Pharmacological activation of aldehyde dehydrogenase 2 inhibits ferroptosis via SLC7A11/GPX4 axis to reduce kidney stone formation

doi:10.21203/rs.3.rs-3974531/v1

Download PDF

Research Article

Pharmacological activation of aldehyde dehydrogenase 2 inhibits ferroptosis via SLC7A11/GPX4 axis to reduce kidney stone formation

https://doi.org/10.21203/rs.3.rs-3974531/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Calcium oxalate (CaOx) kidney stones pose a global health challenge due to their high prevalence and recurrence rates. While cell death mechanisms such as ferroptosis are known to play a crucial role in stone formation, the precise underlying mechanisms remain enigmatic. Aldehyde dehydrogenase 2 (ALDH2) is a metabolic enzyme of the ferroptosis product 4-hydroxy-2-nonenal (4-HNE). However, the function of ALDH2 in kidney stones is poorly understood. In this study, ALDH2 expression was assessed in kidney tissues and HK-2 cells using immunohistochemistry and western blot. Renal histology and crystal deposition were visualized through hematoxylin-eosin and Von Kossa staining. The expression of crystal-related molecules and ferroptosis-associated molecules was quantified via qPCR, western blot and immunohistochemical staining. Commercial assay kits were utilized to quantify glutathione, lipid peroxidation and Fe²⁺, and the activity of glutathione peroxidase 4 (GPX4). Rescue experiments involving siRNA targeting Solute Carrier Family 7 Member 11 (SLC7A11) were conducted to explore functional implications. Our data showed significant reduction of ALDH2 in the stone group. Alda-1, an agonist of ALDH2, notably mitigated crystal deposition in the kidneys and hindered crystal adhesion to cells. Furthermore, Alda-1 induced an upregulation of SLC7A11 expression, stimulating glutathione synthesis, reducing lipid peroxidation accumulation, and lowering Fe²⁺ levels, collectively contributing to the attenuation of ferroptosis triggered by crystal stimulation. Notably, SLC7A11 siRNA experiments confirmed the role of SLC7A11 in Alda-1-mediated renoprotection. In conclusion, our study highlights the potential of targeting ALDH2 as a promising therapeutical strategy for urolithiasis.

ALDH2

Alda-1

Calcium oxalate stone

ferroptosis

Crystal adhesion

Kidney stones, a common disease in urology, have shown a significant increase in cases over recent decades, impacting approximately 10% of the global population[1–3]. Among these cases, about 80% of stones are composed of calcium oxalate[4] (CaOx). While advanced minimally invasive surgical techniques like shock wave lithotripsy, ureteroscopic lithotripsy, and percutaneous nephrolithotomy are available for stone removal, the risk of postoperative recurrence remains a concern[5]. Alarmingly, the recurrence rate stands at around 50% within five years after the initial stone occurrence [6]. This substantial incidence and recurrence frequency have imposed a considerable economic burden on society[7]. Consequently, it becomes imperative to comprehensively understand the pathophysiological mechanisms underlying stone formation to facilitate the development of innovative and precision therapeutic interventions.

During the pathological process of cell-crystal interaction, excess reactive oxygen species (ROS) are produced, which is mediated by matrix NADPH oxidase and mitochondrial respiratory chain[8]. These excess ROS trigger detrimental modifications in the cell membrane and organelle membrane, rich in polyunsaturated fatty acids, resulting in the formation of lipid peroxyl radicals and hydroperoxides. When the rate of lipid peroxidation reaches medium or high levels, the extent of oxidative damage exceeds the capacity for repair, thus initiating cell apoptosis or programmed death[9, 10]. Ferroptosis is a novel form of programmed cell death, characterized by an iron-dependent increase in lipid peroxides [11]. He Z et al.[12] and Song Q et al.[13] have substantiated the involvement of ferroptosis in the development of stone formation. Notably, Yang Y et al.[14] have discovered that CAV1, a scaffolding protein within caveolar membranes, can inhibit ferroptosis and reduce stone formation through the LRP6 / Wnt / β-Catenin axis. Furthermore, the ferroptosis inhibitor Ferrostatin-1 has shown the capability to mitigate cellular damage and reduce stone formation [15]. These researches underscore the inextricable connection between ferroptosis and urolithiasis.

Aldehyde dehydrogenase 2 (ALDH2), a member of the aldehyde dehydrogenase family, exhibits widespread distribution within organs such as the liver, kidney, brain, and heart[16]. ALDH2 is involved not only in the metabolism of aldehyde but also primarily metabolizes toxic aldehydes, notably 4-hydroxy-2-nonenal (4-HNE), reducing the production of ROS resulting from aldehyde accumulation. This action also shields cells from aldehyde-triggered damage to lipid membranes, ensuring cell integrity[17]. Its anti-oxidative stress properties have garnered notable attention from experts across various domains, including gastroenterology[18, 19], cardiovascular medicine[20] and neurology[21]. However, there is no relevant research reported in urolithiasis.

4-HNE, regulated by ALDH2, is also a major product of ferroptosis[22]. This suggests that ALDH2 may be involved in the formation of stone. To test this hypothesis, this study was conducted to explore the relationship between ALDH2 and stone formation. By focusing on ROS-induced lipid peroxidation-dependent ferroptosis, this study discusses the potential mechanism of the ALDH2-specific agonist Alda-1 in inhibiting the formation of renal calculi, aiming to provide a new target for stone treatment.

Expression of ALDH2 and its enzymatic activity decreased in stone group

Mounting evidences have proved that lipid peroxidation occurs in stone formation. However, it has not been reported whether 4-HNE, as another product of lipid peroxidation, participates in this process. The stone model was constructed by intraperitoneal injection of glyoxylic acid in C57BL/6 mice. Von Kossa staining was used to verify the success of the model construction (Fig. 1A). Immunohistochemical staining showed that 4-HNE increased in the kidney of the glyoxylate (Gly) group compared with the normal saline (NS) group (Fig. 1B), and 4-HNE also rose after Calcium Oxalate Monohydrate (COM) stimulation in vitro (Fig. 1C). It implicated that ALDH2, an enzyme that mainly metabolizes 4-HNE, may lost its function in the stone group. To prove our hypothesis, we collected renal tissue samples from patients with calculi in our hospital. The details have been described in the methods section. As shown in Table 1, there was no difference in gender, age and smoking status between the two groups. Immunohistochemistry showed that the expression of ALDH2 in stone patients decreased significantly compared to non-stone patients (Fig. 1D). Similarly, ALDH2 expression was also reduced in the Gly group (Fig. 1E). In addition, the protein expression and enzyme activity of ALDH2 decreased after COM stimulation in vitro (Fig. 1F, G).

