 2015). To investigate the anti-inflammatory effect of leonurine on endometritis, this study used uterine infusion of LPS to establish an animal model of endometritis and explored the anti-inflammatory mechanism of leonurine on endometritis in mice using transcriptome sequencing technology, with the aim of providing a theoretical basis for studying the clinical application of leonurine and its mechanism of action.

Animals and housing

Female C57BL/6J mice, 6–8 weeks old and weighing 18–22 g, were obtained from the Zhengzhou Huiji Huaxing Laboratory Animal Center (Zhengzhou, China). Before the experiment, the mice were acclimatised to the experimental environment for 7 days (ensuring temperature of 24 ± 2°C, relative humidity of 55%±5%, 12 h light and 12 h dark) with free food and water.

Reagents

Lipopolysaccharides from Escherichia coli 055:B5(LPS)purchased from Sigma; 1×PBS buffer was purchased from Beijing Solebo Technology Co.. Mouse TNF-α, IL-1β, IL-6 ELISA kits were purchased from Shanghai Enzyme-linked Biotechnology Co.. Mouse uterine perfusion apparatus was purchased from College of Animal Science and Technology, Hebei Agricultural University, China.Leonurine hydrochloride(purity ≥ 98%) was purchased from Chengdu Chengdu Efa Biotechnology,Co.,molecular formula:C14H22ClN3O5,molecular mass:347.79.

Endometritis mouse model and experimental design

Female C57BL6J mice were randomly divided into four groups: control group (Control group), model group (LPS group), leonurine group (Leo group, 30 mg/kg) and dexamethasone group (Dex group, 5 mg / kg), with 10 mice in each group.Mice in the control group were fed normally. Establishment of an endometritis disease model by uterine perfusion with 50 µL of LPS (1 mg/ml) in mice of the LPS group. Mice in the Leo and Dex groups were injected intraperitoneally with leonurine or dexamethasone 1 hour prior to modelling. They were then injected intraperitoneally with leonurine or dexamethasone every 6 hours after modelling, for a total of 4 administrations. Twenty-four hours after LPS infusion, mouse uterine tissues were aseptically harvested. After flash freezing with liquid nitrogen, the tissues were stored at -80℃ in a refrigerator.

Analysis of cytokines

The cytokines TNF-α, IL-1β and IL-6 were measured in uterine tissues taken randomly from 6 mice in each group. The cryopreserved uterine tissue was removed, weighed and placed on an ice tray, a quantity of PBS (pH 7.4) was added and the samples were well homogenised using a homogeniser. Collect the supernatant by centrifugation at 3,000×g for 20 min. One portion to test and the rest to freeze. The procedure was carried out strictly according to the instructions of the ELISA kit. Zeroing was performed with blank wells and the absorbance (OD value) of each well was measured sequentially at a wavelength of 450 nm using an enzyme-linked immunosorbent assay to calculate the levels of cytokines such as TNF-α, IL-1β and IL-6 in uterine tissue.

Transcriptomic testing and differential gene screening

Uterine tissues from three mice each were randomly selected from the Control, LPS and Leo(30 mg/kg) groups. TRIzol (Invitrogen, California, USA) was used to obtain total RNA from all samples as recommended in the instructions. The RNA Nano 6000 Assay kit (Agilent Technologies, CA, USA) was used to assess RNA concentration and purity. RNA integrity and total contents were evaluated by agarose gel electrophoresis in combination with an Agilent 2100 Bioanalyzer system, and select QC-qualified RNA for subsequent analysis.

Total RNA was used as input material for the RNA sample preparations. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in First Strand Synthesis Reaction Buffer(5X). First strand cDNA was synthesized using random hexamer primer and M-MuLV Reverse Transcriptase(RNase H-). Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3’ ends of DNA fragments, Adaptor with hairpin loop structure were ligated to prepare for hybridization. In order to select cDNA fragments of preferentially 370 ~ 420 bp in length, the library fragments were purified with AMPure XP system (Beckman Coulter, Beverly, USA).

Then PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers and Index (X) Primer. At last, PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system.

After passing the library inspection, the TruSeq PE Cluster Kit v3-cBot-HS (Illumia) sequencing platform is used to obtain the original gene sequences, which are then filtered and statistically analysed to obtain the gene sequences for subsequent analysis, including quality control, comparison, quantification, difference analysis and functional enrichment.

