Loss of smad7 promoted the stromal-myofibroblast transition of endometrium via autophagy

doi:10.21203/rs.3.rs-3975154/v1

Download PDF

Article

Loss of smad7 promoted the stromal-myofibroblast transition of endometrium via autophagy

https://doi.org/10.21203/rs.3.rs-3975154/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Abnormal autophagy and TGFβ-SMAD3/7 signaling pathway plays an important role in intrauterine adhesions (IUA); however, the exact underlying mechanisms remain unclear. In this study, we aimed to detect whether SMAD7 effected IUA via regulating autophagy and TGFβ-SMAD3 signaling pathway.

Methods: The expression of p-SMAD3 and SMAD7 were detected by Immunohistochemistry. Endometrial fibrosis was detected by masson staining. The expression of protein related autophagy and fibrosis was detected by western blot. The autophagic flux was monitored via Tandem mRFP-GFP-LC3 fluorescence system. Chip assay was used for SMAD3 binding site analysis. SMAD7 knockout mice were used for investigated the regulation of SMAD7 on intrauterine adhesions and autophagy.

Results: we observed that patients with IUA exhibited a high expression of p-SMAD3 in the endometrium whereas SMAD7 expression decreased. In endometrial stromal cells, the silencing of SMAD7 inhibits autophagic flux, whereas overexpressed SMAD7 promotes autophagic flux. We also found that SMAD7-mediated autophagic flux regulated stromal-myofibroblast transition. These phenotypes are regulated by the transforming growth factor (TGF)β-SMAD3 signaling pathway. We found that SMAD3 directly binds to the 3ʹ-untranslated region of transcription factor EB (TFEB) and inhibits its transcription. SMAD7 promotes autophagic flux by inhibiting SMAD3, thereby suppressing the inhibition of TFEB. The endometria of SMAD7 knockout mice showed a fibrotic phenotype. Simultaneously, autophagic flux was inhibited. On administering the autophagy activator rapamycin, endometrial fibrosis of SMAD7 gene conditional knockout mice was partially restored.

Conclusions: the loss of SMAD7 promotes endometrial fibrosis by inhibiting autophagic flux via the TGFβ-SMAD3 pathway. Therefore, this study reveals a potential therapeutic target for IUA.

Health sciences/Biomarkers

Health sciences/Diseases

Health sciences/Medical research

Health sciences/Molecular medicine

SMAD7

IUA

stromal-myofibroblast transition

autophagy

TFEB

Intrauterine adhesions (IUA) often cause infertility and recurrent abortion. Uterine surgery and endometrial infection most commonly cause uterine adhesions¹. Hysteroscopic surgery and estrogen have been used to treat uterine adhesions to some extent. However, almost half of the patients with IUA continue to experience poor therapeutic effects². It has been recently revealed that uterine adhesions are pathologically manifested as endometrial fibrosis; however, its pathogenesis remains unclear.

Autophagy is a highly conserved system that facilitates intracellular degradation and circulation and plays an important role in physiological and pathological conditions. Increasing evidence has revealed that dysfunctional autophagy is closely related to the excessive deposition of extracellular matrix and fiber formation³. The role of autophagy in fibrosis disease remains currently controversial because it can both promote and inhibit fibrosis occurrence. Autophagy-related defects may cause endometrial fibrosis⁴. The occurrence of endometrial fibrosis is promoted by endometrial stroma-myofibroblast transition and epithelial-mesenchymal transition. However, the role of autophagy in IUA requires further investigation.

The transforming growth factor (TGF)β-SMAD3 signaling pathway can promote the occurrence of fibrotic diseases, such as renal⁵ and cardiac fibrosis⁶. The activation of the TGFβ-SMAD3 signaling pathway along with the decreased expression of SMAD7 may be associated with the incidence of IUA⁷. Our previous study revealed that the expressions of p-SMAD2/3, type I collagen, and connective tissue growth factor increased in the endometrial tissue of patients with uterine adhesions. However, few studies have explored the correlation between the TGFβ-SMAD3 signaling pathway and IUA, and direct correlational evidence is lacking.

The TGFβ-SMAD3 signaling pathway participates in the regulation of autophagy⁸. Therefore, we speculated that the downregulation of SMAD7 inhibits autophagy by activating the TGFβ-SMAD3 signaling pathway, leading to the occurrence of endometrial fibrosis via endometrial stroma-myofibroblast transition.