Table 1

Baseline Characteristics of Participants
Parameter	Control Group (n = 14)	Stone Group (n = 14)	Total	P Value
Age, y, Mean (SD)	62.1 (9.4)	63.7 (10.4)	62.9 (9.7)	0.664¹
Sex, No. (%)				1.000²
Male	9 (64.3)	10 (71.4)	19 (67.9)
Female	5 (35.7)	4 (28.6)	9 (32.1)
Smoker, No. (%) No Yes	9 (64.3%) 5 (35.7)	7 (50.0%) 7 (50.0%)	16 (57.1%) 12 (42.9%)	0.704¹
¹ P Value for the Chi-Square Test. ² P Value for the Independent Sample T-Test.

Activated ALDH2 enzyme activity reduced COM crystal-induced cell injury and crystal adhesion in vitro

To verify whether the weakening of the ALDH2 is associated with the formation of kidney stones, we initially treated cells with ALDH2-specific agonist Alda-1. This intervention resulted in an increase in ALDH2 enzyme activity (Fig. 2A), conforming the effectiveness of Alda-1. Subsequently, Alda-1 pretreatment reduced the increase of COM-mediated 4-HNE (Fig. 2B). More importantly, Alda-1 treatment reversed the increase of COM-induced cell damage factors NGAL and KIM-1 at the transcriptional levels, and adhesion indicators OPN and CD44 were also controlled by Alda-1(Fig. 2C, D). CCK-8 assay indicated that 2mM COM inhibited cell activity by 40% (Fig. 2E). However, cell activity was improved by Alda-1 in a concentration-dependent manner. The mitochondrial membrane potential decreased due to COM-induced damage, causing the JC-1 probe to mainly exist in its monomeric form, emitting green fluorescence (Fig. 2F). Conversely, the JC-1 probe mainly existed in its aggregated form, emitting red fluorescence in the Control group. This change of mitochondrial membrane potential is a sign of early apoptosis. Specifically, the relative proportion of red and green fluorescence reversed in Alda-1 pretreatment group, indicating that Alda-1 reduced COM-induced apoptosis. The FITC antibody was combined with COM crystals (Fig. 2G), and the fluorescent particles were observed as COM crystals adhered to cell in the dark field. The number of adhered COM crystals was quantified by measuring the green fluorescence. In the Alda-1 pretreatment group, the green fluorescence decreased, indicating a reduction in COM crystals adhered to cells.

Activated ALDH2 enzyme activity reduced renal tubular injury and crystal deposition in vivo

To assess the protective effect of Alda-1, we conducted animal experiments using glyoxylate-induced kidney stone mice. Initially, we measured the content of oxidative stress product 4-HNE in the mice's kidneys. Consist with cell experiments, 4-HNE increased in the kidneys after glyoxylate injection (Fig. 3A). However, 4-HNE decreased in a concentration-dependent manner in Alda-1 group. The expression of the kidney injury molecule KIM-1 and the adhesion molecules OPN and CD44 improved as well (Fig. 3A). During the modeling period, body weight in normal saline group had a slight increased (Fig. 3B). Mice injected with glyoxylate exhibited emaciation. But there was no significant change in Alda-1 group. In addition, glyoxylate indcued severe hepatorenal toxicity (Fig. 3C). The renal function index urea nitrogen (BUN) in the glyoxylate group were significantly elevated, as was aspartate aminotransferase (AST). The treatment of Alda-1 decreased BUN and AST levels in mice, suggesting that Alda-1 may have a protective effect on liver and kidney function. HE and PAS staining were used to assess the degree of renal tubular injury (Fig. 3A). In the glyoxylate group, the renal tubular epithelium of mice became flattened, with some even detaching, leading to enlarged lumens and the formation of renal casts. In PAS staining, the brush border of the proximal renal tubules disappeared. Alda-1 pretreatment alleviated these symptoms. Furthermore, TUNEL staining indicated that glyoxylate induced a large amount of apoptosis in renal tubules (Fig. 3D), while the number of apoptotic cells decreased in the Alda-1 group. Von Kossa staining was used to detect the deposition of calcium oxalate in the kidneys, and the amount of crystal deposition decreased with the increase in Alda-1 concentration (Fig. 3E).

Alda-1 mitigated COM-induced ferroptosis

4-HNE is also a primary product of ferroptosis. The results showing that Alda-1 reduced the deposition of 4-HNE in the stone kidney suggest that Alda-1 may inhabit the formation of stones by regulating ferroptosis. To confirm this hypothesis, ROS, the content of Fe²⁺ and GSH, enzyme activity of GPX4 were measured. As expected, COM increased intracellular ROS and Fe²⁺ content, downregulated activity of the antioxidant enzyme GPX4, and consumed the antioxidant GSH (Fig. 4A-C). What’s more, lipid hydroperoxides, the primary product of lipid peroxidation, also increased in the COM group (Fig. 4C). These changes provided the necessary conditions for ferroptosis. Bodipy 581/591 C11 probe demonstrated lipid peroxidation of cell membrane polyunsaturated fatty acids. However, Alda-1 can alleviate the indicators mentioned above. More importantly, Erastin, a specific ferroptosis inducer, was used to reduce cell activity, while Alda-1 can reverse the decrease (Fig. 4D). Collectively, Alda-1 can protect cells from ferroptosis in vitro.