2.6. GO and KEGG enrichment analysis of differentially expressed genes

Differential expression analysis between the two comparison combinations was performed using DESeq2R package (1.20.0). Differential genes were screened for |log2(FoldChange)| >= 1 & padj < = 0.05. Gene Ontology (GO) enrichment analysis of differentially expressed genes was implemented by the clusterProfiler (3.8.1)R package, in which gene length bias was corrected.The differentially expressed gene sets were enriched into the relevant KEGG (Kyoto Encyclopedia of Genes and Genomes) (http://www.genome.jp/kegg/) pathway for analysis using the ClusterProfiler (3.8.1) R package. The Gene Set Enrichment Analysis (GSEA) analysis tool (http://www.broadinstitute.org/gsea/index.jsp) was used to perform the GSEA analysis on the GO and KEGG data sets, respectively.

Real-time quantitative RCR (qRT‒PCR) analysis

Uterine tissues from three mice in each of the control, LPS and Leo groups were selected at random. Total RNA was extracted using RNA Extraction Solution (Servicebio) according to the procedure, RNA concentration and purity were determined using Nanodrop 2000, and overconcentrated RNA was diluted in an appropriate ratio to give a final concentration of 100–500 ng/µL. The reaction system for the reverse transcription reaction(20µL) consists of the following components:4µL of 5 x Reaction Buffer, 0.5 µL of Oligo (dT)18 Primer (100 µM), 0.5µL of And Random Hexamer primer (100 µM), 1µL of Servicebio®RT Enzyme Mix, 10µl of Total RNA, 4µL of RNase free water.Reverse transcription program settings:25℃ for 5 min, 42℃ for 30 min, 85℃ for 5 sec. The PCR systems were as follows:7.5µL of 2× qPCR Mix,1.5µL of 2.5µM forward and reverse primers, (gene primer sequence as shown in Table 1),2.0µL template cDNA ,4.0µL ddH2O (RNase free). The expression of the PCR product was calculated based on the quantitation of relative gene expression based on the delta Ct values.

Table 1

List of primers used in this study
Genes	Forward primer	Reverse primer
GAPDH	GAAGGTGGTGAAGCAGGCATCT	CGGCATCGAAGGTGGAAGAGTG
PRLR	ACTCACTCCTCTCCTGCGTTCT	TGCGATGCTCACCTCCACAGA
SOCS2	CCACCTCGCCACATTCCATCTT	GCCGTCAATCATCTCAGCAAGC
COL1A1	GCTCGTGGATTGCCTGGAACA	CAGCACCAACAGCACCATCGT
AKT1	TGGACTTCCGATCAGGCTCACC	TGGCGACGATGACCTCCTTCTT
CYP27A1	AAGGACCACCGAGACCACAAGG	GTGATGGCTTCCAAGGCAAGGT
HMGCS1	TGGTTCCCTGGCTTCTGTCCTG	TCCTGGTGTGGCGTCTTGTGT
SCD2	TCCTGCTGATGTGCTTCGTCCT	AGGCGTGGTGGTAGTTGTGGAA

Statistical analysis

ELISA Calc software was used for analysing ELISA results. Statistical significance was assessed using one-way ANOVA followed by Tukey’s comparison test in GraphPad Prism program version 9 (GraphPad Software, San Diego, CA, USA). A value of P < 0.05 was considered to be statistically significant.

Effects of leonurine on the levels of pro-inflammatory cytokines

Changes in levels of inflammatory factors, especially pro-inflammatory cytokines, are a visual indicator commonly used to evaluate the anti-inflammatory effects of anti-inflammatory drugs. To evaluate the effects of leonurine on inflammatory cytokines in LPS-induced endometritis in mice, changes in TNF-α, IL-6 and IL-1β in uterine tissue homogenates were detected by ELISA, as shown in Fig. 1. The levels of inflammatory cytokines TNF-α, IL-6, and IL-1β (Fig. 1) in the uterine tissues of mice in the LPS group were highly significantly increased in comparison with the control group (P < 0. 01); compared with the LPS group, the levels of the inflammatory cytokines TNF-α, IL-6 and IL-1β in the uterine tissues of mice in the Leo group and the Dex group were all highly significantly decreased (P < 0.01).

Differential gene analysis

To accurately grasp the molecular mechanism of leonurine in regulating endometritis and to screen the pathways and target genes for leonurines' anti-inflammatory effects, we analysed uterine tissues by transcriptomics technology and obtained the differential genes among different treatment groups, as shown in Fig. 2. In total, 1603 differentially expressed genes (DEGs) were identified between LPS and Control groups, with 891 up-regulated DEGs (red) and 712 down-regulated DEGs (green) as shown in Fig. 2A. There were a total of 1089 DEGs in the Leo group and Control group, including 612 upregulated DEGs (red) and 477 downregulated DEGs (green), as shown in Fig. 2B. Leo and LPS groups had a total of 1290 DEGs, including 615 upregulated (red) and 675 downregulated (green) DEGs, as shown in Fig. 2C. A total of 3119 DEGs were identified, of which 1388 were upregulated (red) and 1731 were downregulated (green), as shown in Fig. 2D. The overlap of differential genes between different comparison combinations was shown by Venn diagram, and the overlap areas in Fig. 2E and 2F indicate the number of DEGs shared between combinations, with 400 DEGs shared between the LPS vs control + LEO vs LPS groups (Fig. 2E) and 273 DEGs shared between the LEO vs control + DEX vs control groups (Fig. 2F). These data suggest that the genes involved undergo significant changes after LPS stimulation of the body, and that the use of leonurine might serve to block the tendencies of such gene changes to a certain extent.

