Patients
All study participants signed written consent forms to be enrolled in the study with the confidentiality of their data assured. This study was approved by the Ethics Committee of the Endocrinology Department of Harbin First Hospital. Serum samples (20) were obtained from Harbin First Hospital, including 10 patients with hyperuricemic nephritis and 10 healthy individuals. The details of the patients with hyperuricemic nephropathy are as follows: patients 1 to 9, males, aged 28, 35, 35, 40, 45, 52, 55, 57, 59 with hyperuricemic interstitial glomerulonephritis, six of them were on allopurinol while three of them took febuxostat before the blood sample was taken. Patient 10, male, 65 years old, suffering from diabetes, hyperuricemia, and chronic renal failure who has been on febuxostat and insulin for a long time. The 10 healthy people were males, aged between 26 and 57 years old. Human peripheral blood mononuclear cells (PBMCs) were extracted with a PBMCs separation kit (Haoyang Biological products Technology Co., Ltd., Tianjin) followed by the Trizol method for the extraction of RNA or real-time quantitative PCR (qPCR) detection.
Animals
Male wild-type (WT) C57BL/6 mice, 8 weeks old, were purchased from Liaoning Changsheng Biological Co., Ltd. While FGF21 gene knockout C57BL/6 mice, 8 weeks old, were purchased from Beijing View Solid Biotechnology Co., Ltd. All mice were kept in cages fitted with air supply filters at 22 ~ 26℃, with a relative humidity of 40%~45% and a light-dark period of 12 hours, and were fed ad libitum. All animal studies were conducted in accordance with the guidelines formulated by the Animal Protection and Utilization Committee of Northeast Agricultural University.
Acquisition of FGF21
Human FGF21 was selected for this study. Recombinant SUMO-FGF21 plasmid was added to the E. coli competent cell Rossetta (Bioengineering technology company, Shanghai) followed by bacteria fermentation. After the fermentation process, the cells were collected, the supernatant was extracted, and the SUMO-FGF21 protein was obtained by His Trap TM FF crude Colum (GE Health, USA) affinity chromatography. The SUMO-FGF21 complex was digested with SUMO protease for 8 hours followed by a second affinity chromatography to finally obtain the mature FGF21 protein. The molecular weight and purity of the FGF21 protein were analyzed by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and high-performance liquid chromatography (HPLC).
Grouping and establishment of hyperuricemic nephropathy model in mice
Mice models of hyperuricemic nephropathy were given adenine (160 mg/kg) and potassium oxysalt (2400 mg/kg) (Sigma-Aldrich, USA) [20] by gavage while the normal controls were given intragastric administration of saline at the same volume once a day for 60 days. The experimental animals were grouped into 5 as follows: normal control group, model control group, FGF21 gene knockout group, FGF21 low dose group, and FGF21 high dose group. The specific treatment regimens were as follows: low dose FGF21 (1mg/kg) group, (n = 6): FGF21 was injected intraperitoneally every day for 30 days; high dose FGF21 (5mg/kg) group, (n = 6): FGF21 was injected intraperitoneally every day for 30 days; normal control (n = 6), model control group (n = 6), FGF21 gene knockout group (n = 6): intraperitoneal injection of the same volume of normal saline every day for 30 days. At the end of the study, the mice were euthanized and blood and kidney samples were taken for further analysis.
Detection of renal function
Serum samples from the collected blood samples were isolated and sent to the Harbin Electric Power Hospital for the detection of renal function indices such as blood urea nitrogen (BUN), Serum creatinine (Scr), cystatin C (CysC), and β 2-microglobulin (β 2-MG).
Histopathological examination
Sample kidney tissues from the different experimental groups were fixed in 4% paraformaldehyde for 7 days, then dehydrated and embedded in paraffin. Tissue sections (7µm) were cut using a microtome (Lecia, Germany), and then fully stretched in a water bath at 42℃. The sections were then transferred to a glass slide for hematoxylin-eosin (HE) staining or Masson staining. Finally, the blue area stained by Masson staining was observed under an inverted optical microscope and was analyzed by Imagine J software.
Immunohistochemistry
The prepared paraffin sections were put into an oven at 60℃ for one hour and then dewaxed in xylene and ethanol with different concentration gradients. After dewaxing, the antigen was repaired followed by incubation with anti F4/80 antibody (dilution: 1:200, Abcam, USA) at 4 ℃ for 12 hours. The slides were washed twice with PBS followed by incubation with goat anti-rabbit secondary antibody (R&D, USA) at 37 ℃ for 1 hour. Again, the slides were washed twice with PBS and the reaction visualized with diaminobenzidine (DAB) for 8 minutes. The reaction was terminated by rinsing with water followed by hematoxylin-eosin staining. Finally, the slide sections were observed under an inverted optical microscope and the results analyzed by Image J software.
Cell culture
Mouse Glomerular Mesangial cells (GMCs) (ATCC, USA) were cultured in Dulbecco's modified eagle's medium (DMEM) (70%) and Ham's F12 nutrient medium (25%) containing 5% fetal bovine serum (FBS) (Gibco, NY, USA). The concentration of penicillin and streptomycin in the culture medium was 100U/ml and cultured in a 37 ℃ incubator with 5% carbon dioxide. After fusion of the GMCs cells for about 80%, the culture medium was discarded, washed with PBS for 3 times, and a serum-free medium was added to the 24-well plate. The cells were given lipopolysaccharide (LPS) at a concentration of 500ng/ml followed by monosodium uric acid (MSU) (Sigma, USA) at a concentration of 0, 100, 200, 400, 800, and 1600ng/ml (2 wells per concentration). The cells were then stimulated for a period of 24 hours. Finally, protein expression of IL-1β was estimated to determine the best concentration and period of action of MSU. After determining the optimal concentration and action time of MSU, 100nM and 1000nM of FGF21 were added to the cells to observe the therapeutic effect. For the study of inhibition of Protein kinase B (Akt), GMCs cells were grown in a medium containing 10µM GSK690693 (an Akt inhibitor) (Beyotime, Shanghai). At the end of the study, the cells were collected for qPCR, Elisa and Western blotting analysis.
