Gene Based ­­­­Markers in Marker-Assisted Selection to Screen Tomato Genotypes Resistant to Fusarium Wilt, Late Blight, Verticillium Wilt, Leaf Mold, Bacterial Spot and Bacterial Speck

DOI: https://doi.org/10.21203/rs.3.rs-404832/v1

Abstract

The tomato crop is exposed to serious losses due to infection with several diseases and pests, which threaten tomato production in Egypt and worldwide. Therefore, selecting the tomato germplasm resistant or tolerant to a specific pathogen by molecular markers closely linked to resistance loci is a desirable goal of this study. In this work, seven co-dominant markers targeting six resistance genes (I-1, Ve, Ph3, Cf-9/Cf-4, Rx4, and Pto) for six main diseases [ fusarium wilt (Fusarium oxysporum f. sp. lycopersici), verticillium wilt (Verticillium dahliae and V. alboatrum), late blight (Phytophthora infestans), leaf mold (Cladosporium fulvum), bacterial spot (Xanthomonas campestris pv. vesicatoria) and bacterial speck (Pseudomonas syringae pv. tomato)], respectively were determined. Theses molecular markers differentiated among 19 tomato genotypes resistant (homozygote/heterozygote) and susceptible (homozygote) to the pathogens. Therefore, this study supplied us with novel tomato lines with resistance to multiple diseases, and their pyramiding inside domesticated tomato cultivars are suggested to apply in the tomato breeding programs of resistance against fungal and bacterial diseases.

Introduction

Breeding for biotic stress resistance in the plants is considered one of the most crucial ways in the breeding programs. However, selecting the germplasm resistant or tolerant to a specific pathogen is more difficult (Peries 1971). Furthermore, the use of molecular markers in the identification and characterization of resistance genes has become an important tool, because they are not affected by environmental conditions. Besides, molecular markers supply a unique chance to select a big number of germplasms in a short time. Up to date, a big number of gene-based markers have been identified in various crops, including tomato (Foolad 2007).

Tomato (Solanum lycopersicum L.), one of the most important horticulture crops in Egypt and worldwide. It is infected with many fungal and bacterial diseases e.g., wilt disease caused by Fusarium oxysporum f. sp. lycopersici, verticillium wilt (Verticillium dahliae and V. alboatrum), late blight (Phytophthora infestans), leaf mold (Cladosporium fulvum), bacterial spot (Xanthomonas campestris pv. vesicatoria) and bacterial speck (Pseudomonas syringae pv. tomato) are a dangerous threat to tomato farming (Lee et al. 2015). There are a big number of tomato germplasms, many resistance loci for various diseases have been reported (Van Ooijen et al. 2007). Hence, molecular markers become an important tool in the tomato breeding programs for the detection of resistance genes of the above-mentioned diseases (Arens et al. 2010; Shi et al. 2011).

Fusarium wilt disease in tomato is caused by fungus F. oxysporum f. sp. lycopersici (Fol). Three races of Fusarium fungus were known (1, 2, and 3) (Grattidge and O’Brien 1982). Resistance to Fol has been reported in multiple wild tomato species. The resistance genes I-1, I-2 and I-3 have been indicated in the wild tomato S. pimpinellifolium accession “PI79532”, S. lycopersicum × S. pimpinellifolium hybrid “PI126915” and S. pennellii “LA716” respectively, which give resistance to Fol race 1, 2, and 3, respectively (Bohn and Tucker 1939; Simons et al. 1998; Scott and Jones 1989a). Besides, the single dominant gene (I-7) has been recorded in S. pennellii “PI414773” that confers resistance to Fol races 1, 2, and 3 (Gonzalez-Cendales et al. 2015).

Vascular wilt or verticillium wilt disease in tomato is a soil-born fungal pathogen caused by Verticillium dahliae and V. alboatrum (Fradin and Thomma 2006). The resistance gene (Ve) located on chromosome 9 (chr 9), which confers resistance to V. alboatrum race 1 (Diwan et al. 1999).

Late blight (LB) disease of tomato is caused by fungus Phytophthora infestans (Rodewald and Trognitz 2013); a few main resistance genes to LB in tomato have been reported. Three resistance loci to LB, Ph1, Ph2 and Ph3 from wild tomato S. pimpinellifolium have been located on chr 7, chr 10 and chr 9, respectively. The latter refers to incomplete resistance to P. infestans races (Foolad et al. 2008; Kim and Mutschler 2006; Zhang et al. 2013). Furthermore, the resistance gene (Ph4) in accession S. habrochaites LA1033 on chr 2 has been identified (Kole et al. 2006), and Ph5-1 and Ph5-2, which have been found in S. pimpinellifolium “PSLP153”, are mapped at chr 1 and chr 10, respectively (Merk et al. 2012; Merk and Foolad 2012).

Tomato leaf mold, which is caused by the fungus Cladosporium fulvum, causes significant yield loss in glasshouse-grown tomatoes (Rivas and Thomas 2005). Multiple resistance genes (Cf) to leaf mold have been recognized in wild tomato types namely, Cf-2, Cf-4, Cf-4E, Cf-5 and Cf-9 (Dixon et al. 1996; 1998; Takken et al. 1999). Both Cf-4 and Cf-9 originated from S. habrochaites and S. pimpinellifolium, respectively. They are mapped at the same locus on chr 1 (Parniske et al. 1997). Cf-2 and Cf-5 indicated in S. pimpinellifolium and L. esculentum var. cerasiforme, respectively. Both Cf-2 and Cf-5 are mapped at chr 6 (Dixon et al. 1998).