GO enrichment analysis of the DEGs

DEGs from each group's significant difference analysis were annotated to gene sets in GO and KEGG databases, and GO functional enrichment analysis and KEGG pathway enrichment analysis were performed on differential gene sets using clusterProfiler software. It is divided into three parts: biological process / cellular component and molecular function. The GO function enrichment takes padj less than 0.05 as the threshold for significance enrichment and takes the 30 most significant terms to draw a histogram for presentation. The enrichment results are shown in Fig. 3.GO functional enrichment analysis showed that the differential genes in the LPS group compared to the control group were mainly involved in biological processes such as microtubule-based movement, movement of cell or subcellular component, and microtubule-based process,and molecular Functions such as microtubule motor activity,microtubule binding,tubulin binding,motor activity and cytoskeletal protein binding. GO enrichment analysis revealed that after LPS-induced endometritis in mice, inflammation had a greater effect on the gene expression of kinesin superfamily proteins (KIFs) such as Kif18b, Kif23, Kif2c, Kif22, Kif20a, Kifc1 and Kif14. This suggests that LPS-induced endometritis has a greater effect on the function and morphology of cells in the uterine tissue.

GO functional enrichment analysis showed that the differential genes in the Leo group compared to the LPS group were mainly involved in biological processes such as oxidation-reduction process,lipid biosynthetic process,alpha-amino acid metabolic process,Wnt signaling pathway and cell-cell signaling by wnt;molecular Functions such as biological process, signaling receptor binding,receptor regulator activity,receptor ligand activity,molecular function regulator,extracellular matrix structural constituent,channel activity,passive transmembrane transporter activity and cytokine activity;cellular component such as extracellular region,dynein complex,extracellular space,cytoplasmic vesicle,vesicle,intracellular vesicle and microtubule associated complex(Fig. 4). GO enrichment analysis revealed that leonurine may alter gene expression in endometritis mice regarding lipid synthesis, energy metabolism, inflammatory pathways and immune response.

KEGG enrichment analysis of the DEGs

The Kyoto Encyclopedia of Genes and Genomes (KEGG) is a comprehensive database that integrates genomic, chemical, and systemic functional information.KEGG pathway enrichment used padj less than 0.05 as the threshold for significant enrichment. The KEGG pathway enrichment results showed that the KEGG pathways with the most significant differential gene enrichment in the LPS group compared to the control group (Fig. 5) were Steroid Biosynthesis, Terpenoid Backbone Biosynthesis, Herpes Simplex Virus 1 Infection, Cell Cycle, Cell Adhesion Molecules (CAMs) and Other Biological Pathways.

The KEGG pathway enrichment results showed that a total of 295 pathways were enriched in the epsilon alkaloids group compared to the model group (Fig. 6). The KEGG pathways with the most significant differential gene enrichment were Steroid biosynthesis,Terpenoid backbone biosynthesis,ECM-receptor interaction,Protein digestion and absorption,Other types of O-glycan biosynthesis,PI3K-Akt signaling pathway,Mucin type O-glycan biosynthesis,Drug metabolism -cytochrome P450,Calcium signaling pathway,Fluid shear stress and atherosclerosis,Aldosterone-regulated sodium reabsorption,Neuroactive ligand-receptor interaction,Basal cell carcinoma,Metabolism of xenobiotics by cytochrome P450,PPAR signaling pathway and other biological pathways.There was also significant enrichment in inflammatory signaling pathways such as Wnt signaling pathway and MAPK signaling pathway. The genes with significant differences in the above pathways mainly include Hmgcr, Mapk10, Gadd45g, Wnt5b, Igf1, Ccl17, CYP27A1, PRLR, SOCS2, HMGCS1, SCD2, Creb3l3, Prkcq, Ror2, Il11, Casp1, COLIA1, AKT1, and so on.

