Cell culture
RAW264.7 macrophages were cultured in Rosewell Park Memorial Institute (RPMI) 1640 medium supplemented with 20% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin at 37 °C in a humidified atmosphere with 5% CO2 and maintained in a logarithmic growth phase for all experiments, then RAW264.7 macrophages were exposed to CdCl2 at different concentrations on the second day. To study the effect of mitochondrial function on the macrophages, we added 5mM N-Acetyl-L-cysteine (NAC) (Beyotime S0077) or 20μM Mdivi-1 (ab144589) to the cultures for 24h to reduce redox reactions or mitochondria division. What’s more, bone marrow-derived macrophages (BMDMs) were isolated from RIPK3-/-/ApoE-/-mice to research the effects of RIPK3 on Cd-exposed macrophages.
Animal models of AS
Animal experiments were carried out according to the National Institutes of Health Guidelines on the Use of Laboratory Animals and were approved by the Animal Ethics Committee of Southern Medical University. Seven-week-old male ApoE-/- mice were fed with high-fat diets or chow diets which were provided by Guangdong Medical Laboratory Animal Center for three months, exposed to Cd in different concentrations. To study the effect of Mitochondrial function on the formation of AS plaque, we administered NAC orally (20mM) or 50mg/kg i.p.Mdivi-1 to mice exposed to high-fat with Cd diet. And RIPK3-knockout mice on a C57BL/6 background were obtained from GemPharmatech, then bred with ApoE-/-mice to establish RIPK3-/-/ApoE-/-mice.
Tissue collection and analysis
After fed with high-fat or chow diet for three months, mice were sacrificed with deep anesthesia for blood collection. Plasma was obtained from the blood samples of mice by centrifugation (Thermo Scientific™ Medifuge™) at 1000xg for 15 minutes at 4°C and then stored at −80°C. The mice were subsequently fixed by perfusion through the cardiac apex with phosphate buffer saline (PBS), and specimens of the aortic root were obtained without peripheral adipose tissue.
CCK-8 (Cytotoxicity Assay)
RAW264.7 cells in logarithmic growth phase were inoculated in a 96-well plate according to 10000 cells/well. The next day, the macrophages were observed growing to 70%, then treated with different concentration gradients of CdCl2 for 24h. And the cell viability was detected by CCK-8 kit purchased from Dojindo (CK04) in Plate Reader (Bio Tek Instruments Epoch™).
RNA extraction, reverse transcription, and real-time quantitative polymerase chain reaction (qRT-PCR)
Total RNA was extracted from macrophages using Trizol reagent (Invitrogen 15596026). RNA was quantified and reverse-transcribed into complementary DNAs using PrimeScriptTM RT Master Mix kit (TaKaRa RR036A). Finally, the quantitative real-time PCR analysis (qRT-PCR) was performed using a TB Green Premix Ex TaqTMII (TaKaRa RR820A) kit on a Light Cycler96 PCR instrument (Roche). The Vazyme cycling conditions were: 95 °C for 30 s followed by 39 cycles at 95 °C for 10 s and 60 °C for 30 s. Then, a melting curve analysis was performed by increasing the temperature from 65 °C to 95 °C for 15 min. GAPDH was used as a loading control. PCR primers used in this study were synthesized by TSINGKE (Beijing, China) and the sequences were: GAPDH (CATCACTGCCACCCAGAAGACTG (F), ATGCCAGTGAGCTTCCCGTTCAG (R)), IL-1β(TGGACCTTCCAGGATGAGGACA (F), GTTCATCTCGGAGCCTGTAGTG (R)), IL-6 (TACCACTTCACAAGTCGGAGGC (F), CTGCAAGTGCATCATCGTTGTTC (R)), IL-10 (CGGGAAGACAATAACTGCACCC (F), CGGTTAGCAGTATGTTGTCCAGC (R)), TGF-β(CGAAGCGGACTACTATGCTAAA (F), TCCCGAATGTCTGACGTATTG (R)), CD86 (ACGTATTGGAAGGAGATTACAGCT (F), TCTGTCAGCGTTACTATCCCGC (R)), CD206 (GTTCACCTGGAGTGATGGTTCTC (F), AGGACATGCCAGGGTCACCTTT (R)).