Bacterial spot disease in tomato, which is caused by a gram-negative bacterium Xanthomonas campestris pv. vesicatoria (Xcv), is a constant threat to the tomato grown in both the greenhouse and the field (Jones et al. 1998). Five races of Xcv (T1 to T5) are identified by various tomato germplasms. Resistance genes, involving Xv3 and Xv4, are responsible for mechanisms of hypersensitivity reaction (HR) resistance. Xv3 discovered in S. lycopersicum “H7981” and S. pimpinellifolium (accessions “PI126932” and “PI128216”) confers resistance against T3 races (Wang et al. 2011). Besides, resistance locus Rx-4 located on chr 11 (accession “PI128216”) also refers to resistance against T3 races (Robbins et al. 2009). A dominant resistance locus Xv4 on chr 3 has been found in S. pennellii LA716, which confers resistance to T4 strains (Astua-Monge et al. 2000). Both Rx-1 and Rx-2 are mapped at chr 1, while Rx-3 is located on chr 5, has been recognized in S. lycopersicum (accession “H7998”), which gives HR resistance to T1 strains (Scott and Jones 1989b).

Bacterial speck disease in tomato is caused by a gram-negative bacterium Pseudomonas syringae pv. tomato. The single dominant gene, Pto has been located on chr 5, which confers resistance to the bacterial speck in S. pimpinellifolium (Salmeron et al. 1996; Jia et al. 1997). The other genes originated from wild tomato S. habrochites “LA1777” are included in resistance against bacterial speck e.g., bsRr1-1, bsRr1-2 and bsRr1-12 are located on chr 1, chr 2 and chr 12, respectively (Thapa et al. 2015).

The purpose of this study was to identify the resistance alleles corresponding to fusarium wilt, verticillium wilt, late blight, leaf mold, bacterial spot, and bacterial speck of 19 tomato genotypes by molecular markers, which will be used as marker-assisted selection (MAS) in tomato breeding programs.

Materials And Methods

Plant materials

A total of 19 tomato genotypes, including accessions and commercial cultivars, were used in this study. The name and source of these genotypes were mentioned in Table (1). Ten tomato seeds from each of the genotype have been sown in a greenhouse at 27°C:16°C (Light:Dark), a photoperiod of L16:D8 h and relative humidity of 68–75%. Seedlings were planted in peat moss: sand (2:1) in pots (Mahfouze and Mahfouze 2019).

Isolation Of DNA

DNA was isolated from fresh tomato leaves for each genotype. 30 mg of tissue was ground in liquid nitrogen and extracted with the DNA purification Kit (Bio Basic, Inc., Markham, Canada) following the manufacturer's instructions. DNA quality and quantity were determined by agarose gel electrophoresis and Spectrophotometer. DNA concentrations were adjusted to 50 ng/µl and extracts were frozen at -20oC.

PCR amplification of resistance alleles

PCR with a gene-based marker was performed in 25 µl reactions containing 2.5 µl 2.5 mM dNTPs, 5 µl 5X buffer, 2.5 µl 2.5 mM MgCl2, 0.1 µl (0.5 units) Taq DNA polymerase (Promega Corp., Madison, WI), 2.5 µl each forward and reverse primer at 10 µM, 1 µl of DNA extract and 8.9 µl dsH2O. PCR cycles were 94°C for 4 min, 35 cycles of 94°C for 30 sec, annealing temperature (Table 2) for 1 min and 72°C for 1.5 min. These cycles were followed by 72°C for 10 min and then the reaction was held at 4°C. PCR reactions were performed in the Thermocycler (Biometra, biomedizinische Analytik GmbH). For CAPS markers, PCR products were digested by the restriction enzyme RsaI (Table 2). 25 µl reaction mixture containing 10.75 µl dsH2O, 3 µl buffer, 0.25 µl BSA (Bovine serum albumin), 1 µl restriction enzyme (RsaI) 10 U/µl (Promega Corp.) and 10 µl PCR reaction mixture. The reaction mixture was placed in a 65°C water bath for about 2 h according to the manufacturer’s instructions.

Table 1

Tomato genotypes used in this study.

No.

Genotype

Source

No.

Genotype

Source

1

Solanum hirsutum 24036

CGN*

11

S. chilense 56139

CGN

2

S. galapagense 0317

TGRC**

12

S. lycopersicon cv. Super Marmande

Egypt***

3

S. neoricki 0247

TGRC

13

S. lycopersicon cv. Strain B F1

Egypt

4

S. arcanum 1346

TGRC

14

S. corneliomulleri 1283

TGRC

5

S. corneliomulleri 1274

TGRC

15

S. habrochaites 1739

TGRC

6

S. pennellii 1733

TGRC

16

S. pimpinellifolium 1279

TGRC

7

S. huaylasense 1358

TGRC

17

S. pimpinellifolium 1332

TGRC

8

S. pimpinellifolium 1342

TGRC

18

S. pennellii 2963

TGRC

9

S. peruvianum 1333

TGRC

19

S. pennellii 1942

TGRC

10

S. habrochaites 1352

TGRC

     

CGN*= Centre for Genetic Resources, Netherlands (http://www.wur.nl).

TGRC**= Tomato Genetics Resource Center (TGRC), Department of Plant Sciences, University of California, Davis, CA 95616 (http://tgrc.ucdavis.edu).

***Two commercial cultivars were purchased from Egyptian Company for Seeds, Oils and Chemicals, Egypt.

 

Table 2

Primers sequences used in this study.