qRT-PCR to verify the expression of significantly different genes

Based on the results of GO annotation and KEGG pathway enrichment analysis of differentially expressed genes, the relative expression of seven key genes, including CYP27A1, SOCS2, HMGCS1, SCD2 and PRLR, involved in the regulation of inflammation in multiple signalling pathways including JAK-STAT/PI3K-Akt/PPAR were verified by qRT-PCR method with GAPDH as the internal reference gene(Fig. 7). Compared to the Control group, the relative expression of the CYP27A1 gene was downregulated and the relative expression of the SOCS2, HMGCS1, SCD2, PRLR, COLIA1 and AKT1 genes were upregulated in the LPS group. In comparison with the LPS group, the Leo group significantly upregulated the relative expression of the CYP27A1 gene and significantly downregulated the relative expression of the SOCS2, PRLR, HMGCS1, SCD2, COLIA1 and AKT1 genes. And the relative expression trends of the above seven genes were in agreement with the results of the transcriptomic analysis and the results of the qRT-PCR validation.

Endometritis is defined as an inflammation of the endometrium in the absence of systemic signs and is associated with delayed involution of the uterus. Clinically, it often leads to reproductive problems in dairy cows. Although antibiotics are widely used to treat endometritis in dairy cows, long-term treatment with high doses of antibiotics leads to bacterial resistance and drug residues, which is an unavoidable problem. Therefore, pharmacological strategies for the treatment of endometritis need to be studied from other perspectives. The high cost and difficult operation of research using cows as experimental animals has limited the development of in vivo research on the mechanism of drug treatment of endometritis in animals; therefore, the use of small animals to establish an animal model of endometritis disease is a rapid and effective method to study the mechanism of drug treatment of endometritis. In our study, we found that transvaginal instillation of a certain amount of LPS induced acute endometritis in mice, resulting in elevated levels of pro-inflammatory cytokines such as TNF-α, IL-6 and IL-1β, whereas leonurine effectively inhibited the levels of inflammatory factors such as TNF-α, IL-6 and IL-1β in the acute phase of endometritis.Interestingly, we found that leonurine did not inhibit acute inflammation by regulating a single pathway, but by regulating the expression of genes such as PRLR, SOCS2, AKT1, COLIA1, etc., and the signalling pathways such as JAK-STAT and PI3K-AKT. Meanwhile, leonurine regulates the overall cholesterol stability and energy metabolism in macrophages by modulating the gene expression of CYP27A1, HMGCS1, SCD2, etc.. Through the regulation of multiple pathways and multiple targets, it ultimately achieves the prevention of LPS-induced acute inflammatory overdevelopment of endometritis, promotes the recovery of inflammation, and plays a role in the regulation of acute endometritis.

Inflammatory factors are a class of highly active, multifunctional, small-molecule proteins that are mainly synthesised and secreted by immune cells (lymphocytes and monocyte -macrophages) and other related cells (endothelial cells, epithelial cells, fibroblasts, etc.). They have a variety of biological functions, such as regulating the physiological functions of cells, participating in immune responses and mediating inflammatory responses, and are involved in the entire inflammatory process. In the functional classification of inflammatory factors, TNF-α,IL-6,IL-1β are pro-inflammatory factors regulating innate immunity, synergistically mediating the acute-phase response to inflammation, and are the major pro-inflammatory cytokines involved in the inflammatory response. Therefore, the disease process and inflammatory status can be reflected by measuring the body's levels of TNF-α, IL-6 and IL-1β. In this study, we found that uterine infusion of 50 µL LPS (1 mg/mL) significantly increased the levels of TNF-α, IL-6 and IL-1β in the uterine tissue of mice, whereas 30 mg/kg leonurine significantly reduced the levels of the inflammatory cytokine TNF-α, IL-6, and IL-1β in LPS-induced mouse uterine tissue, suggesting that leonurine may exert anti-inflammatory effects on LPS-induced endometritis by inhibiting proinflammatory cytokine release.

The JAK/STAT pathway is a major signalling pathway. It is stimulated by many important cytokines involved in sepsis, including IFN-γ and IL-4, IL-6, IL-10 and IL-12(Wang et al. 2019). The PRLR is a member of the cytokine type I receptor superfamily and, like all cytokine receptors, is a single-pass transmembrane chain. The expression of the PRLR can be regulated by a variety of stimuli, such as inflammatory mediators. PRLRs can also activate a subset of STAT proteins, including STAT1, STAT3, STAT5A and STAT5B(BoleFeysot et al. 1998). In several experimental models of infection, including models of Toxoplasma gondii, Trypanosoma cruzi and Plasmodium berghei Anka infection, the SOCS2 protein has been recognised as a modulator of the innate and adaptive immune response. In these models, SOCS2's involvement is complex and involves Th1, Th2, Th17 and T-regulatory cell generation/differentiation(Fatima et al. 2016;Lisia et al. 2012;Fabiana et al. 2006;Fabiana et al. 2006). SOCS2 in early/peak phase of experimental autoimmune encephalomyelitis contributes to induction of neuroinflammation(Allysson et al. 2019). In this study, we found that endometrial inflammation significantly increased the expression of the PRLR gene (P < 0.01) and the SOCS2 gene (P < 0.05) in the uterine tissue of mice after instillation of LPS. Treatment with leonurine was able to attenuate the inflammation-induced increase in the expression of the PRLR and SOCS2 genes. It suggests that leonurine may inhibit the JAK/STAT pathway during acute inflammation by regulating the relative expression of the PRLR and SOCS2 genes to play an anti-inflammatory role. This may prevent the exacerbation of acute inflammation, reduce uterine tissue damage and promote recovery from endometritis.

