Sampling and processing
Healthy clams C. sinensis were collected from a clam farm in Jiangsu, China. They were cultured in seawater for two weeks at room temperature and fed with 0.005 g/mL of Chlorella once a day. Natural seawater was filtered with a double-layer 500-mesh sieve after precipitation, disinfection, and aeration for culturing clams and replaced once a day.
Twenty-four healthy clams (body weight, 10.09±2.81 g; shell length, 3.01±0.38 cm) were randomly selected and divided into six parallel groups (labeled 1 to 6), each containing four clams. Feeding was withheld for 2 days in continuously oxygenated seawater. Thereafter, the clams were fed with 6×105 cells/L of Chlorella until waste matter (feces) was completely expelled. During this period, clam defecation was observed every 2 h. The feces were collected from the bottom of the beaker using siphon method.
DNA isolation
Total DNA was isolated from clam feces and foot tissue (used as positive control). Fecal DNA isolation was performed using the phenol/chloroform method in accordance with a previous study of Sambrook [48] with some modifications as follows:
- Place the feces on a 200-mesh silk screen, and wash it slowly with double-distilled water (ddH2O) to remove impurities on the fecal surface.
- Transfer each 200 mg fecal sample into a new 1.5 mL Eppendorf tube.
- Add 100 μL ddH2O, blow the feces repeatedly with a straw to make it homogenate, and then vortex fully.
- Centrifuge for 3 min at 800 × g, and then transfer the supernatant into a new 1.5 mL tube. Add 400 μL of 10% SDS and 10 μL of proteinase K into each tube, and then vortex fully.
- Incubate the tubes for 1 h in a 65 °C water bath with occasional shaking (~10 min).
- Add 10 μL of 20 mg/mL RNase, and incubate the tubes in a 37 °C water bath for 10 min. Centrifuge for 3 min at 12,000 × g, and then transfer the supernatant into a new 1.5 mL tube.
- Add an equal volume of ice-cold Tris-saturated phenol (pH 7.9), and mix upside down and store at room temperature for 5 min.
- Centrifuge at 12,000 × g for 12 min, and then transfer the supernatant into a new 1.5 mL tube.
- Add an equal volume of chloroform, and mix upside down. Centrifuge at 12,000 × g for 10 min, and then transfer the supernatant into a new 1.5 mL tube.
- Add an equal volume of isopropanol, mix upside down, and store at room temperature for 3 min. Centrifuge at 12,000 × g for 12 min, and then remove the supernatant completely.
- Wash the DNA pellet twice with 1 mL ice-cold 70% ethanol.
- Air dry.
- Resuspend the DNA pellet in 30 μL of TE buffer, and then store at -40°C before use.
Primer design and PCR amplification
To determine DNA quality, PCR amplification was conducted with primers designed on the basis of mitochondrial and nuclear genomic DNA sequences. The sequences of mitochondrial (COXI and 16S rRNA) and nuclear genomic DNA (18S rRNA and partial sequence of nuclear DNA) were retrieved and downloaded from NCBI (https://www.ncbi.nlm.nih.gov/). PCR primers were designed by Primer Premier 5.0 software and are shown in Table 2. PCR amplification was conducted in a 15 μL reaction volume, containing 1.0 μL of DNA template, 0.2 μL of Taq (Takara, Dalian, China), 0.8 μL of primers (including forward and reverse primers), 1.0 μL of dNTPs, 1.5 μL of 10× buffer, and 10.5 μL of ddH2O. The PCR amplification procedure was conducted as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 10 min. The PCR amplification products were detected by 1.5% agarose gel electrophoresis and captured with a gel imaging system (Universal Hood II, Bio-Rad, USA). The purified PCR products were sequenced by Shanghai Map Biotech Co., Ltd. The sequencing results were checked by Chromas software and blasted by BLAST online software (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Table 2 Primers and sequences
Primer
|
Sequence (5′–3′)
|
Source
|
Gene ID
|
Product size/bp
|
CsCOXI
|
F:TGGTGGTTTAACTGGTGTTGTT
R:AAAACACCAAACCACGCTGAG
|
Mitochondrial DNA from C. sinensis
|
26898108
|
404
|
Cs16S
|
F:GATCGTACCTGCCCTGTGAT
R:ACCACTCTAGCTTACGCCGA
|
Mitochondrial DNA from C. sinensis
|
26898076
|
548
|
Cs18S
|
F:TGCGTTCAAGGTGTCGATGT
R:GGGGCCGACATGAAATGAAA
|
Nuclear genomic DNA from C. sinensis
|
Unregistered
|
581
|
Cspds
|
F: ACTTCAGAATTCAGAATTCAG
R: GTCACGCACAATGTAACG
|
Nuclear genomic DNA from C. sinensis
|
Unregistered
|
187
|
Effects of soaking time and environmental temperature on the degradation of feces and fecal DNA
To explore the effects of environmental temperature and soaking time on fecal texture changes and fecal DNA degradation, the fecal samples were collected immediately after the clams defecated. They were then soaked in clean seawater and stored at 28 °C, 15 °C, and 4 °C. To observe fecal texture changes, the fecal samples were placed on clean slides, observed, and photographed with a stereoscope (Nikon SME 1500, Nikon, Japan) at 0, 5, 10, 15, 20, and 25 days after soaking in seawater. Fecal DNA isolation was conducted using the modified phenol/chloroform method mentioned above, and the fecal DNA quality was determined by Ultramicro Nucleic Acid Analyser (Eppendorf BioPhotometer® D30, Eppendorf, Germany), electrophoresis, and PCR amplification.
Data analysis
The DNA purity was confirmed by Ultramicro Nucleic Acid Analyser (Eppendorf BioPhotometer® D30, Eppendorf, Germany). The DNA and PCR amplification products were detected by 1% and 1.5% agarose gel electrophoresis respectively, and the gel images were observed and captured with a gel imaging system (Universal Hood Ⅱ, Bio-Rad, America).