Primer name

Marker namea

Disease name

R-geneb

Chromosome No

Single nucleotide sequence (5’-3’)

Annealing temperature (AT)°C

Restriction enzyme

Molecular size of PCR product (bp)

References

SCAR I1F

SCAR

Fusarium wilt

I-1

11

CGAATCTGTATATTACATCCGTCGT

55

-

R = 130

Other = 92

Scott et al. (2004)

SCAR I1R

GGTGAATACCGATCATAGTCGAG

SCAR I1 86.1 F

SCAR

Fusarium wilt

I-1

11

TGTTGGCGGTAGTGATGAGA

52

-

R = 314, S = 583

H = 314 and 583

Gonzalez-Cendales et al. (2014)

SCAR I1 86.1 R

TCACCAATATTAGGCCCCTTT

Ve SNP F

SNP

Verticillium wilt

Ve

9

CCTTGATGGGGTTGATCTTTCGT

57

-

R = 476, S = 158 Other = 580

Kawchuk et al. (2001)

Ve SNP R

GTAGGTGAGTTTCTTGGACAGTCGA

SCAR Ph3 F

SCAR

Late blight

Ph3

9

CTACTCGTGCAAGAAGGTAC

50

-

S = 154, R = 176

Jung et al. 2015

SCAR Ph3 R

TCCACATCACCTGCCAGTTG

InDel2_Cf-9/Cf-4 F

InDel

Leaf mold

Cf-9/Cf-4

1

TCCTAAACCTCTATGGAATCTCAC

55

-

R = 434 (Cf-9c)

R = 297 (Cf-4)

Kim et al. (2017)

InDel2_Cf-9/Cf-4 R

GGAGTGAATTCGGAATACGACC

pcc12 Indel Rx4 F

InDel

Bacterial spot

Rx4

11

TCCACATCAAATGCGTTTCT

52

-

R = 113

S = 119

Pei et al. (2012)

pcc12 Indel Rx4 R

TTCCAATCCTTTCCATTTCG

Pto CAPSf

CAPS

Bacterial speck

Pto

5

ATCTACCCACAATGAGCATGAGCTG

60

RsaI

R = 552

S = 113 and 439

Coaker and Francis, (2004)

Pto CAPS R

GTGCATACTCCAGTTTCCAC

aSCAR= Sequence characterized amplified region, SNP = Single nucleotide polymorphism, InDel = PCR based Insertion-deletions, CAPS = Cleaved amplified polymorphic sequences.

bResistance genes of disease.

cCf-9 and its paralogs.

 

Gel electrophoresis

All the PCR and restriction-digested products were analyzed with 1% agarose gel electrophoresis in 1X TBE buffer (89 mM Tris-HCl, 89 mM boric acid, 2.5 mM EDTA, pH 8.3). The genomic DNA was stained with RedSafe Nucleic Acid Staining Solution (1/20,000) (iNtRON Biotechnology, Inc. Kr) and was visualized with UV light. The size of each band was estimated with reference to a size marker of 100 bp DNA ladder (BioRoN, Germany).

Results

Fungi-high-efficiency markers for marker-assisted selection (MAS) in tomato.

Five molecular markers linked with three fungal diseases were estimated to select tomato genotypes carrying resistance alleles for MAS programs. For Fusarium wilt, two markers SCAR I1 and SCAR 86.1 were applied to the target I-1 gene. However, the SNP marker is associated with Ve gene, which gives resistance to verticillium wilt. Besides, the SCAR Ph3 marker linked to Ph3 responsible for resistance to late blight. Finally, the InDel2_Cf-9/Cf-4 marker was used to detect resistance allele to leaf mold (Cf) disease.

Gene-based SCAR markers for I-1 resistance.

Two SCAR markers (SCAR I1 and SCAR I1 86.1) (Table 2) were used to detect resistant and susceptible tomato genotypes to fusarium wilt disease. The primer set SCAR I1 scored two bands of (130 and 92 bp) in all tested tomato genotypes, which refer to the presence of resistance allele I-1 (Fig. 1 and Table 3). This result indicated that the primer SCAR I1 has not differentiated between the resistant and susceptible tomato lines to F. oxysporum f. sp. lycopersici, consequently this primer SCAR I1 cannot be applied in the tomato breeding programs for the selection of resistance allele I-1 to fusarium wilt fungus.

 

Table 3

Tomato genotypes used to evaluate gene-based markers for resistances against tomato pathogens.

No.

Genotype

Resistance genes and DNA markers

Fusarium wilt (I-1)

Verticillium wilt (Ve)

Late blight (Ph3)

Leaf mold (Cf-9/Cf-4)

Bacterial spot (Rx4)

Bacterial speck (Pto)

SCARa I1

SCAR I1 86.1

Ve SNPb

SCAR Ph3

InDel2_Cf-9/Cf-4c

pcc12 Indel Rx4

Pto CAPSd

1

Solanum hirsutum 24036

RRe

-

-

RR

RR (Cf-9)

-

-

2

S. galapagense 0317

RR

rrf

-

RR

RR (Cf-9)

-

-

3

S. neoricki 0247

RR

-

-

Rrg

RR (Cf-9/Cf-4)

rr

Rr

4

S. arcanum 1346

RR

-

-

Rr

RR (Cf-9/Cf-4)

rr

RR

5

S. corneliomulleri 1274

RR

-

rr

-

RR (Cf-9/Cf-4)

rr

RR

6

S. pennellii 1733

RR

-

-

RR

RR (Cf-9)

rr

RR

7

S. huaylasense 1358

RR

-

-

-

RR (Cf-9/Cf-4)

rr

RR

8

S. pimpinellifolium 1342

RR

rr

-

RR

RR (Cf-9)

rr

RR

9

S. peruvianum 1333

RR

-

-

RR

RR (Cf-9/Cf-4)

rr

RR

10

S. habrochaites 1352

RR

-

-

-

RR (Cf-9)

rr

RR

11

S. chilense 56139

RR

-

-

RR

RR (Cf-9)

rr

RR

12

S. lycopersicon cv. Super Marmande

RR

rr

-

-

RR (Cf-9)

rr

Rr

13

S. lycopersicon cv. Strain B F1

RR

rr

-

-

RR (Cf-9/Cf-4)

rr

Rr

14

S. corneliomulleri 1283

RR

-

rr

-

RR (Cf-9/Cf-4)

rr

RR

15

S. habrochaites 1739

RR

-

-

-

-

rr

RR

16

S. pimpinellifolium 1279

RR

RR

rr

-

RR (Cf-9)

rr

RR

17

S. pimpinellifolium 1332

RR

RR

-

-

RR (Cf-9)

rr

RR

18

S. pennellii 2963

RR

-

-

-

RR (Cf-9)

rr

RR

19

S.pennellii 1942

RR

-

rr

-

RR (Cf-9/Cf-4)

rr

RR

SCARa = Sequence characterized amplified region, SNPb =Single nucleotide polymorphism, InDelc = PCR based Insertion-deletions and CAPSd = Cleaved amplified polymorphic sequence.