The PI3K/AKT signalling pathway is closely linked to cell survival, promotes cell proliferation and inhibits apoptosis. It also plays a regulatory role in inflammation and immune response. AKT1 has been shown to regulate innate immunity in macrophages by mediating mitochondrial H₂ O₂ production(AP West et al. 2011). Collagen type I alpha 1 chain (COL1A1) is a biomarker of collagen metabolism and tissue fibrosis(Sun et al. 2022). Recent literature suggests that miR-92b may act as a protective factor in LPS-induced inflammatory injury by inhibiting TLR 4 signalling of the PTEN/PI 3 K/AKT/β-catenin axis(Jiang et al. 2021). Interferon-τ may protect against inflammatory injury by inhibiting TLR4/NF-κB activation through regulation of the PI3K/AKT/β-catenin/FoxO1 axis(Jiang et al. 2024). We found that endometrial inflammation during LPS-induced acute endometritis was able to significantly upregulate COLIA1 and AKT1 gene expression in mouse uterine tissues (P < 0. 01), whereas trans-Estringentine was able to significantly reduce the inflammation-induced increase in COLIA1 and AKT1 gene expression. This suggests that leonurine may alleviate fibrosis caused by LPS-induced acute endometrial inflammation by regulating innate immunity of macrophages and the expression of key genes in the signalling pathway, inhibiting the PI3K/AKT signalling pathway and alleviating inflammation-induced fibrosis in uterine tissue. Thus, leonurine has a potential protective effect against the acute inflammatory injury of LPS-induced endometritis.

Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors of the nuclear hormone receptor superfamily, consisting of three isoforms, PPAR α, PPAR γ and PPAR β/delta. The PPAR family plays an important regulatory role in energy homeostasis and metabolic functions(Kay-Dietrich and Nicole 2010). Cytochrome P450 family 27 subfamily A member 1 (CYP27A1) is a rate-limiting enzyme in the bypass pathway of bile acid synthesis. It is important for overall cholesterol homeostasis and is also closely associated with a variety of tumourigenesis. Baicalin increases the expression of bile acid synthase (CYP27A1) and metabolising enzymes (Bal, Baat, Sult 2a 1) in the liver of rats with estrogen-induced cholestasis, reduces the elevated levels of TNF-α, IL-1b, IL-6 and NF-κ B, and significantly inhibits hepatic inflammatory responses in rats with EIC(Yang et al. 2020). 3-Hydroxy-3-methylglutaryl coenzyme A synthase 1 (HMGCS1) is the rate-limiting enzyme of the mevalonate (MVA) pathway, catalysing the synthesis of HMG-CoA, and is a key enzyme in the cholesterol synthesis pathway. In human cancer cells, PPAR-α, a key transcriptional regulator of lipid metabolism, cross-talks with SREBP to regulate the expression of HMGCS1 and MSMO1(David et al. 2010). Stearoyl-coenzyme A desaturase-2 (SCD2) is a member of the SCD family of enzymes, which acts as both an energy source and a signalling molecule(Lucas et al. 2020). LPS induces the expression of the Scd gene, resulting in the formation of foam cells, which are macrophages containing high levels of fatty acids. Therefore, SCD may play a crucial role in regulating energy metabolism(Bruno et al. 2022). In our study, we found that inflammation during LPS-induced acute endometritis altered cellular processes such as nutrient uptake and metabolic regulation of cells. Additionally, leonurine accelerated bile acid metabolism by regulating cholesterol synthesis and transport in macrophages. This was favourable to overall cholesterol homeostasis. However, the mechanism of action of leonurine in regulating energy metabolism and cholesterol metabolism requires further investigation.