Alda-1 inhibits ferroptosis via SLC7A11-GPX4 axis

At present, there are four main pathways of ferroptosis, including the pathway mediating iron metabolism, the lipid metabolism pathway, the coenzyme Q10 (CoQ10) antioxidant pathway and the GPX4 antioxidant pathway. QPCR was used to detect the transcriptional levels of key genes. Only GPX4, responsible for transporting cystine, was consistent with changes in ferroptosis (Fig. 5A, B). To further confirm the role of Alda-1 in ferroptosis, siRNA was used to downregulate SLCA711 expression (Fig. 5C, D). After siRNA treatment, the expression of the damage molecules NGAL was reversed. Similarly, the adhesion indicators OPN and CD44 were also increased (Fig. 5E). Cell adhesion assay demonstrated that Alda-1 decreased the amount of crystal adhesion, but its anti-adhesion effect was reduced after siRNA treatment (Fig. 5F). These results suggest that Alda-1 may regulate ferroptosis through SLC7A11-GPX4 pathway.

There are many pathogenic factors related to stone formation, including oxidative stress, immune response, inflammatory cascade reaction, etc[23]. Among these factors, oxidative stress is recognized as a pivotal trigger in stone formation. Under normal conditions, the presence of antioxidant enzymes like superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx), alongside non-enzymatic antioxidants (such as vitamins A/C/E, coenzyme Q10, flavonoids, selenium, and zinc), collectively counteract free radicals and mitigate oxidative stress[11]. When ROS, such as superoxide (O₂⁻) and hydrogen peroxide (H₂O₂), are produced, SOD rapidly reduces O₂⁻ to H₂O₂, and then GPx protects cells from ROS damage by converting H₂O₂ into water[24]. However, drastic alterations in the tubular microenvironment lead to excessive ROS production due to urinary salt oversaturation. Enhanced oxidative stress-driven tissue injury amplifies the retention of causative crystals within renal tubules, which is a crucial step in kidney stone formation[25, 26]. To address these issues, apart from altering urine supersaturation levels, enhancing antioxidant capacity and mitigating oxidative stress provide an alternative approach. Currently, various antioxidants or free radical scavengers[27, 28], plant flavonoids[29, 30] have been shown to be therapeutic strategies to prevent the formation of kidney stones. However, clinical implementation remains limited. This study specifically focuses on the oxidative stress-lipid peroxidation-ferroptosis axis. Notably, we identified a significant decrease in ALDH2 protein expression and enzymatic activity within stone formation. This discovery serves as a foundation for further investigations into the relationship between ALDH2 and stones.

ALDH2 stands as a pivotal aldehyde-metabolizing enzyme within mitochondria. Beyond processing intracellular acetaldehyde, it regulates diverse short-chain aliphatic aldehydes, 4-hydroxynonenal (4-HNE), and aromatic aldehydes[17]. The emergence of 4-HNE, a product of ROS-modified arachidonic acid and polyunsaturated fatty acids, leads to interactions with DNA, proteins, and other macromolecules, subsequently affecting cellular function [31]. Importantly, clinical investigations have revealed elevated plasma 4-HNE levels in congestive heart failure patients, which inversely correlate with left ventricular contractility[32]. Furthermore, heightened levels of 4-HNE have been linked to enlarged myocardial infarction areas [33, 34], and elevated levels have been observed in renal ischemia-reperfusion injuries [35]. Our study not only unveiled the accumulation of 4-HNE following COM stimulation or crystal deposition, but also noted the reduced expression and activity of ALDH2 within the stone group. A promising small molecule, Alda-1, capable of enhancing ALDH2 activity and reducing cytotoxic aldehyde formation, was identified by Chen CH et al. through high-throughput screening [33, 36]. Impressively sensitive and specific, Alda-1 exhibits potential for activating ALDH2. Remarkably, the use of Alda-1 resulted in reduced adhesion of COM crystals to cells and decreased glyoxylic acid-induced CaOX crystal deposition in kidneys. Normal epithelial cells exhibit resistance to crystal adhesion. However, when the tight junctions of epithelial cells are disrupted, adhesion molecules from the basement membrane (CD44 and OPN) translocate to the cell surface to facilitate crystal adhesion. The CCK-8 assay results showed the detrimental impact of COM crystals on renal epithelial cells, with a concentration-dependent effect. The stimulation of COM induced oxidative stress, characterized by the depletion of endogenous antioxidants and an excessive production of ROS beyond cellular regulation. Mitochondria are the main source of ROS, and scavenging ROS to stabilize mitochondrial function is a powerful strategy against oxidative stress. Following Alda-1 treatment, intracellular ROS were reduced, and the decrease in mitochondrial membrane potential was partially restored, affirming Alda-1's pivotal role in safeguarding against stone formation by modulating oxidative stress within the mitochondria. Besides mitochondria, NADPH oxidase is also a source of ROS in the kidney[37]. NADPH oxidase activity is regulated by angiotensin. Telmisartan, a highly selective angiotensin II type 1 receptor blocker (ARB), has been shown to protect HK2 cells from oxalate-induced oxidative stress injury[38]. Moreover, Koda K et al. have demonstrated that ALDH2 activation mitigates reperfusion arrhythmias by inhibiting renin release from mast cells[39]. Therefore, further investigation is warranted to determine whether Alda-1 can reduce oxidative stress injury by inhibiting the release of renin-angiotensin.

