Patients and samples
AIPC samples were obtained from 45 patients who provided informed consent in accordance with the ethical standards of the Tongren Hospital (Shanghai, China) Review Board. All samples were analysed by a pathologist and confirmed as AIPC according to histopathological evaluation. No local or systemic treatments were provided to these patients before surgery.
Cell culture
The AIPC cell lines PC3 and DU145 were obtained from the American Type Culture Collection (Manassas, VA, USA). The normal prostate cell line RWPE was purchased from Jennio Biotech Co. (Guangzhou, China). PC3 and DU145 cells were cultured in DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% heat-inactivated foetal bovine serum (FBS; Gibco). RWPE cells were cultured in RPMI 1640 medium supplemented with 10% FBS (both from Gibco). All cells were incubated at 37 °C in a humidified incubator under an atmosphere 5% CO2.
Cell transfection
The LEF1-AS1 pcDNA3.3 vector was generated based on the expression vector pcDNA3.3 (Invitrogen, USA). Small interfering RNAs for LEF1-AS1, C-myb, FZD2 or CD44 (siLEF1-AS1, siC-myb, siFZD2, siCD44) and scramble siRNA (siNC) were purchased or synthetized from RiboBio (Guangzhou, China). The cells were seeded into 6-well plates and transfected with vectors using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After incubating for 48 hours, the cells were collected for further experiments.
RNA isolation and RT-PCR analyses
Total RNA was extracted from AIPC samples and cells using TRIzol reagent (Invitrogen), and cDNA was synthesised using a QuantiTect Reverse Transcription kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. Then, RT-qPCR was performed using SYBR Premix Ex Taq (Takara, Tokyo, Japan) following the manufacturer’s instructions, and the expression levels of the assayed genes were normalized to that of GAPDH. The sequences of the upstream and downstream primers used in the present study are as follows: LEF1-AS1, forward (AAGGACGAGAGAAAAGCAC) and reverse (CACACAAAGGGGAAGACC); FZD2, forward (TCGTGTACCTGTTCATCGGCAC) and reverse (CTGTGTAGAGCACGGAGAAGAC); CD44, forward (CCAGAAGGAACAGTGGTTTGGC) and reverse (ACTGTCCTCTGGGCTTGGTGTT); MMP7, forward (TCGGAGGAGATGCTCACTTCGA) and reverse (GGATCAGAGGAATGTCCCATACC); c-myc, forward (CCTGGTGCTCCATGAGGAGAC) and reverse (CAGACTCTGACCTTTTGCCAGGE); and GAPDH, forward (GTCTCCTCTGACTTCAACAGCG) and reverse ACCACCCTGTTGCTGTAGCCAA. Each experiment was repeated at least three times.
Chromatin immunoprecipitation (ChIP)
To identify the potential transcription factors that bind to the LEF1-AS1 promoter, a ChIP assay was performed using an EZ-Magna ChIP kit (Millipore) according to the manufacturer’s protocol. In brief, cells were fixed with 4% paraformaldehyde and incubated with glycine for 10 min to generate DNA-protein cross-links. Then, the cells were lysed with cell and nuclear lysis buffers and sonicated to generate 400-800 bp chromatin fragments. The chromatin fragments were immunoprecipitated with an anti-C-myb antibody (Cell Signaling Technology, Danvers, MA, USA) or control IgG, and the resulting DNA was purified for PCR analyses All primers sequence was shown as Table S1.
RNA binding protein immunoprecipitation (RIP) assay
RIP was performed according using an EZ-Magna RIP kit (EMD Millipore, Billerica, MA, USA) following the manufacturer’s instructions. Briefly, DU145 cells grown to 80-90% confluency were lysed in complete RIP lysis buffer, and 90 μL of whole cell extract was incubated with RIP buffer containing magnetic beads conjugated with 5 μg of a human anti-C-myb antibody (Abcam) or immunoglobulin G (IgG) control. The samples were then incubated with proteinase K with shaking to digest the protein, and RNA was isolated by immunoprecipitation. Finally, the immunoprecipitated RNA was purified and analysed by RT-qPCR.