RRe = Resistance allele, homozygote, rrf = Susceptibility allele, homozygote, Rrg = Heterozygote, - = Absence of allele.

 

For SCAR I1 86.1, it scored one amplicon of 314 bp in two tomato accessions containing homozygous dominant allele I-1 e.g., S. pimpinellifolium 1279 and 1332. Furthermore, SCAR I1 86.1 recorded one amplified fragment with a molecular size of 583 bp in four tomato germplasms may be susceptible to fusarium wilt disease such as S. galapagense 0317, S. pimpinellifolium 1342, S. lycopersicon cv. Super Marmande and S. lycopersicon cv. Strain B F1, which have a recessive allele with homozygous (Fig. 2 and Table 3).

Gene-based SNP marker for Ve1 resistance.

PCR amplification of DNA from 19 tested tomato accessions using primer set Ve SNP, gave a faint band of 158 bp in the four tomato genotypes expected to be susceptible to fungus verticillium wilt i.e., S. corneliomulleri 1274 and 1283, S. pimpinellifolium 1279 and S. pennellii 1942 (Fig. 3 and Table 3). Moreover, the other15 tomato genotypes have not shown any unique bands. Our results have not recorded any tomato genotypes resistant to verticillium wilt disease.

Gene-based SCAR marker for Ph3 resistance.

A PCR assay was used by a single pair of primer SCAR Ph3 to amplify the resistance gene to late blight (Ph3). Among the 19 studied tomato genotypes, six lines were homozygous for the Ph3 allele, which gave a unique band of 176 bp like S. hirsutum 24036, S. galapagense 0317, S. pennellii 1733, S. pimpinellifolium 1342, peruvianum 1333 and S. chilense 56139 (Fig. 4 and Table 3). Three genotypes were heterozygous that scored two amplicons with molecular sizes of 154 and 176 bp e.g., S. neoricki 0247 and S. arcanum 1346 are expected to be Ph3 resistant. In addition, the other tomato lines have not scored any products. On the other hand, none of the studied tomato lines were homozygous recessive for the ph3 allele (Fig. 4 and Table 3).

Gene-based InDel marker for Cf-9/Cf-4 resistance.

The primer pair InDel2_Cf-9/Cf-4 was able to amplify a 434 bp PCR product from ten tomato genotypes have only the Cf-9 resistance allele including S. hirsutum 24036, S. galapagense 0317, S. pennellii 1733 and 2963, S. pimpinellifolium 1342, 1279 and 1332, S. habrochaites 1352, S. chilense 56139 and S. lycopersicon cv. Super Marmande (Fig. 5 and Table 3). On the other hand, the primer set InDel2_Cf-9/Cf-4 gave two bands of 297 and 434 bp in eight wild type tomato species viz., S. neoricki 0247, S. arcanum 1346, S. corneliomulleri 1274 and 1283, S. huaylasense 1358, S. peruvianum 1333, S. lycopersicon cv. Strain B F1 and S. pennellii 1942 carrying both the Cf-4 and Cf-9 resistance alleles. In contrast, none of the examined tomato lines has only a Cf-4 allele. Besides, S. habrochaites 1739 has not any Cf-4 or Cf-9 resistance loci (Fig. 5 and Table 3).

Bacteria-high-efficiency markers for MAS in tomato.

Two gene-based markers related to two bacterial diseases were examined to screen tomato lines carrying resistance alleles. For bacterial spot, pcc12 Indel Rx4 marker was used to the target Rx4. Besides, Pto CAPS markers associated with the Pto gene, responsible for resistance to bacterial speck disease.

Gene-based InDel marker for Rx4 resistance.

Genomic PCR using primer set pcc12 Indel yielded a single band of 119 bp for the recessive allele in all tested tomato genotypes, except S. hirsutum 24036 and S. galapagense 0317 have not recorded any products (Fig. 6 and Table 3). On the other hand, none of the examined tomato lines has the dominant allele for Rx4 resistance gene.

Gene-based CAPS marker for Pto resistance.

A total number of 19 tomato genotypes were subject to CAPS marker analysis. Primer Pto CAPS amplified a 552 bp band from both bacterial speck resistant and susceptible tomato genotypes (Fig. 7a and Table 3). The restriction enzyme RsaI has not cut the amplicon from the homozygous resistant tomato accessions involving S. arcanum 1346, S. corneliomulleri 1274 and 1283, S. pennellii 1733, 2963 and 1942, S. huaylasense 1358, S. pimpinellifolium 1342, 1279 and 1332, S. peruvianum 1333, S. habrochaites 1352 and 1739 and S. chilense 56139, but digested the amplicon from the susceptible tomato genotypes into two amplified fragments, 113 and 439 bp (none of the two fragments were obtained in 19 the tested tomato genotypes) (Fig. 7b and Table 3). Besides, pto CAPs primer scored three alleles of 113 bp, 439 and 552 bp in the three tomato genotypes, which were heterozygous such as S. neoricki 0247, S. lycopersicon cv. Super Marmande and S. lycopersicon cv. Strain B F1 (Fig. 7b and Table 3). In contrast, S. hirsutum 24036 and S. galapagense 0317 have not shown any bands. None of the tested tomato genotypes carry a recessive allele for the Pto gene (Fig. 7 and Table 3).

Discussion

Production of tomato is being threatened by multiple diseases e.g., fungi, bacteria, viruses, insects, and nematodes. Marker-assisted selection (MAS) is an indirect screening process; whereas a trait of interest is screened depending on molecular markers, which can be applied in the tomato breeding programs for the selection of resistance alleles of pathogens. In this study, we used seven molecular markers linked with three fungal diseases and two bacterial diseases to select tomato lines carrying resistance loci for MAS programs.