Ferroptosis, originally proposed by Dixon et al[40] in 2012, is a non-apoptotic form of cell death characterized by the intracellular accumulation of ferrous iron, which leads to toxic lipid peroxidation. Ferroptosis can be defined as a distinctive manifestation of oxidative stress[22]. High concentrations of CaOx crystals have been observed to induce ferroptosis in HK2 cells[12]. Similarly, oxalate exposure can trigger autophagy, contributing to autophagy-mediated ferroptosis. Mechanistically, the key molecule of autophagy, BECN1, can bind to SLC7A11 to form the BECN1-SLC7A11 complex, which suppresses system Xc(-) activity, subsequently reducing intracellular cysteine levels and glutathione synthesis. This cascade leads to the initiation of glutathione-dependent ferroptosis[13, 41]. In this study, COM stimulation led to a decline in SLC7A11 expression, GSH depletion, and attenuation of GPX4 function, thus setting the stage for potential ferroptosis. Intriguingly, Alda-1 treatment unexpectedly elevated SLC7A11 expression, implying a potential anti-ferroptotic role of Alda-1 via the SLC7A11 pathway. To dissect the underlying mechanisms of Alda-1, we used siRNA to down-regulate SLC7A11 expression, effectively nullifying the ferroptosis resistance conferred by Alda-1. This outcome conclusively confirmed that Alda-1's inhibition of ferroptosis is mediated through the SLC7A11-GPX4 axis. Although our experiments did not directly demonstrate molecular interactions, previous findings have indicated that ALDH2 can modulate BECN1 phosphorylation[42, 43]. Notably, phosphorylated BECN1 can bind to SLC7A11, impeding system Xc(-) activity[44]. Consequently, it is noteworthy to explore the potential of ALDH2 to hinder ferroptosis by regulating BECN1-mediated autophagy, which represents a promising approach warranting thorough investigation.

This research mainly investigated the formation of stones from the perspective of oxidative stress-lipid peroxidation-ferroptosis, revealing ALDH2's regulatory role in these processes. These findings offer promising avenues for novel pharmaceutical developments in stone treatment. Nonetheless, several limitations are inherent in this experiment. Firstly, it relied solely on the ALDH2 agonist Alda-1 for unilateral validation, lacking corresponding experiments involving ALDH2 knockout to establish a comprehensive association between ALDH2 and urolithiasis. Secondly, the sample size of patient tissues was relatively limited, potentially introducing selection bias. Consequently, further comprehensive research is essential to confirm these findings.

Clinical specimens

All specimens were procured from individuals who underwent radical renal resection at the Second Hospital of Tianjin Medical University. Tissues categorized in the calcium oxalate stone group were extracted from adjacent non-tumorous renal tissues of patients diagnosed with renal cell carcinoma and ipsilateral renal calcium oxalate stones. Tissues categorized in the control group were extracted from adjacent normal kidney tissues of patients solely diagnosed with renal cell carcinoma. Ethical guidelines were strictly followed throughout the study. All patients were provided with comprehensive information about the study and voluntarily signed the informed consent form. The research was conducted in adherence to The Code of Ethics of the World Medical Association and was approved by the Ethics Committee of the Second Hospital of Tianjin Medical University (Approval No. KY2020K088).

Cell culture

In this study, the human proximal tubular cell line HK-2 (obtained from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was utilized. The cells were cultured in a cell culture incubator at 37°C with 5% CO₂, using Dulbecco's Modified Eagle Medium: F-12 (DMEM/F-12) supplemented with 10% fetal bovine serum (FBS), streptomycin (100 µg/mL), and penicillin (100 µg/mL). To elucidate the impact of ALDH2 in Calcium Oxalate Monohydrate (COM)-treated cells, HK-2 cells were pretreated with Alda-1 (10 mM, MCE) for 30 minutes, followed by exposure to COM (2 mM). Cells were cultured for 48 hours, with a 24-hour intervention period, before being harvested for subsequent experimental procedures.

Animal experiments

The animal experimental procedures were granted ethical approval by the Animal Care Committee of the Second Hospital of Tianjin Medical University. A total of 20 male C57BL/6 mice (8 weeks old) were procured from Charles River Laboratories (Beijing, China). All mice had free access to water and were fed standard chow. Following a one-week adaptation period, the mice were randomly divided into four groups: the normal saline (NS) group, the glyoxylate (Gly) group, the Gly + low-dose Alda-1 group, and the Gly + high-dose Alda-1 group. Specifically, the NS group was intraperitoneally administered physiological saline, while the Gly group received intraperitoneal injections of glyoxylate acid (100 mg/kg). The mice in the Gly + Alda-1 groups were subjected to intraperitoneal injections of glyoxylate acid combined with either 5 mg/kg or 10 mg/kg Alda-1 pretreatment, respectively. This injection regimen was carried out once daily for a duration of 7 days. Following the 7-day intervention, retro-orbital blood samples were collected, and the supernatant was frozen at -80°C for subsequent analyses after centrifugation. Subsequently, all mice were euthanized, and their two kidneys were fixed in paraformaldehyde for further assessments.

Renal histology

The paraffin-embedded tissue sections were stained with hematoxylin-eosin (HE) and periodic acid Schiff (PAS) to evaluate the renal morphology and renal tubular damage. Calcium crystals deposition in kidneys were detected by Von Kossa staining (Abcam, UK). Apoptosis in mice kidney tissues was evaluated by the TUNEL staining (Beyotime, China). Immunohistochemistry (IHC) staining was conducted to observed the expression of 4-HNE (1:150, Abcam, UK), ALDH2 (1:100, Zenbio, China), CD44 (1:200, Abcam, UK), OPN (1:200, Abcam, UK), Kim-1 (1:150, Abcam, UK). All stained sections were observed using a polarizing microscope (Thermo, USA). Four fields of each section at different sites were randomly selected to quantify positive area by Image J.

Measurements of lipid peroxidation

Lipid peroxidation assessment involved the quantification of 4-hydroxynonenal (4-HNE), lipid hydroperoxide (LPO), and BODIPY (581/591) C11. Notably, 4-HNE, a stable oxidative stress marker, is a recognized by-product of lipid peroxidation and serves as a substrate for ALDH2[9, 45]. The concentration of 4-HNE was quantified using the Lipid peroxidation (4-HNE) assay kit (Abcam, UK). The primary product of lipid peroxidation, lipid hydroperoxide, was measured using Abcam's Lipid Hydroperoxide (LPO) Assay Kit. Additionally, membrane lipid peroxides were visually detected using BODIPY (581/591) C11 (Thermo, USA).

Measurements of ALDH2 activity

ALDH2 is located in the cell mitochondria, so we first used the cell mitochondria isolation kit (Beyotime, China) to collect the mitochondria protein. Protein concentrations were determined using Bradford protein assay with bovine serum albumin (BSA) as a standard. Then the ALDH test kit (Solarbio, China) was used to detect ALDH activity according to the instructions.

