Patients and Tissue Sample
We obtained the tumor tissues with paired adjacent normal tissues from 147 patients with NSCLC at the Department of The Second Affiliated Hospital of Xi’an Medical University from 2012 to 2015. All cancers were confirmed as NSCLC by the medical examination of hematoxylin and eosin. No patient had received chemotherapy or radiation therapy before surgery. The obtained fresh tissue samples were quickly frozen in the liquid nitrogen. Our present study has obtained the approval of the Medical Ethics Committee of The Second Affiliated Hospital of Xi’an Medical University, and the written informed consents of all participators prior to experiments.
Cell culture and Cell transfection
NSCLC cell lines A549, SPC-A1, H1299, 95D, and SK-MES-1 as well as normal human bronchial epithelial cells (16HBE) were provided by the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). We cultured cells in RPMI 1640 medium (GIBCO, Hangzhou, Zhejiang, China) added with 10% FBS (GIBCO, Hangzhou, Zhejiang, China). Cultures underwent incubation at 37 °C in a humidified atmosphere containing 5% CO2.
We seeded cells into 6-well plates and used the Lipofectamine 2000 (Invitrogen, Nanjing, Jiangsu, China) to transfect them with miR-877-5p inhibitor, miR-877-5p mimics, or normal control (NC). Recombinant plasmid overexpressing DNAH17-AS1 with the empty pcDNA3.1 vector (GenePharma, Pudong, Shanghai, China), were transfected into cells in logarithmic growth phase. For inhibiting endogenous DNAH17-AS1 expression, siRNA targeting DNAH17-AS1 and the corresponding control RNA (s-NC) were provided by Shanghai GenePharma, Pudong, Shanghai, China).
Bioinformatics analysis
The expression pattern of CCNA2 and its survival assays in NSCLC patients was analyzed using GEPIA website or UALCAN program18,19. MiRDB, TargetScan, starbase and mirWalk predicted the target genes of miR-877-5p. DAVID program or Co-LncRNA helped to perform the Gene ontology (GO) and KEGG analysis. The putative targets of DNAH17-AS1 were predicted by the starbase v2.020.
Quantitative real time polymerase chain reaction (qRT-PCR)
TRIzol reagent (Invitrogen, Grand Island, NY, USA) helped to extract the total RNA of the frozen specimens and cells following the instruction of manufacturer. UV spectrophotometer helped to detect the purity and concentration exhibited by the total RNA at 260 nm. Superscript III transcriptase (Invitrogen, Grand Island, NY, USA) assisted in reverse transcribing RNA into cRNA. An ABI7500 system together with SYBR Green PCR Master Mix (Takara, Dalian, Liaoning, China) were applied to the qRTPCR for measuring the expression level of DNAH17-AS1, miR-877-5p and CCNA2. We used GAPDH and U6 as an endogenous control. The relative expressions of genes were determined by the 2−ΔCt methods. The qRT-PCR specific primers were purchased from Ambion (Xuhui, Shanghai, China). Table 1 lists the primer sequences.
Table 1
Sequence of the primers used in this study.
Names | Primer sequences (5’-3’) |
DNAH17-AS1: Forward | TGCTGGACGGAAGCACCATC |
DNAH17-AS1: Reverse | CTCAACGGCTGATCAACGCCA |
miR-877-5p: Forward | GTAGAGGAGATGGCGCAGG |
miR-877-5p: Reverse | CTCTACAGCTATATTGCCAGCCAC |
CCNA2: Forward | CGCTGGCGGTACTGAAGTC |
CCNA2: Reverse | GAGGAACGGTGACATGCTCAT |
GAPDH: Forward | GGGAGCCAAAAGGGTCATCT |
GAPDH: Reverse | GAGTCCTTCCACGATACCAAC |
U6: Forward | GCGCGTCGTGAAGCGTTC |
U6: Reverse | GTGCAGGGTCCGAGGT |
Cell proliferation assays
Cell Counting Kit-8 (CCK-8) assay kits (Dojindo, Haidian, Beijing, China) assisted in conducting the cell proliferation assays. Briefly, cells received 24 h, 48 h, 72 h and 96 h of transfection by using the plasmid. Each well was added with CCK-8 (10 µL). Cells were incubated for one hour at 37 °C, then a microplate reader absorbance test plate (Molecular Devices, Shenzhen, Guandong, China) assisted in measuring each well’s spectrophotometric absorbance at 450 nm at various time points. The relative absorbance at 450 nm decided the number of cells. We conducted all experiments in triplicate.
When performing the colony formation assay, experimenters placed 600 GC cells in total in a fresh six-well plate as well as maintained them in the media that contained 10% FBS (replaced each three days). Twelve days later, methanol and 0.1% crystal violet (1 mg/ml) helped to fix and stain colonies, respectively. Number of visible colonies was counted by experimenters.