Tissue specimens

A total of 20 pairs of IUA tissues were obtained from the Department of Obstetrics and Gynecology, Affiliated Hospital of North Sichuan Medical College. All patients provided signed informed consent. The tissue specimens were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned for subsequent experiments. The Ethics Committee of North Sichuan Medical College approved the use of IUA tissues and study protocols.

Masson staining

The Masson staining assay was conducted according to the instructions of Masson’s Trichrome Stain Kit (G1340-7, Beijing Solarbio Science & Technology Co., Ltd.).

Cell culture and transfection

T-human embryonic stem cells (HESCs) (hTERT-immortalized cells; CRL-4003) were purchased from ATCC and cultured in Dulbecco’s modified Eagle medium/F12 medium with 3.1 g/L glucose and 1 mM of sodium pyruvate, without phenol red (Sigma Cat# D 2906), supplemented with 1.5 g/L sodium bicarbonate, 1% ITS + Premix (BD Cat# 354352), 500 ng/mL of puromycin, and 10% of charcoal/dextran treated fetal bovine serum (HyClone Cat# SH30068.03). T-HESCs were cultured at 37°C under conditions of 5% CO₂.

The si-SMAD7 and siRNA-mate plus were purchased from GenePharma (GenePharma Co Ltd, Shanghai, China). Transfection was performed according to the manufacturer's instructions for siRNA-mate plus. Sequences of SMAD7 siRNAs were as follows: Si-1: 5′-AGGCAUUCCUCGGAAGUCATT-3′; Si-2: 5′-GCAGCCTAACCAGACCTTT-3′, and pCMV5-SMAD7 was constructed for the overexpression of SMAD7.

Western blotting

Cells were lysed using a radioimmunoprecipitation assay buffer containing 1% phenylmethylsulfonyl fluoride for the extraction of total protein. After the proteins were fully denatured using a boiling water bath, they were loaded onto a sodium dodecyl-sulfate polyacrylamide gel electrophoresis gel. After running electrophoresis for 2 h, the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA). Subsequently, the PVDF membrane was blocked using 5% skimmed milk at room temperature for 2 h. The membrane was rinsed with phosphate-buffered saline with Tween 20 (PBST) three times and incubated with primary antibodies overnight. PBST rinsing was performed again, and the membrane was incubated with secondary antibodies for 2 h at room temperature. After the final rinse, the proteins were visualized using an enhanced chemiluminescence solution on a ChemiDoc XRS system (Bio‐Rad). The primary antibodies included rabbit anti-SMAD7 (Santa Cruz: sc-365846), anti-LC3I/II (Sigma Aldrich L7543), anti-P62 (CST, #23214), anti-collagen I (COI) (Abcam, ab138492), anti-α-SMA (CST, #19245), anti-TFEB (CST, #37785), anti-SMAD3 (CST, #9513), anti-p-SMAD3 (CST, #9520), and anti-ATG7 (CST, #8558).

Immunohistochemistry (IHC)

IHC analyses were performed according to the SP kit instructions (ZSGBBIO ORIGENE, SP-9000). Briefly, tissue sections were heated at 56°C overnight, dewaxed to water in a concentrated gradient alcohol solution, subjected to antigen repairing with boiling citrate sodium, incubated with 3% H₂O₂, and blocked with nonspecific antibody bovine serum albumin. The tissue sections were incubated with primary antibodies at 4°C overnight. After rinsing with PBS thoroughly, the sections were incubated with a reaction magnifier and then incubated with secondary antibodies. Finally, the sections were visualized with DAB and photographed using a light microscope.

Chromatin immunoprecipitation (ChIP) assay

The ChIP assay was performed according to the manufacturer’s instructions for the ChIP Assay Kit (Cell Signaling Technology, 9003). Briefly, formaldehyde-fixed and cross-linked target proteins formed a complex with DNA. Chromatin was sonicated into fragments of 200–1000 bp. An anti-SMAD3 antibody was used for the immunoprecipitation of the SMAD3 protein–DNA complex. The protein A/G was used to bind the SMAD3 antibody–SMAD3 protein–DNA complex. After removing the nonspecific binding proteins and the enriched SMAD7 protein–the DNA complex was decoupled for purification and enrichment of DNA fragments. The DNA was verified by performing a quantitative polymerase chain reaction (PCR).