Crystal adhesion assay

To semi-quantify the attachment of COM crystals to HK-2 cells, a combination of FITC (1:100, Solarbio, China) and COM was prepared in phosphate-buffered saline (PBS) and incubated at room temperature for 6 hours with agitation. The mixture was then added to a six-well plate containing cells and incubated for an additional 24 hours, with or without pretreatment using Alda-1 (20µM, MCE) for 30 minutes. Following a 30-minute fixation of the cells using paraformaldehyde, multiple washes with PBS were conducted to remove unbound crystals. Subsequently, nuclear staining was achieved using 4',6-diamidino-2-phenylindole (DAPI, 1:100, Solarbio, China), and images were captured using a fluorescence confocal microscope. The fluorescence signal was quantified using Image J.

Cell viability assay

HK-2 cells were seeded in 96-well plates at a density of 3×10³ cells/well. Following a 24-hour incubation, cells were exposed to varying concentrations of COM in the cell culture medium. After this period, 10% CCK-8 solution was added and further incubated for 2 hours at room temperature. Subsequently, absorbance was measured at 450nm using a microplate reader (Thermo Fisher Scientific, USA). To assess the role of Alda-1, optimal COM concentrations were selected for stimulation, followed by the application of distinct concentrations of Alda-1 for pretreatment.

Mitochondrial membrane potentials assay

JC-1 probe (Beyotime, China) was used to measure mitochondrial depolarization in treated HK-2 cells. Briefly, 1µM JC-1 dye was added in treated samples (3×10⁴cells). After incubation for 30min at 37℃, the image was observed under a fluorescence microscope with red and green fluorescence.

Detection of animal biochemical indicators

Mice serum of blood urea nitrogen (BUN), serum creatinine (Scr), glutamic-oxalacetic transaminase (AST) and glutamic pyruvic transaminase (ALT) were measured by commercial kits. (Nanjing Jiancheng Bioengineering Institute, China).

ROS detection

The treated cells were incubated with DCFH-DA (10uM, Solarbio, China), a ROS probe, for 30 min at 37℃ and observed by a fluorescent microscopy. Image J was used to semi-quantify the fluorescence intensity of ROS.

Determination of Fe²⁺ and GSH content

The iron assay kit (Abcam, UK) was used to detect intracellular ferrous iron level (Fe²⁺). GSH content was measured by GSH Detection Assay Kit (Abcam, UK). All procedures were performed according to the protocol.

GPX4 activity assay

HT Glutathione Peroxidase Assay Kit (R&D Systems, USA) was used to determine the activity of GPX4. GPX4 catalyzed the oxidation of GSH to GSSG, which was then recycled back to GSH by glutathione reductase using NADPH as a reductant. As NADPH was oxidized to NADP + during this process, the reduction in NADPH absorbance measured at 340 nm corresponded to GPX4 activity, thus serving as an indicator of its activity

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from treated cells using TRIzol reagent (Invitrogen, USA) and reverse-transcribed into cDNA using the PrimeScript® RT reagent kit (Takara Biotechnology, Japan). Real-time quantitative polymerase chain reaction was performed using the SYBR Green system (Applied Biosystems, USA) in an ABI Prism 7300 system (Thermo, USA). Primer sequences were shown in Table 2. The mRNA expression in all genes was normalized to the expression of GAPDH.

Table 2

Primer sequences
Primer Name	Sequences
GAPDH	Forward	CGGAGTCAACGGATTTGGTC
	Reverse	TTCCCGTTCTCAGCCTTGAC
Kim-1	Forward	TGGCAGATTCTGTAGCTGGTT
	Reverse	AGAGAACATGAGCCTCTATTCCA
NGAL	Forward	GAAGTGTGACTACTGGATCAGGA
	Reverse	ACCACTCGGACGAGGTAACT
CD44	Forward	CTGCCGCTTTGCAGGTGTA
	Reverse	CATTGTGGGCAAGGTGCTATT
OPN	Forward	CTCCATTGACTCGAACGACTC
	Reverse	CAGGTCTGCGAAACTTCTTAGAT
SLC7A11	Forward	TCTCCAAAGGAGGTTACCTGC
	Reverse	AGACTCCCCTCAGTAAAGTGAC
NCOA4	Forward	ACAGTTGCATAAGCCGTCACC
AIFM2 ACSL4	Reverse Forward Reverse Forward Reverse	TGAGCCTGCTGTTGAAGTGTC GTGAGCGGGTGAGCAATCT CTTGATGCCGGTGCAGAGAA CATCCCTGGAGCAGATACTCT TCACTTAGGATTTCCCTGGTCC
SLC7A11#1	Sence	CCUACUUUACGACCAUUAATT
	Antisence	UUAAUGGUCGUAAAGUAGGTT
SLC7A11#2	Sence	CCUCUAUUCGGACCCAUUUTT
SLC7A11#3 siNC	Antisence Sence Antisence Sence Antisence	AAAUGGGUCCGAAUAGAGGTT CCAGGUGGUUUAGAAUAAUTT AUUAUUCUAAACCACCUGGTT UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

Western blotting

Treated HK-2 cells were lysed using RIPA buffer, and extracted protein was quantified by Bradford protein assay. Equivalent (30 ug) proteins were separated by 10–12% SDS-PAGE gel and transferred to PVDF membranes. After blocking with 5% skim milk for 1h, the membranes were incubated overnight at 4℃ with primary antibodies targeting ALDH2 (1:1000, Zenbio, China), CD44 (1:2000, Abcam, UK), OPN (1:1000, Abcam, UK), NGAL (1:3000, Thermo, USA), SLC7A11 (1:1000, Thermo, USA), GPX4 (1:2000, Abcam, UK). The membranes were incubated with secondary antibodies for 1h at room temperature. The protein bands were visualized by electrochemiluminescence reagent (Thermo, USA). Image J was used to analyze the densitometric band intensities.