5-Ethynyl-2’-deoxyuridine (EdU) assays
An EdU Apollo-DNA kit (RIBOBIO, Xicheng, Beijing, China) was applied to the 5-Ethynyl-2-deoxyuridine incorporation assays for determining the proliferation of cells. Experimenters seeded about 6.0 × 103 cells/well in a 96-well plate, then used si-NC and si-DNAH17-AS1#1 and si-DNAH17-AS1#2 to transfect them. After being transfected, cells received 2 h of incubation by EdU at 37 °C. 4% polyformaldehyde that contained PBS was used to fix cells. Finally, a fluorescence microscopy assisted in visualizing these cells. Experiments were conducted repeatedly for no less than three times.
Flow cytometric analysis
48 hours after being transfected with trypsinisation, H1299 and 95D cells transfected with DNAH17-AS1#1, si-DNAH17-AS1#2 or si-NC were harvested. FITC Annexin V Apoptosis Detection Kit (BD Biosciences, Hangzhou, Zhejiang, China) was firstly adopted to double stain cells by using propidium iodide (PI) and FITC-Annexin V based on the users’ handbook, then flow cytometry (BD Biosciences, Hangzhou, Zhejiang, China) was employed to analyze stained cells under the assistance of CellQuest software (BD Biosciences, Hangzhou, Zhejiang, China).
Caspase activity detection
Caspase activity detection kits (Beyotime, Nanjing, Jiangsu, China) helped assess caspase 3/9 activities in DNAH17-depleted NSCLC cells according to the manufacturer’s protocol.
Wound healing assay
Cells in each group were implanted into 6-well culture plates with the density of 4.0 × 106 cells/well. With the density of cell up to 80 to 90%, a 100 µl pipette tip was used to made a scratch in the monolayer in the middle of the well. Experimenters kept the tip perpendicular to the bottom of the well for maintaining a straight gap. Experimenters used solutions to wash away the detached cells and removed them three times each day. At 0 and 48 h incubation, the H1299 and 95D cell lines were photographed using the inverted microscope (Olympus, Shenzhen, Guangdong, China) and the scratch area was assessed using Image J software.
Transwell invasion assay
Matrigel (1:8, BD, Lanzhou, Gansu, China) was coated on transwell inserts’ upper chamber (with the pore size of 8 µM, Nalge Nunc Intl., NY, USA) so as to perform the for invasion assays. Experimenters placed 3 × 104 cells into the upper chamber in RPMI-1640 (0.3 ml, without serum), and placed RPMI-1640 that contained 10% FBS in the lower chamber for being used as a chemoattractant. Cells that still were in the upper chambers were removed, then 0.3% crystal violet dye was used to stain these in lower chambers and PBS was used to wash them. A light microscope (× 40) assisted in counting the obtained images. Each assay was repeated three times.
Subcellular fractionation
The PARIS Kit (Life Technologies, Haidian, Beijing, China) assisted in separating the cytosolic and nuclear fractions of the two kinds of cells. After the extraction of total RNA from both fractions, RT-PCR was further carried out to examine DNAH17-AS1 expression ratios between the nuclear fraction and the cytoplasmic fraction. GAPDH and U6 were used as the controls.
Luciferase reporter assays
Experimenters synthesized the full fragments or mutant of DNAH17-AS1 that contained putative miR-877-5p-binding sites in the DNAH17-AS1, followed by cloning them into downstream of the firefly luciferase gene in the pGL3 plasmids (Promega Corporation, Hangzhou, Zhejiang, China), with the name of pGL3-DNAH17-AS1-wild type (Wt) and pGL3-DNAH17-AS1-mutant (Mut). Also, PCR helped to amplify the 3’UTR of CCNA2 that contained predicted miR-877-5p -binding sites or mutant sites, which were then inserted into pGL3 plasmids, with the name of pGL3-miR-877-5p -3’UTR-Wt1, pGL3-miR-877-5p-3’UTR-Mut, pGL3- miR-877-5p-3’UTR-Wt2 and pGL3- miR-877-5p-3’UTR-Mut2. Cells grew in the 96-well plate, followed by being were co-transfected using Lipofectamie 2000 (Invitrogen, Suzhou, Jiangsu, China). Cells were harvested 48 h after being transfected and the Dual-Luciferase reporter assay system (Promega, Guangzhou, Guangdong, China) was employed for measuring the luciferase activity following manufacturer’s protocol.
Statistical analysis
SPSS software, version 19.0 (SPSS, Chicago, IL, USA) assisted in performing the statistical analysis. Chi-square test or student’s t-test helped to analyze the difference between the two groups. The multi-group comparison was performed using one-way analysis of variance. The paired comparison was performed by SNK approach. Receiver-operating characteristic (ROC) curves assisted in evaluating the performance of CCNA2 and DNAH17-AS1 to discriminate NSCLC specimens from normal lung tissues. The survival rate was calculated with the Kaplan-Meier method and the calculated survival rates were compared with the log-rank test. The significance of survival variables was analyzed using the Cox multivariate proportional hazards model. The value of p < 0.05 was considered with statistical significance.