Double luciferase reporter gene assay

After seeding into 24-well plates, T-HESCs were transfected with 100 nM overexpressed SMAD7 plasmids or the control, which were cotransfected with 0.8 μg of TFEB-WT or mut and 1 μg of Renilla plasmid after routine cultivation of 24 h. After 24 h, the relative luciferase activity was calculated by using the dual-luciferase reporter assay system (Promega Corporation, E1910).

Tandem mRFP-GFP-LC3 fluorescence

T-HESCs were transfected with mRFP-GFP-LC3, si-SMAD7, or NC (si-SMAD7-NC, si-SMAD7-1, and si-SMAD7-2) and pcmv5-SMAD7 or NC (pcmv5-SMAD7-NC and pcmv5-SMAD7). The green fluorescent protein (GFP) and red fluorescent protein (RFP) represented autophagy bodies and lysosomes that were photographed using confocal microscopy. The GFP and RFP dots were counted using the Image Pro plus 6.0 software.

Real-time (RT)-PCR

Total RNA was extracted using the high-purity total RNA rapid extraction kit (Bioteke Corporation, RP1201). The RNA was reverse transcribed into cDNA based on the operating instructions of the iSCRIPT cDNA synthesis kit (Bio-Rad Laboratories, 4,106,228). All primers were synthesized by Sangon Biotech. RT-PCR was performed according to the instructions of GeneCopoeia. The 2 −Δ ΔCT method was used for analysis.

Animal models

1. Methods: to generate conditional knockout offspring, the gRNA of the mouse Smad7 gene, the donor vector containing loxP sites, and Cas9 mRNA were co-injected into fertilized mouse eggs. F0 founder animals were identified using PCR followed by sequence analysis, and they were bred to wild-type mice to test germline transmission and F1 animal generation. An F1-targeted mouse was bred with a tissue-specific PR-cre delete mouse to generate F2. For a heterozygous breed, Cre+ mice were bred with homozygous mice. 2. gRNA target sequence: gRNA1 (matching forward strand of the gene): CCTCCTCGCCCCGCATGTTCAGG; gRNA2 (matching forward strand of the gene): GTAAGTGCCAGTCGGATCTGTGG. 3. Genotyping strategy: Primers1: (annealing temperature of 60.0ºC) F1: 5′-CAATTCTGAAGCTTTGTAAGTGCC-3’ R1: 5′-ACATAATCCTCGCTAAACTCGCT-3′; homozygotes: one band with 207 bp; heterozygotes: two bands with 207 bp and 143 bp; wildtype allele: one band with 143 bp; Primers2: (annealing temperature of 60.0ºC); forward: 5′-GCGCTAAGGATGACTCTGGTC-3′; reverse: 5′-CCCTTCTCATGGAGATCTGTC-3′; Cre amplicon: approximately 700 bp. 4. PCR reaction: the TaKaRa MiniBEST Universal Genomic DNA Extraction kit (Ver.5.0_Code No. 9765) was used to obtain genomic DNA of high purity. Premix Taq (Vazyme, P222).

Statistical analyses

All statistical analyses were performed using the SPSS software version 22.0 (Chicago, IL). Each experiment was performed in triplicate. Statistical analyses were performed using Student’s t-test. Data are represented by mean ± standard deviation. Statistical significance was defined as p < 0.05.

1) The markers of autophagy and fibrosis exhibited increased expression in endometrial tissues with IUA

Our previous study demonstrated that endometrial tissues with IUA showed fibrosis. Masson’s staining results revealed that fibrosis increased in the endometrium with IUA compared to normal endometria. The expression of SMAD7, LC3-II, and ATG7 were downregulated in the endometrium with IUA (Fig. 1A).

2) Loss of SMAD7 inhibited autophagy flux and promoted the stromal-myofibroblast transition

To investigate the function of SMAD7, we silenced the ectopic expression of SMAD7 in both primary endometrial and endometrial stromal cell lines (T-HESCs). The results revealed that levels of SMAD7 mRNA and proteins decreased after silencing SMAD7 and increased after SMAD7 was overexpressed (Fig. 2A, 2B, 2C). After silencing SMAD7, the levels of autophagy biomarkers of LC3-II increased but those of p62 decreased, whereas the fibrosis markers of α-SMA and COL1A1 levels increased. On overexpression of SMAD7, LC3-II levels decreased but those of p62 increased, whereas α-SMA and COL1A1 levels decreased (Fig. 2D, 2E). To further demonstrate the effect of SMAD7 on autophagic flux, we administered autophagy inhibitors of 3-MA or Bafa1 in T-HESCs, which led to the overexpression of SMAD7. The conversion of LC3-I to LC3-II decreased, and this was attributed to the enhanced autophagic flux or reduced autophagosomes. Our results revealed that Bafa1 could not reverse the decreased conversion of LC3-I to LC3-II caused by overexpressed SMAD7, which indicated that SMAD7 promoted autophagic flux (Fig. 2F, 2G).