Cell transfection

Small interfering RNA (siRNA) targeting SLC7A11 (si-SLC7A11#1, si-SLC7A11#2, si-SLC7A11#3) and negative control (si-NC) were synthesized by GenePharma. Primer sequences were shown in Table 2. HK-2 cells were seeded in a 6-well plate at 2×10⁵ cells per well and transfected with designed siRNA using Lipo 2000TM transfection reagent based on the instructions in the manufacturer’s protocol.

Statistical analysis

All experiments were conducted independently three times at various time points, and the experimental data were presented as mean ± standard error. Gender and other categorical variables were depicted as ratios. Independent sample t-tests were employed to analyze quantitative data between two groups. One-way ANOVA was utilized to compare the overall means among multiple groups. The chi-square test was applied to assess the rate differences between the two groups. Statistical analysis was performed using SPSS version 26.0 for Windows. A significance level of P < 0.05 was considered statistically significant.

In summary, we have confirmed that pharmacological activation of ALDH2 by Alda-1 inhibited crystal-associated ferroptosis by modulating the SLC7A11-GPX4 signaling pathway. This study provided a better insight into the role of aldehydes in the pathogenesis of urolithiasis and implicated ALDH2 as a potential therapeutical target of stones.

Funding

This research was supported by grants from Clinical Medical Research Project of the Second Hospital of Tianjin Medical University (2023LC01), Tianjin Institute of Urology Talent Funding Project (MYSRC202313), and The Fund of The Second Hospital of Tianjin Medical University (2023ZDSYS03 and 2022ydey04).

Conflicts of Interest

The authors declare no conflict of interest.

Author Contributions

Conceptualization: J.Z. and C.L.; methodology: R.W.; validation: L.X. and H.R.; formal analysis: D.L. and Y.Y.; investigation: J.Z. and R.W.; resources: Z.S. and H.X.; data curation: R.W.; writing—original draft preparation: J.Z.; writing—review and editing: J.Z., R.W., L.X., H.R. and D.L.; visualization: Y.Y.; supervision: J.Z., R.W., Z.S. and C.L.; project administration: J.Z.; funding acquisition: Z.S. and C.L. All authors have read and agreed to the published version of the manuscript.

Data availability

Data will be made available on request.

Ethics approval

The research was conducted in adherence to The Code of Ethics of the World Medical Association and was approved by the Ethics Committee of the Second Hospital of Tianjin Medical University (Approval No. KY2020K088).

Consent to participate

Informed consent was obtained from all subjects involved in the study.

Consent to publish

The authors affirm that human research participants provided informed consent for publication of the images in Figure 1D.

Acknowledgements None.