The present work proven that leonurine has demonstrated excellent anti-inflammatory properties. The molecular mechanisms behind leonurine's anti-inflammatory properties include inhibition of the expression of PRLR, SOCS2, COLIA1 and AKT1 genes in the JAK-STAT/PI3K-Akt pathway, as well as down-regulation of the pro-inflammatory cytokines TNF-α, IL-6 and IL-1β. In addition, leonurine has been shown to modulate the expression of CYP27A1, HMGCS1 and SCD 2 in the PPAR pathway, thereby improving cholesterol and energy metabolism and maintaining overall cholesterol homeostasis. In summary, leonurine has multiple pathways and targets for anti-inflammatory activity, as evidenced by its ability to modulate LPS-induced endometritis in mice. Therefore, leonurine has the potential to be used as a drug for the treatment of endometritis.

Acknowledgements We would especially want to thank Prof. Xinli Gu, who supported the project by providing research ideas and equipment. We are grateful to everyone who participated in this process.

Author contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yongbin Shao, Yaoqiang Sun,Jingbo Jiang, Zhiyuan Li, Mengmeng Wang, and Yan Luo. The first draft of the manuscript was written by Yongbin Shao and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data Availability Data will be made available upon reasonable request.

Competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Animal Ethics This research was approved by the Biology Ethics Committee of Shihezi University, protocol number A2023-82.The mice were obtained from the Zhengzhou Huiji Huaxing Laboratory Animal Center (Zhengzhou, China). Before the experiment, the mice were acclimatised to the experimental environment for 7 days (ensuring temperature of 24±2°C, relative humidity of 55%±5%, 12 h light and 12 h dark) with free food and water. All mice in this study were euthanized(via intraperitoneal injection of excess 5% chloral hydrate).