Furthermore, the mRFP-GFP-LC3 lentiviral vector was used to infect T-HESCs to track the autophagic flux. Overexpressed SMAD7 promoted autophagic flux, whereas the silencing of SMAD7 inhibited autophagic flux. (Fig. 2H, 2I)

3) Silencing of SMAD7 inhibited stromal-to-myofibroblast transition

The silencing SMAD7 of increased p-SMAD3 levels, whereas the overexpression of SMAD7 decreased p-SMAD3 levels but did not affect the expression of SMAD3(Fig. 3A,3B). The expression of ATG7 or ATG5 was decreased after silencing ATG7 or ATG5(Fig. 3C, 3D, 3E, 3F) The silencing of SMAD7 increased the expressions of α-SMA and COL1A1, which could be reversed by the overexpression of ATG5/7 or the addition of rapamycin (Fig. 3G). The overexpression of SMAD7 decreased the expressions of α-SMA and COL1A1, which could be reversed by the silencing of ATG5/7 or the addition of CQ (Fig. 3H). Therefore, the activation of autophagy can inhibit fibroblast-to-myofibroblast transition and SMAD7-mediated fibrosis.

4) SMAD7 regulated autophagy flux via TFEB

TFEB plays a crucial role in the regulation of autophagy flux and lysosomes. We explored whether SMAD7 regulates autophagy via TFEB. The silencing of SMAD7 in primary and immortalized endometrial stromal cells decreased TFEB protein and mRNA levels, whereas TFEB protein and mRNA levels increased when SMAD7 was overexpressed (Fig. 4A,4C,4D,4B,4E,4F). SMAD7 regulated SMAD3-dependent TFEB, which was also confirmed by using the SMAD3 inhibitor, SIS3 (Fig. 4G,4H). We further investigated the mechanism underlying the regulation of TFEB by SMAD7. Bioinformatics analyses (Gene Transcription Regulation Database v20.06) revealed binding sites in the 3′untranslated regions between SMAD3 and TFEB (Fig. 4I). The ChIP assay further confirmed that SMAD3 and TFEB exhibited a direct combining effect, which could be promoted by TGFβ1(Fig. 4J). The dual luciferase reporter gene assay revealed that the overexpression of SMAD3 could inhibit the activity of dual luciferase, which could be reversed after the binding site was mutated. SMAD7 overexpression increased dual luciferase activity, whereas the silencing of SMAD7 decreased luciferase activity. Simultaneously, we found that this regulation was SMAD3-dependent (Fig. 4K). Therefore, SMAD7 regulated the transcriptional activity of TFEB via SMAD3.

5) SMAD7 knockout-induced endometrium fibrosis and stromal-myofibroblast transition in mice

To understand the relationship between endometrial fibrosis and SMAD7, we established SMAD7 conditional knockout (SMAD7^fl/fl, Cre^+/−) mice. Agarose gel electrophoresis was used to confirm that SMAD7 could be knocked out (Fig. 5A). Western blotting confirmed that SMAD7 expression significantly decreased after SMAD7 knockout (Fig. 5B). Masson’s staining revealed that the level of endometrial fibrosis in SMAD7^Cre+/− mice was significantly higher than that in SMAD7^fl/fl mice (Fig. 5C). No fibrosis was noted in the liver, heart, lung, and kidney in both groups of SMAD7^Cre+/− and SMAD7^fl/fl mice (Fig. 5D). IHC analyses and western blotting revealed that the expressions of p-SMAD3, COL1A1, LC3-II, and P62 increased, whereas those of SMAD7, ATG7, and TFEB decreased (Fig. 5E, 5H). Differential gene KEGG enrichment analysis shows that certain pathways such as PI3K-AKT, P53 and NF-kappa B signaling pathways may participate in the effect caused by SMAD7 knockout (Fig. 5F). The gene expression profile in the uterus of WT or SMAD7 knockout mice shows that 374 genes were upregulated, and 340 were down-regulated. The top 30 genes heat map was shown in Fig. 5G.

