Patient recruitment
In this case-control study, 72 patients with NAFLD (age range: 20– 50 years), 71 healthy controls, 80 patients with T2DM, and 77 healthy individuals as control were enrolled Controls were matched on age and ethnicity. The patients who their differential diagnosis was confirmed by a physician according to ultrasonography and biochemical test consequences were referred to the outpatient clinics of Tabriz University of Medical Sciences, Tabriz, Iran. The inclusion criteria for NAFLD patients were Iranian ancestry and unrelated, adults between 20 years and 50 years old, having body mass index (BMI) between 25 and 39 and any alcohol consumption. The exclusion criteria for controls were using medications, including metformin, corticosteroids, amiodarone, and/or valproate in the past 3 months, any history of acute and chronic liver diseases, viral hepatitis, hemochromatosis, Wilson disease, any autoimmune or endocrine disorders and having participated in weight loss diets for at least 3 months before the start of the screening process for this study. Diabetic type 2 patients were identified by an endocrinologist based on biochemical tests. The patients and control group were selected with age between 30 and 70 years old. They hadn’t type 1 diabetes disease and history of insulin injection. Control group also had no history of diabetic disease. Subjects provided written informed consent after a full explanation of the research outline. The study protocol was reviewed and approved by the Medical Ethics Committee of the Tabriz University of Medical Sciences.
Biochemical Measurements
Fasting serum glucose (FSG), total cholesterol (TC), high-density lipoprotein cholesterol (HDLC), triglycerides (TG), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) concentrations were checked using kits on the Abbott ALCYON 300 auto analyzer (Abbott Laboratories, Inc) after fasting for more than 10 hours. All of the biochemical parameters are listed in Table1.
DNA isolation and polymerase chain reaction (PCR)
Genomic DNA was extracted from whole blood by using salting-out method [24]. We selected one SNP in UCP2 gene from published literature and the Database of Single Nucleotide Polymorphism (dbSNP) at the NCBI website (http://www.ncbi.nlm.nih.gov/SNP). SNP genotyping was performed by PCR. DNA fragments related to 45-bp ins/del polymorphism were amplified by primers: 5ʹ- TTCTCCGCTTGGGTTCCTG -3ʹ as forward primer and 5ʹ- CACTGTCAAATGTCAACTCCACC -3ʹ as reverse primer. PCR primer sequences were designed using Gene Runner software (version 3.01), based on GenBank coding DNA reference sequence NG_011478, from the National Center for Biotechnology Information (NCBI) website https:// www.ncbi.nlm.nih.gov.
Statistical analysis
All statistical analyses were conducted by using the SPSS statistical package ver. 22 (SPSS Software, Chicago, IL, USA). The Distributions of categorical variables in groups compared using the chi-squared test. Kolmogorov-Smirnov and Shapiro–Wilk tests performed to determine the normal distribution of quantitative variables. We used t-test for comparing quantitative data between two groups that had normal distribution and Mann-Whitney test for data that had abnormal distribution. Odd Ratio calculated by logistic regression for genotypes and alleles that adjusted by gender and age. As well, evaluation of continuous variables changes between different UCP-2 genotypes was completed by analysis of covariance (ANCOVA) with modification effects of age and sex.