Allysson Cramer，Bruno Cabral de Lima Oliveira，Paulo Gaio Leite，David Henrique Rodrigues，FabianaSimo Machado (2019) Role of SOCS2 in the Regulation of Immune Response and Development of the Experimental Autoimmune Encephalomyelitis.Mediators of Inflammation,2019(1):1-11.https://doi.org/10.1155/2019/1872593
AP West，IE Brodsky，C Rahner，KW Dong，H Erdjument-Bromage，P Tempst，MC Walsh，Y Choi，GS Shadel，SS Ghosh (2011) TLR signalling augments macrophage bactericidal activity through mitochondrial ROS,Nature, 472:476-80.https://doi.org/10.1038/NATURE09973
BoleFeysot C，Goffin V，Edery M，Binart N，Kelly PA (1998) Prolactin (PRL) and its receptor: actions,signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews,19(3):225. 225–268.https://doi.org/10.1210/edrv.19.3.0334
Bruno Bueno-Silva, Manuela Rocha Bueno, Dione Kawamoto, Renato C Casarin, João Marcos Spessoto Pingueiro, Severino Matias Alencar, Pedro Luiz Rosalen, Marcia Pinto Alves Mayer (2022) Anti-Inflammatory Effects of (3S)-Vestitol on Peritoneal Macrophages. Pharmaceuticals (Basel).15(5):553.https://doi.org/10.3390/ph15050553
David L M van der Meer, Tatjana Degenhardt, Sami Väisänen, Philip J de Groot, Merja Heinäniemi, Sacco C de Vries, Michael Müller, Carsten Carlberg, Sander Kersten (2010) Profiling of promoter occupancy by PPARalpha in human hepatoma cells via ChIP-chip analysis. Nucleic Acids Res 38(9):2839-50. https://doi.org/10.1093/nar/gkq012
Denis-Robichaud J,Dubuc J (2015) Determination of optimal diagnostic criteria for purulent vaginal discharge and cytological endometritis in dairy cows.Journal of dairy science.98(10):43-48. https://doi.org/10.3168/jds.2014-9120
Fabiana S Machado , James E Johndrow, Lisia Esper, Alexandra Dias, Andre Bafica, Charles N Serhan, JulioAliberti (2006) Anti-inflammatory actions of lipoxin A4 and aspirin-triggered lipoxin are SOCS-2 dependent.Nature Medicine,12(3):330-334.https://doi.org/10.1038/nm1355
Fabiana S Machado , Julio Aliberti (2006) Impact oflipoxin-mediated regulation on immune response to infectious disease. Immunologic Research,35(3):209-218.https://doi.org/10.1385/IR:35:3:209
Fatima Brant, Aline S. Miranda, Lisia Esper, Melisa Gualdrón-López, Daniel Cisalpino, Danielle da Gloriade Souza, Milene Alvarenga Rachid, Herbert B. Tanowitz, Mauro Martins Teixeira, Antônio Lucio Teixeira, Fabiana Simão Machado (2016) Suppressor of cytokine signaling 2 modulates the immune response profile and development of experimental cerebral malaria. Brain, Behavior,and Immunity,54:73-85.https://doi.org/10.1016/j.bbi.2016.01.002
G.C.W. England, T. Rijsselaere, A. Campbell, R. Moxon, S.L. Freeman (2021) Normal and abnormal response to sperm deposition in female dogs:A review and new hypotheses for endometritis. Theriogenology,159:176-183.https://doi.org/10.1016/j.theriogenology.2020.10.013
Jamal Hussen, Turke Shawaf, Abdullah I.A. Al-Mubarak, Naser Abdallah Al Humam, Faisal Almathen, Hans-Joachim Schuberth (2020) Leukocyte populations in peripheral blood of dromedary camels with clinical endometritis.Animal Reproduction Science,222:106602.https://doi.org/10.1016/j.anireprosci.2020.106602
Jiang Kangfeng, Cai Jinyin, Jiang Qianming, Juan J Loor, Deng Ganzhen, Li Xiaobing , Yang Jing (2024)Interferon-tau protects bovine endometrial epithelial cells against inflammatory injury by regulating the PI3K/AKT/β-catenin/FoxO1 signaling axis. J Dairy Sci.107(1):542-559. https://doi.org/10.3168/jds.2022-22983
Jiang Kangfeng, Yang Jing, Song Chunlian, He Fengping, Yang Liangyu, Li Xiaobing (2021) Enforced expression of miR-92b bluntsE. colilipopolysaccharide-mediated inflammatory injury by activating the PI3K/AKT/β-catenin pathway via targeting PTEN.International journal of biological sciences,17(5):1289-1301.https://doi.org/10.7150/ijbs.56933
K. Sun, J. Luo, J. Guo, X. Yao, X. Jing, F. Guo (2020) The PI3K/AKT/mTOR signaling pathway in osteoarthritis: a narrative review.Osteoarthritis and Cartilage,28:400-409.https://doi.org/10.1016/j.joca.2020.02.027
Kay-Dietrich Wagner , Nicole Wagner (2010) Peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) acts as regulator of metabolism linked to multiple cellular functions. Pharmacol Ther. 125(3):423-435.https://doi.org/10.1016/j.pharmthera.2009.12.001
Liang Yuanjiao, Shen Tao, Ming Qi, Han Guoqing, Zhang Yan, Liang Jinlan, Zhu Duanrong (2018) Alpinetin ameliorates inflammatory response in LPS-induced endometritis in mice.International Immunopharmacology,62:309-312.https://doi.org/10.1016/j.intimp.2018.07.010
Li Nan, Xu Qiang, Liu Qingping, Pan Dongmei, Jiang Yubao, Liu Minying,Liu Mingling, Xu Hanshi andLin Changsong (2017) leonurine attenuates fibroblast-like synoviocyte- mediated synovial inflammation and joint destruction in rheumatoid arthritis.. Rheumatology (Oxford，England),56(8):1417–1427.https://doi.org/10.1093/rheumatology/kex142
Lisia Esper , Danilo Roman-Campos, Aline Lara, Fatima Brant, Luisa L Castro, Andreia Barroso et al.(2012) Role of SOCS2 in modulating heart damage and function in a murine model of acute Chagas disease. The American Journal of Pathology, 181(1):130-40.https://doi.org/10.1016/j.ajpath.2012.03.042