Determination of β klotho in GMCs cells
GMCs cells in normal culture were collected, centrifuged at 1500r/min at 4℃ for 5min, then washed with PBS for three times, and then resuspended with 500ul PBS. The cells were divided into control and experimental groups (two wells per each group), and anti-klotho antibody (Runmai Biotechnology, Shanghai, diluted at 1:100) was added and incubated at 37℃ for 1h. After incubation, the cells were centrifuged and washed with PBS for three times. Donkey anti-sheep perCP antibody (Abcam, USA, diluted 1:1000) was added to the control group and experimental groups respectively and incubated for 1 h at room temperature in the dark. After incubation, the cells were washed with PBS for three times again, and the peak offsets of the different groups of cells were detected by flow cytometry.
qPCR
Total RNA was extracted from the kidney of the mice using Trizol reagent (Takara Company, Japan). cDNA was synthesized by reverse transcription and the expression of the target genes were analyzed by qPCR using Quanti Tet SYBR Green PCR kit (Takara Company, Japan). The relative content of the target genes was calculated relative to that of the normal group. The primers used in this study were as follows: GAPDH (human) forward: ACAACTTTGGTATCGTGGAAGG reverse: GCCATCACGCCACAGTTTC; β-actin (mouse) forward: GGCTGTATTCCCCTCCATCG reverse: CCAGTTGGTAACAATGCCATGT; FGF21 (human) forward: TTTACCAGTCCGAAGCCCAC reverse: CCTGGTAGTGGCAGGAAGC; FGF21 (mouse) forward: CTGCTGGGGGTCTACCAAG reverse: CTGCGCCTACCACTGTTCC; NACHT, LRR and PYD domains-containing protein 3 (NLRP3) (mouse) forward: CTCCAACCATTCTCTGACCAG reverse: ACAGATTGAAGTAAGGCCGG; Collagen 1 (Col 1) (mouse) forward: GTGCTAAAGGTGCCAATGGT reverse: ACCAGGTTCACCGCTGTTAC; α-smooth muscle actin (α-SMA) (mouse) forward: CGGGACATCAAGGAGAAACT reverse: CCCATCAGGCAACTCGTAA; interleukin (IL)‑1β (mouse) forward: TCGCCAGTGAAATGATGGCTTA reverse: GTCCATGGCCACAACAACTGA; tumor necrosis factor (TNF)-α (mouse) forward: ATGAGCACTGAAAGCATGATC reverse: TCACAGGGCAATGATCCCAAAGTAGACCTGCCC; IL-6 (mouse) forward: ACTCACCTCTTCAGAACGAATTG reverse: CCATCTTTGGAAGGTTCAGGTTG; IL-10 (mouse) forward: TGGACAACATACTGCTAACCGAC reverse: TGGACAACATACTGCTAACCGAC.
Elisa analysis
Radioimmunoprecipitation assay (RIPA) solution and protease inhibitor (Beyotime Biotechnology, Shanghai, China) were added to the preserved kidney tissues, ground, and crushed using medical tissue homogenizer to finally extracted the supernatant. The expressions of IL-1β, TNF- α, IL-6, IL-10, reactive oxygen species (ROS), malondialdehyde (MDA), catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), glutathione peroxidase (GSH-PX), and hydroxyproline were detected by Elisa kit (Andy Gene Biotechnology Co., LTD, Beijing, China) after protein extraction from the kidney of the mice and GMCs. Nuclear proteins of tissues or cells are extracted by Nuclear Protein Extraction Kit (Beyotime Biotechnology, Shanghai, China).
Western blotting
The concentrations of the proteins extracted from the kidney tissues and GMCs were determined by BCA kit (Beyotime, Shanghai). Equal amounts of protein samples were separated by SDS-PAGE and then transferred to a nitrocellulose membrane. After sealing for 10 minutes at room temperature with rapid sealing solution, primary antibodies anti-NLRP3 (dilution: 1: 1000, Abcam, USA), anti-Col1 (dilution: 1: 1000, Abcam, USA), anti-α-SMA (dilution: 1: 1000, Abcam, USA), anti-nuclear factor E2-related factor 2 (Nrf2) (dilution: 1: 1000, Abcam, USA), anti-AKT (dilution: 1: 1000, Abcam, USA) and anti-p (Thr 308) AKT (dilution: 1: 1000, Abcam, USA) were added at 4℃ for 12h. This was followed by incubation with a secondary antibody, horseradish peroxidase-coupled (HRP) (dilution: 1: 3000, R&D, USA) at 37℃ for 1 h. Blots were developed with an Electro-Chemi-Luminescence (ECL) kit (Amersham Biosciences, Piscataway, NJ), and the results quantified using ImageJ software.
Statistical analysis
Data were analyzed with GraphPad Prism 7.0 software for windows. Mean ± SD values were calculated, and one-way ANOVA was used to test for significance at P < 0.05. Tukey’s Post hoc analysis was further used for comparison between groups.