Sorokin I, Mamoulakis C, Miyazawa K, Rodgers A, Talati J, Lotan Y (2017) Epidemiology of stone disease across the world. World J Urol 35:1301–1320. https://doi.org/10.1007/s00345-017-2008-6
Singh P, Harris PC, Sas DJ, Lieske JC (2022) The genetics of kidney stone disease and nephrocalcinosis. Nat Rev Nephrol 18:224–240. https://doi.org/10.1038/s41581-021-00513-4
Peerapen P, Thongboonkerd V (2023) Kidney Stone Prevention. Adv Nutr 14:555–569. https://doi.org/10.1016/j.advnut.2023.03.002
Grant C, Guzman G, Stainback RP, Amdur RL, Mufarrij P (2018) Variation in Kidney Stone Composition Within the United States. J Endourol 32:973–977. https://doi.org/10.1089/end.2018.0304
Rule AD, Lieske JC, Pais VM Jr. (2020) Management of Kidney Stones in 2020. JAMA 323:1961–1962. https://doi.org/10.1001/jama.2020.0662
Siener R (2021) Nutrition and Kidney Stone Disease. Nutrients 13. https://doi.org/10.3390/nu13061917
Thongprayoon C, Krambeck AE, Rule AD (2020) Determining the true burden of kidney stone disease. Nat Rev Nephrol 16:736–746. https://doi.org/10.1038/s41581-020-0320-7
Xu Z, Yao X, Duan C, Liu H, Xu H (2023) Metabolic changes in kidney stone disease. Front Immunol 14:1142207. https://doi.org/10.3389/fimmu.2023.1142207
Gęgotek A, Skrzydlewska E (2019) Biological effect of protein modifications by lipid peroxidation products. Chem Phys Lipids 221:46–52. https://doi.org/10.1016/j.chemphyslip.2019.03.011
Jiang X, Stockwell BR, Conrad M (2021) Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol 22:266–282. https://doi.org/10.1038/s41580-020-00324-8
Su LJ, Zhang JH, Gomez H, Murugan R, Hong X, Xu D, Jiang F, Peng ZY (2019) Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxid Med Cell Longev 2019:5080843. https://doi.org/10.1155/2019/5080843
He Z, Liao W, Song Q, Li B, Liu J, Xiong Y, Song C, Yang S (2021) Role of ferroptosis induced by a high concentration of calcium oxalate in the formation and development of urolithiasis. Int J Mol Med 47:289–301. https://doi.org/10.3892/ijmm.2020.4770
Song Q, Liao W, Chen X, He Z, Li D, Li B, Liu J, Liu L, Xiong Y, Song C, Yang S (2021) Oxalate Activates Autophagy to Induce Ferroptosis of Renal Tubular Epithelial Cells and Participates in the Formation of Kidney Stones. Oxid Med Cell Longev 2021:6630343. https://doi.org/10.1155/2021/6630343
Yang Y, Hong S, Lu Y, Wang Q, Wang S, Xun Y (2022) CAV1 alleviated CaOx stones formation via suppressing autophagy-dependent ferroptosis. PeerJ 10:e14033. https://doi.org/10.7717/peerj.14033
Xie J, Ye Z, Li L, Xia Y, Yuan R, Ruan Y, Zhou X (2022) Ferrostatin–1 alleviates oxalate–induced renal tubular epithelial cell injury, fibrosis and calcium oxalate stone formation by inhibiting ferroptosis. Mol Med Rep 26. https://doi.org/10.3892/mmr.2022.12772
Panisello-Roselló A, Lopez A, Folch-Puy E, Carbonell T, Rolo A, Palmeira C, Adam R, Net M, Roselló-Catafau J (2018) Role of aldehyde dehydrogenase 2 in ischemia reperfusion injury: An update. World J Gastroenterol 24:2984–2994. https://doi.org/10.3748/wjg.v24.i27.2984
Chen CH, Ferreira JC, Gross ER, Mochly-Rosen D (2014) Targeting aldehyde dehydrogenase 2: new therapeutic opportunities. Physiol Rev 94:1–34. https://doi.org/10.1152/physrev.00017.2013
Seo W, Gao Y, He Y, Sun J, Xu H, Feng D, Park SH, Cho YE, Guillot A, Ren T, Wu R, Wang J, Kim SJ, Hwang S, Liangpunsakul S, Yang Y, Niu J, Gao B (2019) ALDH2 deficiency promotes alcohol-associated liver cancer by activating oncogenic pathways via oxidized DNA-enriched extracellular vesicles. J Hepatol 71:1000–1011. https://doi.org/10.1016/j.jhep.2019.06.018
Yokoyama A, Taniki N, Nakamoto N, Tomita K, Hara S, Mizukami T, Maruyama K, Yokoyama T (2020) Associations among liver disease, serum lipid profile, body mass index, ketonuria, meal skipping, and the alcohol dehydrogenase-1B and aldehyde dehydrogenase-2 genotypes in Japanese men with alcohol dependence. Hepatol Res 50:565–577. https://doi.org/10.1111/hepr.13475
Zhang J, Guo Y, Zhao X, Pang J, Pan C, Wang J, Wei S, Yu X, Zhang C, Chen Y, Yin H, Xu F (2023) The role of aldehyde dehydrogenase 2 in cardiovascular disease. Nat Rev Cardiol 20:495–509. https://doi.org/10.1038/s41569-023-00839-5
Chen J, Huang W, Cheng CH, Zhou L, Jiang GB, Hu YY (2019) Association Between Aldehyde dehydrogenase-2 Polymorphisms and Risk of Alzheimer's Disease and Parkinson's Disease: A Meta-Analysis Based on 5,315 Individuals. Front Neurol 10:290. https://doi.org/10.3389/fneur.2019.00290
Zhu J, Xiong Y, Zhang Y, Wen J, Cai N, Cheng K, Liang H, Zhang W (2020) The Molecular Mechanisms of Regulating Oxidative Stress-Induced Ferroptosis and Therapeutic Strategy in Tumors. Oxid Med Cell Longev 2020:8810785. https://doi.org/10.1155/2020/8810785
Khan SR, Canales BK, Dominguez-Gutierrez PR (2021) Randall's plaque and calcium oxalate stone formation: role for immunity and inflammation. Nat Rev Nephrol 17:417–433. https://doi.org/10.1038/s41581-020-00392-1
van der Pol A, van Gilst WH, Voors AA, van der Meer P (2019) Treating oxidative stress in heart failure: past, present and future. Eur J Heart Fail 21:425–435. https://doi.org/10.1002/ejhf.1320
Chaiyarit S, Thongboonkerd V (2020) Mitochondrial Dysfunction and Kidney Stone Disease. Front Physiol 11:566506. https://doi.org/10.3389/fphys.2020.566506
Albert A, Paul E, Rajakumar S, Saso L (2020) Oxidative stress and endoplasmic stress in calcium oxalate stone disease: the chicken or the egg? Free Radic Res 54:244–253. https://doi.org/10.1080/10715762.2020.1751835
Ye T, Yang X, Liu H, Lv P, Lu H, Jiang K, Peng E, Ye Z, Chen Z, Tang K (2021) Theaflavin protects against oxalate calcium-induced kidney oxidative stress injury via upregulation of SIRT1. Int J Biol Sci 17:1050–1060. https://doi.org/10.7150/ijbs.57160
Zhu J, Wang Q, Li C, Lu Y, Hu H, Qin B, Xun Y, Zhu Y, Wu Y, Zhang J, Wang S (2019) Inhibiting inflammation and modulating oxidative stress in oxalate-induced nephrolithiasis with the Nrf2 activator dimethyl fumarate. Free Radic Biol Med 134:9–22. https://doi.org/10.1016/j.freeradbiomed.2018.12.033
Zeng X, Xi Y, Jiang W (2019) Protective roles of flavonoids and flavonoid-rich plant extracts against urolithiasis: A review. Crit Rev Food Sci Nutr 59:2125–2135. https://doi.org/10.1080/10408398.2018.1439880
Yuan P, Sun X, Liu X, Hutterer G, Pummer K, Hager B, Ye Z, Chen Z (2021) Kaempferol alleviates calcium oxalate crystal-induced renal injury and crystal deposition via regulation of the AR/NOX2 signaling pathway. Phytomedicine 86:153555. https://doi.org/10.1016/j.phymed.2021.153555
Li Y, Zhao T, Li J, Xia M, Li Y, Wang X, Liu C, Zheng T, Chen R, Kan D, Xie Y, Song J, Feng Y, Yu T, Sun P (2022) Oxidative Stress and 4-hydroxy-2-nonenal (4-HNE): Implications in the Pathogenesis and Treatment of Aging-related Diseases. J Immunol Res 2022:2233906. https://doi.org/10.1155/2022/2233906
Daiber A, Hahad O, Andreadou I, Steven S, Daub S, Münzel T (2021) Redox-related biomarkers in human cardiovascular disease - classical footprints and beyond. Redox Biol 42:101875. https://doi.org/10.1016/j.redox.2021.101875
Chen CH, Budas GR, Churchill EN, Disatnik MH, Hurley TD, Mochly-Rosen D (2008) Activation of aldehyde dehydrogenase-2 reduces ischemic damage to the heart. Science 321:1493–1495. https://doi.org/10.1126/science.1158554
Zhou T, Wang X, Wang K, Lin Y, Meng Z, Lan Q, Jiang Z, Chen J, Lin Y, Liu X, Lin H, Wu S, Lin D (2023) Activation of aldehyde dehydrogenase-2 improves ischemic random skin flap survival in rats. Front Immunol 14:1127610. https://doi.org/10.3389/fimmu.2023.1127610
Lin D, Xiang T, Qiu Q, Leung J, Xu J, Zhou W, Hu Q, Lan J, Liu Z, Zhong Z, Wang Y, Ye Q (2020) Aldehyde dehydrogenase 2 regulates autophagy via the Akt-mTOR pathway to mitigate renal ischemia-reperfusion injury in hypothermic machine perfusion. Life Sci 253:117705. https://doi.org/10.1016/j.lfs.2020.117705
Zhong W, Zhang W, Li Q, Xie G, Sun Q, Sun X, Tan X, Sun X, Jia W, Zhou Z (2015) Pharmacological activation of aldehyde dehydrogenase 2 by Alda-1 reverses alcohol-induced hepatic steatosis and cell death in mice. J Hepatol 62:1375–1381. https://doi.org/10.1016/j.jhep.2014.12.022
Yan LJ, Allen DC (2021) Cadmium-Induced Kidney Injury: Oxidative Damage as a Unifying Mechanism. Biomolecules 11. https://doi.org/10.3390/biom11111575
Liu Y, Chen S, Liu J, Jin Y, Yu S, An R (2020) Telmisartan inhibits oxalate and calcium oxalate crystal-induced epithelial-mesenchymal transformation via PPAR-γ-AKT/STAT3/p38 MAPK-Snail pathway. Life Sci 241:117108. https://doi.org/10.1016/j.lfs.2019.117108
Koda K, Salazar-Rodriguez M, Corti F, Chan NY, Estephan R, Silver RB, Mochly-Rosen D, Levi R (2010) Aldehyde dehydrogenase activation prevents reperfusion arrhythmias by inhibiting local renin release from cardiac mast cells. Circulation 122:771–781. https://doi.org/10.1161/circulationaha.110.952481
Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B, Stockwell BR (2012) Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149:1060–1072. https://doi.org/10.1016/j.cell.2012.03.042
Liu R, Li X, Zhao G (2019) Beclin1-mediated ferroptosis activation is associated with isoflurane-induced toxicity in SH-SY5Y neuroblastoma cells. Acta Biochim Biophys Sin (Shanghai) 51:1134–1141. https://doi.org/10.1093/abbs/gmz104
Shen C, Wang C, Fan F, Yang Z, Cao Q, Liu X, Sun X, Zhao X, Wang P, Ma X, Zhu H, Dong Z, Zou Y, Hu K, Sun A, Ge J (2015) Acetaldehyde dehydrogenase 2 (ALDH2) deficiency exacerbates pressure overload-induced cardiac dysfunction by inhibiting Beclin-1 dependent autophagy pathway. Biochim Biophys Acta 1852:310–318. https://doi.org/10.1016/j.bbadis.2014.07.014
Liu Z, Ye S, Zhong X, Wang W, Lai CH, Yang W, Yue P, Luo J, Huang X, Zhong Z, Xiong Y, Fan X, Li L, Wang Y, Ye Q (2020) Pretreatment with the ALDH2 activator Alda–1 protects rat livers from ischemia/reperfusion injury by inducing autophagy. Mol Med Rep 22:2373–2385. https://doi.org/10.3892/mmr.2020.11312
Song X, Zhu S, Chen P, Hou W, Wen Q, Liu J, Xie Y, Liu J, Klionsky DJ, Kroemer G, Lotze MT, Zeh HJ, Kang R, Tang D (2018) AMPK-Mediated BECN1 Phosphorylation Promotes Ferroptosis by Directly Blocking System X(c)(-) Activity. Curr Biol 28:2388–2399e5. https://doi.org/10.1016/j.cub.2018.05.094
Ayala A, Muñoz MF, Argüelles S (2014) Lipid peroxidation: production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid Med Cell Longev 2014:360438. https://doi.org/10.1155/2014/360438