Western blot
Proteins were extracted from cells, tissues or mitochondria, while the mitochondria were isolated from RAW264.7 macrophages or aortic root using the cell mitochondria isolation kit (Beyotime C3601) or tissue mitochondria isolation kit (Beyotime C3606). After the proteins were measured by BCA (Beyotime Biotechnology, Beijing, CHINA) to the same concentration in each group, we boiled the proteins for 10 minutes, and separated it by 10% sodium dodecyl sulfatepolyacrylamide (SDS-PAGE) gel electrophoresis then transferred it onto a polyvinylidene difluoride (PVDF) membrane. After blocking the nonspecific binding sites with 5% non-fat milk in Tris buffered saline-Tween 20 (TBS-T), we incubated the membranes overnight with antibodies. The following primary antibodies were used: rabbit polyclonal antibody against GAPDH (ab9485), rabbit polyclonal antibody against NLRP3 (ab214185), rabbit monoclonal antibody against IL-1 beta[EPR16805-15] (ab234437), rabbit monoclonal antibody against TNF alpha [EPR19147] (ab183218), rabbit monoclonal antibody against IL-6 [EPR21710] (ab229381), rabbit monoclonal antibody against Opa1[EPR11057(B)] (ab157457), rabbit monoclonal antibody against MLKL (phospho S345) [EPR9515(2)] (ab196436) and rabbit monoclonal antibody against RIP3 (phospho S232) [EPR9516(N)-25] (ab195117) were from Abcam. Rabbit monoclonal antibody against Phospho-NF-kappaB p65 (Ser536) (93H1)(Cell Signaling, #3033S),rabbit monoclonal antibody against Cleaved Caspase-1 (Asp296) (E2G2I)(Cell Signaling,#89332S),rabbit monoclonal antibody against COX IV (D6I4K) (Rodent Specific) (Cell Signaling, #38563) were from Cell Signaling Technology. Rabbit polyclonal antibody against LC3I/II (WL01506) and rabbit polyclonal antibody against Drp1 (WL03028) were from Wanlei Biology. After having been incubated with the corresponding secondary antibodies (Boster BA1054) for 1.5 hours at room temperature, the immunoblot bands were detected by enhanced chemiluminescence (Engreen 29100). Prestained molecular‐weight marker proteins (Thermo#26616) were used to calculate the molecular weights of proteins. The membranes were exposed to autoradiography film following incubation with an enhanced chemiluminescence imaging system (Engreen 29100). The signal intensities were checked by Gel‐Pro Analyzer 4.0 software (Media Cybernetics, Silver Spring, MD).
Enzyme-linked immunosorbent assay (ELISA)
The levels of inflammation markers in cell supernatant or mouse plasma, including interleukin 1β (IL-1β) and interleukin 6 (IL-6) were examined using ELISA kits (DAKEWE #1210122 #1210602).
Flow Cytometry
Cell surfaces were stained with phycoerythrin (PE)-conjugated anti-mouse F4/80 antibody (biolegend 123110), APC-conjugated anti-mouse CD206 (MMR) antibody (141708) and FITC-conjugated anti-mouse CD86 antibody (105006). The expression of F4/80 was determined by flow cytometry to identify macrophages. And the expression of CD86 was used to delineate M1 macrophages, while the cells stained by APC-conjugated anti-mouse CD206 (MMR) antibody could be identified as M2 macrophages. Cell suspensions were stained for 30 minutes on ice with specific antibodies and washed twice with 3 mL of PBS buffer supplemented with 0.5% bovine serum albumin (BSA). Finally, we analyzed it using flow cytometry (CytoFlex A00-1-1102).
Immunofluorescence
Cultured Raw264.7 macrophages or aortic root tissues were fixed with 4% paraformaldehyde, incubated in 1% Triton for 10min and then in 2% BSA for 1 h, successively incubated with primary antibodies overnight at 4 °C, followed by incubation with secondary antibodies. The following primary antibodies were used: F4/80 (BM8.1) rat mAb (#71299S) from Cell Signaling Technology, CD86 Polyclonal rabbit antibody (13395-1-AP), CD206 Polyclonal rabbit antibody (18704-1-AP), Tom20 Polyclonal rabbit antibody (11802-1-AP) and LC3B-Specific Polyclonal rabbit antibody (18725-1-AP) from Proteintech. Then, the samples were stained with DAPI to visualize nucleus and observed by a laser confocal microscope (LEICA SP8). All the images and staining intensities were acquired and measured using analysis software (Image J).
Mitochondrial function detection
The mitochondrial superoxide of Raw264.7 macrophages was detected by MitoSOX™ Red mitochondrial superoxide indicator (Invitrogen™ M36008), and the Mitochondrial membrane potential was determined via mitochondrial membrane potential assay kit with JC-1 (Beyotime C2006) according to the manufacture’s instruction.
Transmission electron microscope (TEM) observations
Macrophages growing to the logarithmic phase were scraped and collected to be fixed with glutaraldehyde for 4 hours. Then sections (60 nm) were cut and stained with lead citrate and uranyl acetate at room temperature for 4 h. Next, samples were embedded in resin at room temperature for another 2 hours. A Hitachi H-7500 Transmission Electron Microscope (Hitachi, Ltd., Tokyo Japan) was used to observe the samples.
Oil Red O Staining
After the serial 10μm sections were cut, the OCT compound-embedded tissues were stained with Oil Red O (Solarbio 08010) to evaluate the lipid content, and Re-dyed with hematoxylin (Beyotime), differentiated by hydrochloric alcohol (Beyotime), washed by double distilled water, finally observed under microscope (OLYMPUS).
Quantification of blood Cd
We added 500 μL1 % HNO3 to 250 μL whole blood of mice and added 0.01% TritonX-100 (Amresco 0694) to 5mL. Then we measured the concentration of blood Cd by ICP-Mass Spectrometer (PerkinElmer NexIONTM 350X).
Statistical analyses
Data were generated through at least three independent experiments and were presented as the means ± SEM, then analyzed with the method of t-test between two groups or one-way ANOVA followed by a Bonferroni comparison test among three groups. Statistical analyses were carried out using Prism 8 (GraphPad). A two-tailed P value < 0.05 was considered to be statistically significant.