In this work, primer set SCAR I1 gave false-positive results for the presence of the I-1 locus, responsible for resistance to fusarium wilt disease in the tomato. This marker has not separated resistance and susceptible alleles for the I-1 gene. In contrast, primer pair SCAR I1 86.1 well separated both dominant and recessive alleles at each locus. The PCR results successfully amplified DNA amplicons for the I-1 locus from both resistant (314 bp) and susceptible (583 bp) tomato genotypes. As a result, it is expected that the SCAR I1 86.1 marker would be beneficial for MAS to resistance against fungus F. oxysporum f. sp. lycopersici race 1. These results were in an agreement with Catanzariti and Jones (2010); Takken and Rep (2010) mentioned that fusarium wilt disease threatens tomato production worldwide. Fusarium wilt fungus in tomato is controlled by main genes for resistance introgressed from wild tomato species. The resistance gene I-1, introgressed from S. pimpinellifolium, refers to resistance against race 1 by recognition of Avr1gene (Houterman et al. 2008). The co-dominant SCAR markers used in this study should permit routine marker-assisted selection (MAS) for resistance to wilt fusarium fungus in the tomato breeding programs. This would allow early screening of resistant lines without inoculation steps, waiting for a long period until the appearance of symptoms. Mutlu et al. (2008) mentioned that co-dominant SCAR markers linked to dominant resistance genes against wilt fusarium fungus are more informative and easier in the eggplant breeding programs, compared with other markers.

Our results have not recorded any 19 tested tomato genotypes resistant to verticillium wilt disease. Resistance to V. dahlia and V. albo-atrum fungi was identified from S. lycopersicum line Peru wild and potato plants, respectively (Schaible et al. 1951; Kawchuk et al. 2001). The two resistance loci Ve1 and Ve2 have been identified for resistance to verticillium wilt (Diwan et al. 1999). Arens et al. (2010) developed primers as well as SNP markers to amplify either Ve1 or Ve2. Primers specific to Ve1 and Ve2 were used to amplify fragments in both susceptible and resistant varieties (homozygous and heterozygous resistance).

In this research, we indicated new tomato genotypes have a dominant allele of Ph3 i.e., S. hirsutum 24036, S. galapagense 0317, S. pennellii 1733, S. pimpinellifolium 1342, S. peruvianum 1333 and S. chilense 56139. Besides, two resistant tomato wild types were heterozygous involving S. neoricki 0247 and S. arcanum 1346. The latter genotypes may be introgressed from lines containing the dominant allele. Resistance sources to late blight disease in tomato are supplied by Ph3 gene produced from S. chilense (Miranda et al. 2010; Elsayed et al. 2011), S. hirsutum (Elafifi et al. 2019), S. pennellii (Li et al. 2011), S. pimpinellifolium (Irzhansky and Cohen 2006; Zhang et al. 2014), S. arcanum (Akhtar et al. 2016) and S. habrochaites LYC4 (Finkers et al. 2007). Our results showed that a co-dominant SCAR marker was effective in differentiation between the homozygous and heterozygous of Ph3 allele. This marker gave results matched to results observed by Hittalmani et al. (2000) and Jung et al. (2015) who used the SCAR marker for screening of resistance gene Ph3 that will be a powerful tool in tomato breeding programs. Besides, molecular markers can reduce the breeding period. It is clear that the SCAR marker applied in this work would be beneficial for screening tomato lines made by crossing plants that are resistant to late blight. Consequently using gene-based markers, such as strenuous crossing and offspring testing to genotype the Ph3 gene could be averted.

In the current investigation, we discovered that the indel marker discriminated tomato genotypes carrying Cf-9 from Cf-4. Genotyping with the Indel marker showed that all tested tomato lines carry the Cf-9 allele, except S. habrochaites 1739. In addition, indel marker amplified products not only from the Cf-9 gene but also from its homologs. Interestingly, eight tomato accessions carry both the Cf-9 and the Cf-4 resistance loci including S. neoricki 0247, S. arcanum 1346, S. corneliomulleri 1274 and 1283, S. huaylasense 1358, S. peruvianum 1333, S. lycopersicon cv. Strain B F1 and S. pennellii 1942. These lines will be useful in the tomato breeding programs of resistance against leaf mold disease. Similar data were obtained by Kruijt et al. (2005) mentioned that the resistance gene Cf-9 was found in two wild tomato types viz., S. habrochaites and S. pimpinellifolium, while its close homolog, the Cf-4 resistance allele was indicated in six tomato accessions e.g., S. chilense, S. peruvianum, S. habrochaites, S. parviflorum, S. lycopersicum and S. chmielewskii. Kim et al. (2017) distinguished between Cf-9 and Cf-4 alleles using SNP and InDel markers that will be beneficial for MAS of tomato varieties resistant to leaf mold. Durable resistance to the leaf mold disease caused by fungi C. fulvum has been the main purpose for breeders (Stevens and Rick 1988; Rivas and Thomas 2005). Introgressions of Cf genes inside S. lycopersicum supplied with genetic resources resistant to leaf mold (Thomas et al. 1997; Kruijt et al. 2005). The Cf-9 resistance gene was highly homologous with the Cf-4 gene with 95.5% and 91% at the DNA and amino acid levels, respectively (Parniske et al. 1997; Parniske and Jones 1999).

In our study, all tested tomato lines recorded susceptible to bacterial spot disease, using pcc12 Indel marker, except Solanum hirsutum 24036 and S. galapagense 0317 have not shown any products. Similar studies were made by Yuqing et al. (2018) mentioned that no commercial tomato cultivars are resistant to bacterial diseases. Pei et al. (2012) found that resistance genes to bacterial spot disease from wild tomato species and incorporating them into tomato cultivars are important for disease resistance. The resistant accession S. pimpinellifolium PI128216 that carries the Rx4 gene on chromosome 11 referring to hypersensitivity response (HR) and field resistance to Xanthomonas campestris pv. vesicatoria strain T3 (Robbins et al. 2009).