6) Autophagy inhibited endometrial fibrosis and stromal-myofibroblast transition in SMAD7^fl/fl, Cre^+/− mice

In vitro experiments have confirmed that autophagy activation could inhibit COI and α-SMA expressions that were induced by SMAD7 inhibition (Fig. 6A). Therefore, we intraperitoneally injected rapamycin or a SMAD3 inhibitor into SMAD7 knockout mice once a day for 7 consecutive days. Subsequently, the endometrium was stained with Masson’s stain. Rapamycin or the SMAD3 inhibitor could significantly improve the level of endometrial fibrosis in SMAD7 knockout mice (Fig. 6B). IHC analyses and western blotting revealed showed that the levels of p-SMAD3, COI, LC3-II, and p62 decreased, whereas those of ATG7 and TFEB increased (Fig. 6C).

In this study, we observed the abnormal expression of SMAD7 and autophagy markers in the endometrial tissues of patients with IUA. We also found that autophagy was activated by SMAD7 via the inhibition of the TGFβ-SMAD3 signaling pathway. The transformation of endometrial stromal cells into myofibroblasts was promoted by SMAD7-mediated autophagy. We established mice with conditional knockout SMAD7 gene in endometrial tissues. After SMAD7 gene knockout in the endometrial tissues of mice, we noted increased fibrosis, decreased autophagy, and enhanced stromal-to-myofibroblast transition in endometrial tissues.

Our previous studies revealed that the TGFβ-SMAD2/3 pathway was abnormally expressed in IUA⁹. Other studies have reported an association between the TGFβ-SMAD2/3 pathway and IUA. Endometrial fibrosis is a pathological manifestation of IUA. Therefore, the TGFβ-SMAD2/3 pathway may play a crucial role in the pathogenesis of endometrial fibrosis⁷. However, no direct evidence exists that this pathway causes endometrial fibrosis. We found that SMAD7 exhibited reduced expression in endometrial tissues with IUA. Thus, we established a conditional knockout of the SMAD7 gene in the mouse endometrium. Consistent with our hypothesis, we observed that endometrial fibrosis was significantly enhanced. Therefore, the decreased expression of SMAD7 protein can cause endometrial fibrosis, and ultimately cause IUA. Our study provides a good model for IUA.

Myofibroblasts play a crucial role in normal tissue repair and fibrosis. The positive expression of α-SMA is a characteristic of myofibroblasts. Abnormal myofibroblast function can cause fibrotic diseases. There can be many sources of myofibroblasts, including fibroblasts and macrophages. In this study, we found that endometrial stromal cells can be transformed into myofibroblasts. A reduction in SMAD7 can activate TGFβ-SMAD3 by facilitating the transition of endometrial stromal cells into myofibroblasts. This change was also observed in SMAD7 knockout mice. TGFβ-SMAD3 pathway inhibitors can inhibit this transition. Therefore, we speculated that the transition of endometrial stromal cells into myofibroblasts could promote the occurrence of endometrial fibrosis, and the inhibition of this transition could be a potential therapeutic target for IUA¹⁰

The role of autophagy in fibrosis remains controversial. Abnormal autophagy can activate or inhibit the occurrence of fibrosis¹¹. In IUA, autophagy markers were differentially expressed in patients with IUA and endometrial tissues at various sites. Autophagy was found to gradually reduce from endometrial tissues, endometrial and scar link sites, and scar tissue from patients with IUA. Compared with the normal endometrium, LC3-II expression increased in the endometrial tissues of patients with IUA¹². Another study revealed that autophagy was reduced in the endometrial tissues of IUA. Our results revealed that LC3-II and ATG7 expressions decreased and P62 expression increased in the endometrial tissues of patients with IUA⁴. This indicated that autophagy was inhibited in IUA. Results of in vitro studies revealed that SMAD7 promoted autophagy flux by inhibiting the TGFβ-SMAD3 signaling pathway. In SMAD7 knockout mice, the expression of ATG7 decreased and that of P62 increased. This result was consistent with that of human IUA. The administration of rapamycin, an inducer of autophagy, significantly inhibited fibrosis in SMAD7 knockout mice. Therefore, the activation of autophagy can be used to treat IUA.

we found that decreased SMAD7 expression activated the TGFβ-SMAD3 signaling pathway, leading to the inhibition of autophagy flux. This eventually causes endometrial fibrosis. The inhibition of the TGFβ-SMAD3 signaling pathway or autophagy activation can inhibit endometrial fibrosis. Our study provides potential therapeutic targets and animal models for the treatment of IUA ((Fig. 7)).