Immunoblotting analysis
Cells (5 × 106) were lysed for 20 min with lysis buffer (Beyotime Biotechnology) containing protease inhibitors (Roche, Indianapolis, IN, USA). Then, equal amounts of samples were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. Subsequently, the membranes were blocked with 5% (wt/vol) skimmed milk in TBS plus Tween 20 at 4 °C overnight before being probed with antibodies against the following proteins at the indicated dilutions: GSK3β (1:1000; ab32391), p-GSK3β (1:1000; ab75814), β-catenin (1:1000; ab32572), MMP-7 (1:1000; ab271977) c-myc (1:1000; ab32072), FZD2 (1:1000; ab109094), CD44 (1:1000; ab51037) and GAPDH (1:1000; ab8245 (all obtained from Abcam, USA). The membrane-immobilized proteins were then detected using an HRP-conjugated secondary antibody (1:1000, Santa Cruz Biotech, Santa Cruz, CA).
Colony formation assay
Colony formation assays were performed by seeding 1000 AIPC cells into each well of a 6-well plate. After culturing for 15 days, the PC3 or DU145 cells were washed with PBS and fixed in methanol for 20 min. Then, after three washes with PBS, colonies were stained with 0.1% crystal violet for 20 min and then imaged using a light microscope (Olympus, Tokyo, Japan). Clusters containing ≥ 30 cells were counted as a single colony.
EDU assays
Cells were cultured in 96-well plates at a density of 2 × 103 cells/well. Then, cell proliferation was evaluated by the EDU (5’-ethynyl-2’-deoxyuridine) incorporation assay using a KeyFluor488 Click-iT EDU kit (KeyGENBioTECH, Nanjing, China) according to the manufacturer’s instructions. Subsequently, the percentage of Edu-positive cells was calculated after fluorescence microscopy analysis.
Cell migration and invasion assays
Cells were harvested, resuspended in serum-free medium, and then placed into the upper chamber of a transwell membrane filter (Corning, NY, USA) coated with or without Matrigel (Corning) for invasion and migration assays, respectively. After incubating for 24 h, the cells on the upper side of the filter were removed with a cotton swab. The invasive capacity of cells was evaluated by counting the invaded cells under a microscope (40 × 10). Five random fields of view were analysed for each chamber and counted using an Olympus microscope (Tokyo, Japan).
Immunohistochemical analysis
AIPC and adjacent tissues were fixed in 4% paraformaldehyde for paraffin embedding. Then, the tissue specimens were cut into slices that were deparaffinized, rehydrated, and immersed in 3% hydrogen peroxide for 10 min to quench endogenous peroxidase activity. The cancer tissues were then immunostained for FZD2 and CD44 (Abcam, San Francisco, CA, USA; 1:100 dilution), and the signal was amplified and visualized with diaminobenzidine chromogen followed by counterstaining with haematoxylin.
Tumourigenicity assays in nude mice
Male nude mice (6 weeks of age) obtained from the Animal Facility of Shanghai Jiao Tong University School of Medicine were used to perform tumourigenicity assays. The mice were fed sterilized food and water, and all animal experiments were approved by the Responsible Governmental Animal Ethics Committee and complied with the ARRIVE guidelines. Thirty-day-old male nude mice were subcutaneously injected in the right flank with 1 × 106 AIPC cells in 200 μL of serum-free medium. Once palpable tumours were detected (after approximately 4 weeks), the mice were sacrificed, and the tumours were isolated and weighed.
Statistical analysis
The results are presented as the means ± SD from three independent experiments performed in triplicate. The P values were calculated using Student t-test or one-way ANOVA. A P value of < 0.05 was considered to indicate a statistically significant result. Statistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software Inc., La Jolla, California).