For Pto locus, PCR products of DNA from 19 tomato genotypes and subsequent digestion by RsaI were performed using the CAPS marker. After restriction with RsaI, 14 wild tomato types have resistance gene Pto such as S. corneliomulleri 1274 and 1283, S. peruvianum 1333 and S. chilense 56139 (Hörger 2011), S. arcanum 1346, S. pennellii 1733, 2963 and 1942, S. huaylasense 1358, S. pimpinellifolium 1342, 1279 and 1332 (Orsi et al. 2012), S. habrochaites 1352 and 1739 (Thapa et al. 2015). Furthermore, three tomato lines were heterozygous e.g., S. neoricki 0247, S. lycopersicon cv. Super Marmande and S. lycopersicon cv. Strain B F1. These lines were introgressed from tomato germplasms carrying the dominant allele of Pto. These findings were synchronized with results previously obtained by Yang and Francis (2005) identified the Pto gene responsible for resistance to bacterial speck by a co-dominant CAPS marker, which is more exhausting and less easy compared with the SCAR marker. Orsi et al. (2012) determined tomato cultivars resistant to Pseudomonas syringae pv. tomato by a semi-dominant allele of S. pimpinellifolium that was introgressed into S. lycopersicum in the past century. Pedley and Martin (2003) mentioned that the Pto dominant allele was widely applied to bacterial speck resistance in tomato. Because the Pto gene is semi-dominant, symptoms of infection with P. syringae pv. tomato were obtained in hybrids, which have one copy of the Pto gene (Pedley and Martin 2003). Completely resistant lines avert any damage caused by the pathogen, so decreasing agrochemical operations. Besides, seed production companies can benefit from molecular markers linked to the dominant allele (Pto) to generate tomato cultivars resistant to P. syringae pv. tomato for breeding programs depending on marker-aided selection (MAS) (Collard and Mackill 2008).

Conclusions

The gene-based markers (SCAR, CAPS, SNP, and InDel) used in this work should permit routine marker-assisted selection (MAS) for resistance against fungal and bacterial pathogens in tomato. In this study, we identified new tomato lines resistant to multiple diseases, and their pyramiding into domesticated tomato will take a short time compared with the classical breeding ways, which require inoculation steps and waiting for a long period till the appearance of symptoms. In addition, the classical breeding ways produce only heterozygous lines, while gene-based markers identify non-segregating homozygous resistant tomato genotypes.

Declarations

Local and national regulations

All Studies complies with local and national regulations.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analyzed during this work already exist in this published article.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was funded by National Research Centre (NRC).

Authors’ contributions

Dr. Heba A. Mahfouze carried out SCAR, CAPS, SNP and InDel markers and Prof. Dr.  Sherin A. Mahfouze performed writing of the manuscript.

Acknowledgements

The authors are thankful to the National Research Centre (NRC) to fund this study.

Authors’ information

1Genetics and Cytology Department, Genetic Engineering and Biotechnology Research Division,

National Research Centre (NRC), Dokki, 12622, Egypt.

References

Akhtar MY, Saleem Q, Iqbal M, Asghar A Hameed & Sarwar N. 2016. Evaluation of tomato genotypes for late blight resistance using low tunnel assay. Journal of Plant Pathology 98 (3): 421-428.

Arens P, Mansilla C, Deinum D, Cavellini L, Moretti A, Rolland S, van der Schoot H, Calvache D, Ponz F, Collonnier C, Mathis R, Smilde D, Caranta C & Vosman B. 2010. Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theor Appl Genet 120:655-664.

Astua-Monge G, Minsavage GV, Stall RE, Vallejos CE, Davis MJ & Jones JB. 2000. Xv4-vrxv4: a new gene-for-gene interaction identified between Xanthomonas campestris pv. vesicatoria race T3 and wild tomato relative Lycopersicon pennellii. Mol Plant Microbe Interact 13:1346-1355.

Bohn G & Tucker C. 1939. Immunity to fusarium wilt in the tomato. Science 89:603-604.

Catanzariti AM & Jones DA (2010) Effector proteins of extracellular fungal plant pathogens that trigger host resistance. Funct Plant Biol 37:901-906.

Coaker GL & Francis DM. 2004. Mapping, genetic effects, and epistatic interaction of two bacterial canker resistance QTLs from Lycopersicon hirstum. Theor Applied Genet 108: 1047-1055.

Collard BCY & Mackill DJ. 2008. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Phil Trans R Soc B 363:557-572.

Diwan N, Fluhr R, Eshed Y, Zamir D & Tanksley SD. 1999. Mapping of Ve in tomato: a gene conferring resistance to the broad-spectrum pathogen, Verticillium dahliae race 1. Theor Appl Genet 98:315-319.

Dixon MS, Jones DA, Keddie JS, Thomas CM, Harrison K & Jones JDG. 1996. The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell 84:451-459.

Dixon MS, Hatzixanthis K, Jones DA, Harrison K & Jones JDG. 1998. The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number. Plant Cell 10:1915-1925.

Elafifi ST, Ramadan WA, El-Saady WA & Abdelmalek PA. 2019. Inheritance of resistance against Phytophthora Infestans in wiled tomato genotype (Lycopersicon hirsutum l03684). J. Plant Production, Mansoura Univ 10 (8):675- 67.

Elsayed AY, Silva DJH, Mizubuti ESG & Carneiro PCS. 2011. Combining the monogenic and polygenic resistant genes to late blight in tomato. Journal of Plant Breeding and Crop Science 3:251-259.