Ethics approval and consent to participate

The study is reported in accordance with ARRIVE guidelines. According to the principles of the Declaration of Helsinki, all patients consented to use their tissues. The Ethics Committee of North Sichuan Medical College approved the use of IUA tissues and study protocols (2021 ER(A):51). The animal experiments were approved by the Committee on the Use and Care of Animals and conducted according to institutional guidelines (I ACUC Issue No.26).

Consent for publication

Not applicable.

Conflict of interest

The authors declare that they have no conflict of interest.

Funding

This work was supported by Sichuan Science and Technology Program (2022NSFSC1357 ); the Nanchong City-School Science and Technology Strategic Cooperation Project (19SXHZ0293); Doctoral Initiation Fund Project (Natural Science)( CBY21-QD23); The Key Scientific Research Project of North Sichuan Medical College (CBY18-A-ZD21), the Scientific Research Project of Affiliated Hospital of North Sichuan Medical College (2020JC021), the National Science Foundation of China (82103250), Kuanren Talents Program of the second affiliated hospital of Chongqing Medical University (kryc-yq-2104, kryc-yq-2222), Traditional Chinese Medicine research joint project of Chongqing Health Commission and Chongqing Science and Technology Bureau (2019ZY3152); Senior Medical Talents Program of Chongqing for Young and Middle-aged.

Authors' contributions

Jianguo Hu and Min Yong conducted animal experiments. Honggui Zhou proofread the article. Hongtao Zhu and Yuqin Yao conducted the western blot and IHC. All authors read and approved the final manuscript

Acknowledgments

We thank members of our laboratory of the translational medicine research center for technical help and stimulating discussions.