Lucas M O'Neill, Chang-An Guo, Fang Ding, Yar Xin Phang, Zhaojin Liu, Sohel Shamsuzzaman, James M Ntambi (2020) Stearoyl-CoA Desaturase-2 in Murine Development, Metabolism, and Disease.International Journal of Molecular Sciences,21(22):1-17.https://doi.org/10.3390/ijms21228619
Marta J. Siemieniuch, Roland Kozdrowski, Anna Z. Szóstek-Mioduchowska, Andrzej Raś, Marcin Nowak (2019) Evidence for Increased Content of PGF 2α,PGE 2,and 6-keto-PGF 1α in Endometrial Tissue Cultures From Heavy Draft Mares in Anestrus With Endometritis.Journal of Equine Veterinary Science,77:107-113.https://doi.org/10.1016/j.jevs.2019.02.014
Md. Abu Sayed, Md. Ashraful Alam, Md. Shariful Islam, Md. Taif Ali, Md. Emdad Ullah, Abu Zaffar Shibly, Md. Aslam Ali, Md. Mahdi Hasan-Olive (2016) Leonurus sibiricus L. (honeyweed):A review ofits phytochemistry and pharmacology.Asian Pacific Journal of Tropical Biomedicine,6(12):1076-1080.https://doi.org/10.1016/j.apjtb.2016.10.003
Miao Lu-Lin, Zhou Qin-Mei, Peng Cheng, Liu Zhao-Hua, Xiong Liang (2019) Leonurus japonicus(Chinese motherwort), an excellent traditional medicine for obstetrical and gynecological diseases:A comprehensive overview.Biomedicine & Pharmacotherapy,117:109060.https://doi.org/10.1016/j.biopha.2019.109060
Michał Bulc,Jarosław Całka,Karolina Meller,Barbara Jana (2019) Endometritis affects chemical coding of the dorsal root ganglia neurons supplying uterus in the sexually mature gilts. Research in Veterinary Science,124:417-425. https://doi.org/10.1016/j.rvsc.2019.05.003
Nani Nasreldin, Fatma Abo Zakaib Ali, Hanan H. Abd-Elhafeez, Mervat Hassan, Marwa El-Zeftawy, Waleed Senosy (2020) Characterization of immunological, biochemical and inflammatory response of clinical and subclinical endometritis in ewes in the subtropics. Animal Reproduction Science,219.106541.https://doi.org/10.1016/j.anireprosci.2020.106541
Song Xiaojing,Wang Tiancheng, Zhang Zecai, Jiang Haichao, Wang Wei, Cao Yongguo & Zhang Naisheng (2015) leonurine Exerts Anti-Inflammatory Effect by Regulating Inflammatory Signaling Pathways and Cytokines in LPS-Induced Mouse Mastitis.Inflammation, 38(1):79-88.https://doi.org/10.1007/s10753-014-0009-9
Sun Yimin, Liu Bingyan, Xie Jianping, Jiang Xuefeng, Xiao Baolai, Hu Xiaomiao, Xiang Jinjian (2022) Aspirin attenuates liver fibrosis by suppressing TGFβ1/Smad signaling.Molecular medicine reports, 25(5).https://doi.org/10.3892/mmr.2022.12697
Wang Xiangkun, Liao Xiwen, Yu Tingdong, Gong Yizhen, Zhang Linbo,Huang Jianlu, Yang Chengkun, Han Chuangye, Yu Long, Zhu Guangzhi, Qin Wei, Liu Zhengqian, Zhou Xin, Liu Junqi, Han Quanfa,Peng Tao (2019) Analysis of clinical significance and prospective molecular mechanism of main elements of the JAK/STAT pathway in hepatocellular carcinoma.International Journal of Oncology, 55(4).https://doi.org/10.3892/ijo.2019.4862
Wu Haichong, Zhao Gan, Jiang Kangfeng, Chen Xiuying, Zhu Zhe, Qiu Changwei, Li Chengye, Deng Ganzhen (2016) Plantamajoside ameliorates lipopolysaccharide- induced acute lung injury via suppressing NF-κB and MAPK activation.International Immunopharmacology,35:315-322.https://doi.org/10.1016/j.intimp.2016.04.013
Wu Haichong,Zhao Gan,Jiang Kangfeng,Chen Xiuying,Zhu Zhe,Qiu Changwei,Deng Ganzhen (2016) Puerarin Exerts an Antiinflammatory Effect by Inhibiting NF-kB and MAPK Activation in Staphylococcus aureus-Induced Mastitis. Phytotherapy research,30(10): 1658–1664.https://doi.org/10.1002/ptr.5666
Xu Dalian, Chen Maosheng, Ren Xianzhi, Ren Xianguo, Wu Yonggui (2014) leonurine ameliorates LPS-induced acute kidney injury via suppressing ROS-mediated NF-κB signaling pathway.Fitoterapia, 97:148–155.https://doi.org/10.1016/j.fitote.2014.06.005
Yang Jinyu, Xiang Daochun, Xiang Dong, He Wenxi, Liu Yanan, Lan Lulu, Li Guodong, Jiang Chen, Ren Xiuhua, Liu Dong, Zhang Chengliang (2020) Baicalin Protects Against 17α-Ethinylestradiol-Induced Cholestasis via the Sirtuin 1/Hepatic Nuclear Receptor-1α/Farnesoid X Receptor Pathway.Frontiers in Pharmacology,10:1685.https://doi.org/10.3389/fphar.2019.01685

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Leonurine exerts anti-inflammatory effects in LPS-induced endometritis by modulating the mouse JAK-STAT/PI3K-Akt/PPAR signalling pathway based on transcriptomic analysis

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Animals and housing

Reagents

Endometritis mouse model and experimental design

Analysis of cytokines

Transcriptomic testing and differential gene screening

Real-time quantitative RCR (qRT‒PCR) analysis

Statistical analysis

Results

Effects of leonurine on the levels of pro-inflammatory cytokines

Differential gene analysis

GO enrichment analysis of the DEGs

KEGG enrichment analysis of the DEGs

qRT-PCR to verify the expression of significantly different genes

Disussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1