Finkers R, van Heusden A, Meijer-Dekens F, van Kan J, Maris P & Lindhout P. 2007. The construction of a Solanum habrochaites LYC4 introgression line population and the identification of QTLs for resistance to Botrytis cinerea. Theor Appl Genet 114:1071-1080.

Foolad MR, Merk HL & Ashrafi H. 2008. Genetics, genomics and breeding of late blight and early blight resistance in tomato. Crit Rev Plant Sci 27:75-107.

Foolad MR. 2007. Genome mapping and molecular breeding of tomato. Int J Plant Genomics. doi:10.1155/2007/64358.

Fradin EF & Thomma BPHJ. 2006. Physiology and molecular aspects of verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol 7:71-86.

Gonzalez-Cendales Y, Do HTT, Lim GTT, McGrath DJ, Catanzariti AM & Jones DA. 2014. Application of CAPS markers to the mapping and marker-assisted breeding of genes for resistance to fusarium wilt in the tomato. P.91-107. In: CLEAVED AMPLIFIED POLYMORPHIC SEQUENCES (Y. Shavrukov ed). Nova Science Publishers, Inc.243 pp.

Gonzalez-Cendales Y, Catanzariti AM, Baker B, Mcgrath DJ & Jones DA. 2015. Identification of I-7 expands the repertoire of genes for resistance to fusarium wilt in tomato to three resistance gene classes. Mol Plant Pathol. doi: 10.1111/mpp.12294.

Grattidge R & O’Brien RG. 1982. Occurrence of a third race of Fusarium wilt of tomatoes in Queensland. Plant Dis 66: 165-166.

Hittalmani S, Parco A, Mew TV, Zeigler RS & Huang N. 2000. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor Appl Genet 100:1121-1128.

Hörger AC.  2011. Evolution of disease resistance genes in wild tomato species. Dissertation, LMU München: Faculty of Biology.189 Pp.

Houterman PM, Cornelissen BJC & Rep M. 2008. Suppression of plant resistance gene-based immunity by a fungal effector. PLoS Pathogens 4 (5):e1000061.

Irzhansky I & Cohen Y. 2006. Inheritance of resistance against Phytophtora infestans in Lycopersicon pimpinellifolium L3707. Euphytica 149:309-316.

Jia Y, Loh YT, Zhou J & Martin GB. 1997. Alleles of Pto and Fen occur in bacterial speck-susceptible and fenthion-insensitive tomato cultivars and encode active protein kinases. Plant cell 9(1):61-73.

Jones JB, Stall RE & Bouzar H. 1998. Diversity among xanthomonads pathogenic on pepper and tomato. Annu Rev Phytopathol 36:41-58.

Jung J, Kim HJ, Lee JM, Oh CS, Lee HJ & Yeam I. 2015. Gene-based molecular marker system for multiple disease resistances in tomato against Tomato yellow leaf curl virus, late blight, and verticillium wilt. Euphytica 205:599-613.

Kawchuk LM, Hachey J, Lynch DR, Kulcsar F, van Rooijen G, Waterer DR, Robertson A, Kokko E, Byers R, Howard RJ, Fischer R & Prüfer D. 2001. Tomato Ve disease resistance genes encode cell surface-like receptors. PNAS 98:6511-6515.

Kim MJ & Mutschler MA. 2006 Characterization of late blight resistance derived from Solanum pimpinellifolium L3708 against multiple isolates of the pathogen Phytophthora infestans. J Amer Soc Hort Sci 131:637-645.

Kim B, Hwang IS, Lee HJ & Oh CS. 2017. Combination of newly developed SNP and InDel markers for genotyping the Cf-9 locus conferring disease resistance to leaf mold disease in the tomato. Mol Breeding 37:59.

Kole C, Ashrafi H, Lin G & Foolad M. 2006. Identification and molecular mapping of a new R gene, Ph-4, conferring resistance to late blight in tomato. Solanaceae Conference, University of Wisconsin, Madison, Abstract 449.

Kruijt M, Kip DJ, Joosten MH, Brandwagt BF & de Wit PJ. 2005. The Cf-4 and Cf-9 resistance genes against Cladosporium fulvum are conserved in wild tomato species. Mol Plant Microbe Interact 18:1011-1021.

Lee JM, Oh CS & Yeam I. 2015. Molecular markers for selecting diverse disease resistances in tomato breeding programs. Plant Breed Biotech 3(4):308-322.

Li J, Liu L, Bai Y, Finkers R, Wang F, Du Y, Yang Y, Xie B, Visser RGF & van Heusden AW. 2011. Identification and mapping of quantitative resistance to late blight (Phytophthora infestans) in Solanum habrochaites LA1777. Euphytica 179:427-437.

Mahfouze SA & Mahfouze HA. 2019. Comparison between CAPS and SCAR markers for detection of Tomato Yellow Leaf Curl Virus resistance genes Ty-1, Ty-2, Ty-3 and Mi-1.2 in tomato genotypes. Jordan journal of Biological Sciences (JJBS) 12 (2):123-133.

Merk HL, Ashrafi H & Foolad MR. 2012. Selective genotyping to identify late blight resistance genes in an accession of the tomato wild species Solanum pimpinellifolium. Euphytica 187: 63-75.

Merk HL& Foolad MR. 2012. Parent-offspring correlation estimate of heritability for late blight resistance conferred by an accession of the tomato wild species Solanum pimpinellifolium. Plant Breeding 131:203-210.

Miranda BEC, Suassuna ND & Reis A. 2010. Mating type, mefenoxam sensitivity, and pathotype diversity in Phytophthora infestans isolates from tomato in Brazil. Pesquisa Agropecuária Brasileira 45:671-679.

Mutlu N, Boyaci FH, Göçmen M & Abak K. 2008. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant.  Theor Appl Genet 117:1303-1312.

Orsi I, Malatrasi M. Belfanti E, Gullı` M & Marmiroli N. 2012. Determining resistance to Pseudomonas syringae in tomato, a comparison of different molecular markers. Mol Breeding 30:967-974.