Data Availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

March CM. Management of Asherman's syndrome. Reproductive biomedicine online 2011; 23:63-76.
Schenker JG, Margalioth EJ. Intrauterine adhesions: an updated appraisal. Fertility and sterility 1982; 37:593-610.
Evans-Hoeker EA, Young SL. Endometrial receptivity and intrauterine adhesive disease. Seminars in reproductive medicine 2014; 32:392-401.
Sahin Ersoy G, Zolbin MM, Cosar E, Moridi I, Mamillapalli R, Taylor HS. CXCL12 Promotes Stem Cell Recruitment and Uterine Repair after Injury in Asherman's Syndrome. Molecular therapy Methods & clinical development 2017; 4:169-77.
Pongpattanawut C, Pantasri T, Sreshthaputra O, Sanmee U. Intrauterine Adhesions: Causes and Treatment Outcomes among Thai Women. Journal of the Medical Association of Thailand = Chotmaihet thangphaet 2016; 99:1067-72.
Bosteels J, Weyers S, D'Hooghe TM, Torrance H, Broekmans FJ, Chua SJ, et al. Anti-adhesion therapy following operative hysteroscopy for treatment of female subfertility. The Cochrane database of systematic reviews 2017; 11:Cd011110.
Yu D, Wong YM, Cheong Y, Xia E, Li TC. Asherman syndrome--one century later. Fertility and sterility 2008; 89:759-79.
Salazar CA, Isaacson K, Morris S. A comprehensive review of Asherman's syndrome: causes, symptoms and treatment options. Current opinion in obstetrics & gynecology 2017; 29:249-56.
Hu, J. et al. MARCH5 RNA promotes autophagy, migration, and invasion of ovarian cancer cells. Autophagy 13, 333-344, doi:10.1080/15548627.2016.1256520 (2017).
Liu N, Feng J, Lu X, Yao Z, Liu Q, Lv Y, et al. Isorhamnetin Inhibits Liver Fibrosis by Reducing Autophagy and Inhibiting Extracellular Matrix Formation via the TGF-β1 /Smad3 and TGF-β1/p38 MAPK Pathways. Mediators of inflammation 2019; 2019:6175091.
Wei L, Jian P, Erjiong H, Qihan Z. Ginkgetin alleviates high glucose-evoked mesangial cell oxidative stress injury, inflammation, and extracellular matrix (ECM) deposition in an AMPK/mTOR-mediated autophagy axis. Chemical biology & drug design 2021; 98:620-30.
Zhou Z, Wang H, Zhang X, Song M, Yao S, Jiang P, et al. Defective autophagy contributes to endometrial epithelial-mesenchymal transition in intrauterine adhesions. Autophagy 2022; 18:2427-42.
Zhang X, Zhang Y, Miao Q, Shi Z, Hu L, Liu S, et al. Inhibition of HSP90 S-nitrosylation alleviates cardiac fibrosis via TGFβ/SMAD3 signalling pathway. British journal of pharmacology 2021; 178:4608-25.
Li Y, Guo F, Huang R, Ma L, Fu P. Natural flavonoid pectolinarigenin alleviated kidney fibrosis via inhibiting the activation of TGFβ/SMAD3 and JAK2/STAT3 signaling. International immunopharmacology 2021; 91:107279.
Salma U, Xue M, Ali Sheikh MS, Guan X, Xu B, Zhang A, et al. Role of Transforming Growth Factor-β1 and Smads Signaling Pathway in Intrauterine Adhesion. Mediators of inflammation 2016; 2016:4158287.
Bao Y, Ding Z, Zhao P, Li J, Chen P, Zheng J, et al. Autophagy inhibition potentiates the anti-EMT effects of alteronol through TGF-β/Smad3 signaling in melanoma cells. Cell death & disease 2020; 11:223.
Hu J, Zeng B, Jiang X, Hu L, Meng Y, Zhu Y, et al. The expression of marker for endometrial stem cell and fibrosis was increased in intrauterine adhesious. International journal of clinical and experimental pathology 2015; 8:1525-34.
Thannickal VJ. Myofibroblast Functions in Tissue Repair and Fibrosis: An Introduction. Methods in molecular biology (Clifton, NJ) 2021; 2299:9-15.
Kim P, Chu N, Davis J, Kim DH. Mechanoregulation of Myofibroblast Fate and Cardiac Fibrosis. Advanced biosystems 2018; 2.
Chen J, Tang Y, Zhong Y, Wei B, Huang XR, Tang PM, et al. P2Y12 inhibitor clopidogrel inhibits renal fibrosis by blocking macrophage-to-myofibroblast transition. Molecular therapy : the journal of the American Society of Gene Therapy 2022; 30:3017-33.
Liang S, Wu YS, Li DY, Tang JX, Liu HF. Autophagy and Renal Fibrosis. Aging and disease 2022; 13:712-31.
Wei C, Pan Y, Zhang Y, Dai Y, Jiang L, Shi L, et al. Overactivated sonic hedgehog signaling aggravates intrauterine adhesion via inhibiting autophagy in endometrial stromal cells. Cell death & disease 2020; 11:755.

No competing interests reported.

WB.rar

Download PDF

Version 1

posted

You are reading this latest preprint version

Loss of smad7 promoted the stromal-myofibroblast transition of endometrium via autophagy

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Results

1) The markers of autophagy and fibrosis exhibited increased expression in endometrial tissues with IUA

2) Loss of SMAD7 inhibited autophagy flux and promoted the stromal-myofibroblast transition

3) Silencing of SMAD7 inhibited stromal-to-myofibroblast transition

4) SMAD7 regulated autophagy flux via TFEB

5) SMAD7 knockout-induced endometrium fibrosis and stromal-myofibroblast transition in mice

6) Autophagy inhibited endometrial fibrosis and stromal-myofibroblast transition in SMAD7^fl/fl, Cre^+/− mice

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Loss of smad7 promoted the stromal-myofibroblast transition of endometrium via autophagy

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Results

1) The markers of autophagy and fibrosis exhibited increased expression in endometrial tissues with IUA

2) Loss of SMAD7 inhibited autophagy flux and promoted the stromal-myofibroblast transition

3) Silencing of SMAD7 inhibited stromal-to-myofibroblast transition

4) SMAD7 regulated autophagy flux via TFEB

5) SMAD7 knockout-induced endometrium fibrosis and stromal-myofibroblast transition in mice

6) Autophagy inhibited endometrial fibrosis and stromal-myofibroblast transition in SMAD7fl/fl, Cre+/− mice

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

6) Autophagy inhibited endometrial fibrosis and stromal-myofibroblast transition in SMAD7^fl/fl, Cre^+/− mice