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Pharmacological activation of aldehyde dehydrogenase 2 inhibits ferroptosis via SLC7A11/GPX4 axis to reduce kidney stone formation

Status:

Version 1

Abstract

Figures

Introduction

Results

Expression of ALDH2 and its enzymatic activity decreased in stone group

Activated ALDH2 enzyme activity reduced COM crystal-induced cell injury and crystal adhesion in vitro

Activated ALDH2 enzyme activity reduced renal tubular injury and crystal deposition in vivo

Alda-1 mitigated COM-induced ferroptosis

Alda-1 inhibits ferroptosis via SLC7A11-GPX4 axis

Discussion

Materials and methods

Clinical specimens

Cell culture

Animal experiments

Renal histology

Measurements of lipid peroxidation

Measurements of ALDH2 activity

Crystal adhesion assay

Cell viability assay

Mitochondrial membrane potentials assay

Detection of animal biochemical indicators

ROS detection

Determination of Fe²⁺ and GSH content

GPX4 activity assay

Quantitative real-time PCR (qRT-PCR)

Western blotting

Cell transfection

Statistical analysis

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Pharmacological activation of aldehyde dehydrogenase 2 inhibits ferroptosis via SLC7A11/GPX4 axis to reduce kidney stone formation

Status:

Version 1

Abstract

Figures

Introduction

Results

Expression of ALDH2 and its enzymatic activity decreased in stone group

Activated ALDH2 enzyme activity reduced COM crystal-induced cell injury and crystal adhesion in vitro

Activated ALDH2 enzyme activity reduced renal tubular injury and crystal deposition in vivo

Alda-1 mitigated COM-induced ferroptosis

Alda-1 inhibits ferroptosis via SLC7A11-GPX4 axis

Discussion

Materials and methods

Clinical specimens

Cell culture

Animal experiments

Renal histology

Measurements of lipid peroxidation

Measurements of ALDH2 activity

Crystal adhesion assay

Cell viability assay

Mitochondrial membrane potentials assay

Detection of animal biochemical indicators

ROS detection

Determination of Fe2+ and GSH content

GPX4 activity assay

Quantitative real-time PCR (qRT-PCR)

Western blotting

Cell transfection

Statistical analysis

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Determination of Fe²⁺ and GSH content