Parniske M, Hammond-Kosack KE, Golstein C, Thomas CM, Jones DA, Harrison K, Wulff BB, & Jones JD. 1997. Novel disease resistance specificities result from sequence exchange between tandemly repeated genes at the Cf-4/9 locus of tomato. Cell 91:821-832.

Parniske M & Jones JDG. 1999. Recombination between diverged clusters of the tomato Cf-9 plant disease resistance gene family. Proc Natl Acad Sci U S A 96:5850-5855. doi:10.1073/pnas.96.10.5850.

Pedley KF & Martin GB. 2003. Molecular basis of Pto-mediated resistance to bacterial speck disease in tomato. Annu Rev Phytopathol 41:215-243.

Pei C, Wang H, Zhang J, Wang Y, Francis DM & Yang W. 2012. Fine mapping and analysis of a candidate gene in tomato accession PI128216 conferring hypersensitive resistance to bacterial spot race T3. Theor Appl Genet 124:533-542.

Peries OS. 1971. Environmental factors affecting plant disease. Tea Q 42:188-195.

Rivas S & Thomas CM. 2005. Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum. Ann Rev Phytopathol 43:395-436.

Robbins MD, Darrigues A, Sim SC, Masud MA & Francis DM. 2009. Characterization of hypersensitive resistance to bacterial spot race T3 (Xanthomonas perforans) from tomato accession PI 128216. Phytopathology 99:1037-1044.

Rodewald J & Trognitz B. 2013. Solanum resistance genes against Phytophthora infestans and their corresponding avirulence genes. Mol Plant Pathol 14:740-757.

Salmeron JM, Oldroyd JED, Rommens CMT, Scofield SR, Kim HS, Lavelle DT, Dahlbeck D & Staskawicz BJ. 1996. Tomato Prf is a member of the leucine-rich repeat class of plant disease resistance genes and lies embedded within the Pto kinase gene cluster. Cell 86:123-133.

Schaible L, Cannon OS & Waddoups V. 1951. Inheritance of resistance to verticillium wilt in a tomato cross. Phytopathology 41:986-990.

Scott JW & Jones JP. 1989a Monogenic resistance in tomato to Fusarium oxysporum f. sp. lycopersici race 3. Euphytica 40:49-53.

Scott JW & Jones JB. 1989b. Inheritance of resistance to foliar bacterial spot of tomato incited by Xanthomonas campestris pv. vesicatoria. J Am Soc Hortic Sci 114:111-114.

Scott JW, Agrama HA & Jones JP. 2004. RFLP-based analysis of recombination among resistance genes to fusarium wilt races 1, 2 and 3 in tomato. J Am Soc Hortic Sci 129(3):394-400.

Shi A, Vierling R, Grazzini R, Chen P, Caton H & Panthee D. 2011. Identification of molecular markers for Sw-5 gene of Tomato spotted wilt virus resistance. Amer J Biotechnol Mol Sci 1: 8-16.

Simons G, Groenendijk J, Wijbrandi J, Reijans M, Groenen J, Diergaarde P, Van der Lee T, Bleeker M, Onstenk J, de Both M, Haring M, Mes J, Cornelissen B, Zabeau M & Vos P. 1998. Dissection of the Fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell 10:1055-1068.

Stevens MA & Rick CM. 1988. Genetics and breeding. p. 35-109. In: The tomato crop (J.G. Atherton, J. Rudich, eds.). Chapman Hall, London. 684 pp

Takken FLW, Thomas CM, Joosten MHAJ, Golstein C, Westerink N & Hille J. 1999. A second gene at the tomato Cf-4 locus confers resistance to Cladosporium fulvum through recognition of a novel avirulence determinant. Plant J 20:279-288.

Takken F & Rep M. 2010. The arms race between tomato and Fusarium oxysporum. Molecular Plant Pathology 11:309-314.

Thapa SP, Miyao EM, Michael Davis R & Coaker G. 2015. Identification of QTLs controlling resistance to Pseudomonas syringae pv. tomato race 1 strains from the wild tomato, Solanum habrochaites LA1777. Theor Appl Genet 128:681-692.

Thomas CM, Jones DA, Parniske M, Harrison K, Balint-Kurti PJ, Hatzixanthis K & Jones JDG. 1997. Characterization of the tomato Cf-4 gene for resistance to Cladopsorium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9. Plant Cell 9:2209-2224.

Van Ooijen G, van den Brug HA, Cornelissen BLC & Takken F. 2007. Structure and function of resistance proteins in solanaceous plants. Annu Rev Phytopathol 45:3.1-3.30.

Wang H, Hutton SF, Robbins MD, Sim SC, Scott JW, Yang W, Jones JB & Francis M. 2011. Molecular mapping of hypersensitive resistance from tomato 'Hawaii 7981' to Xanthomonas perforans race T3. Phytopathology 101:1217-1223.

Yang W & Francis DM. 2005. Marker-assisted selection for combining resistance to bacterial spot and bacterial speck in tomato. J Am Soc Hortic Sci 130:716-721.

Yuqing W, Axian Z, Hipeng G & Wenca Y.  2018. Breeding for resistance to tomato bacterial diseases in China: Challenges and prospects. Horticultural Plant Journal 4 (5):193-207.

  Zhang C, Liu L, Zheng Z, Sun Y, Zhou L, Yang Y, Cheng F, Zhang Z, Wang X, Huang S, Xie B, Du Y, Bai Y & Li J. 2013. Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato. Theor Appl Genet 126:2643-2653.

Zhang C, Liu L, Wang X, Vossen J, Li G, Li T, Zheng Z, Gao J, Guo Y, Visser RGF, Li J, Bai Y & Du Y.  2014. The Ph-3 gene from Solanum pimpinellifolium encodes CC-NBS-LRR protein conferring resistance to Phytophthora infestans. Theor Appl Genet 127(6):1353-1364.