Cell lines and culture
Human GC cell lines, including AGS, BGC-823, MGC-803, MKN45, SGC-7901, and human normal gastric epithelial cell line GES-1 were purchased from iCell Bioscience Inc. (Shanghai, China). AGS, BGC-823, and MGC-803 were cultured in DMEM medium, and MKN45, SGC-7901, and GES-1 were cultured in RPMI-1640 medium. All the mediums were purchased from Gibco (Carlsbad, CA, USA) and added 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin sulfate (Gibco). MG132 was obtained from Selleckchem (Radnor, PA, USA) and 10 μM of MG132 was used to treat cells.
Real-time PCR
TRIzol reagent (Thermo Fisher Scientific Inc, Grand Island, NY, USA) was used to extract cellular RNA and PrimerScript RT reagent Kit (Applied Biosystems, Foster City, CA, USA) was used to synthesize cDNA. SYBR Green kit was used to perform the PCR reactions in a 7500 Fast Real-time PCR System (Thermo Fisher Scientific). Relative gene expression levels were calculated using the 2−ΔΔCT method and normalized to GAPDH. The primer sequences are presented below.
UBE2D1 Primer F 5' AGCGCATATCAAGGTGGAG 3'
Primer R 5' AGAGCTGGTGACCATTGTG 3'
SMAD4 Primer F 5' GCATTCCAGCCTCCCATTTCC 3'
Primer R 5' GGCACCTGACCCAAACATCAC 3'
β-actin Primer F 5' GATGACCCAGATCATGTTTGAG 3'
Primer R 5' TAATGTCACGCACGATTTCC 3'
Western blot assay
The treated cells were lysed in RIPA buffer (Invitrogen, Carlsbad, CA) on ice. After 12,000 rpm centrifugation at 4°C, a BCA kit (Beyotime, Shanghai, China) was used to measure protein concentration. Proteins (30 μg) from different samples were separated by 10% SDS-PAGE and blotted onto PVDF membranes (Millipore Corp., Bedford, MA, USA). After blocking in 5% non-fat milk, PVDF strips were incubated overnight with primary antibodies, followed by incubation with secondary antibodies. Primary antibodies were listed as following: UBE2D1 (1:800, Proteintech, Rosemont, IL, USA), SMAD4 (1:1000, Abcam, St. Louis, MO, USA), MMP2 (1:1000, Abcam), MMP9 (1:800, Abcam), and β-actin (1:2000, Abcam). At last, the membranes were scanned using a Bio-Rad imaging system (Hercules, CA, USA).
Lentivirus construction
All these lentiviruses were constructed by Genechem company (shanghai, China), including three interfering (shUBE2D1-1: GCTGAAGAGGATTCAGAAA; shUBE2D1-2: GCGCATATCAAGGTGGAGT; shUBE2D1-3: CCAAAGATTGCTTTCACAA) and one overexpression lentiviruses targeting UBE2D1, and one SMAD4 overexpression lentivirus.
Transwell assay
The transwell chambers (Corning Incorporated, Corning, NY, USA) were set into 24-well plates and incubated with culture medium overnight. Treated cells were harvested with FBS-free culture medium and seeded into the upper chamber at 2×104 cells per well (about 200 μl). Next, the culture medium containing 10% FBS was added to the lower chamber and cultured for 24 h. After removing the non-migratory cells, the chambers were stained with 1% crystal violet (Sigma, St. Louis, MO, USA) for 15 minutes, followed by acquiring images (200×) using a microscope (Leica, Germany).
Wound healing assay
A total of 1×105 treated cells were planted into each well of a 6-well plate and cultured to 80% confluence. Then, a 200 µL pipette tip was used to create wounds in the middle of each well. After washing with PBS, the cells were incubated with culture medium containing 1% FBS. Images (200×) of wounds were acquired at 0 and 24 h. Each sample was performed in triplicate.
Pulmonary metastasis mouse model
A total number of 12 BALB/c nude mice (4 weeks old, male) were purchased from Shanghai SLAC Laboratory Animal Co.,Ltd (20170005030081, Shanghai, China). Mice were randomly divided into two groups: AGS-shNC and AGS-shUBE2D1. The treated cells were harvested and suspended with PBS, then 1×106 cells were subcutaneously injected into the tail vein of nude mice. After 4 weeks of feeding, all these mice were euthanized. The image of lung profile was acquired, and the metastatic nodules were counted. Then, the lung samples were fixed in 4% paraformaldehyde (Beyotime) for the hematoxylin-eosin staining. All the animal protocols were approved by the Institutional Animal Ethics Care and Use Committee of The First People’s Hospital of Changzhou. This study was performed in line with the principles of the Declaration of Helsinki.
Gene set enrichment analysis (GSEA)
GSEA is used to analyze gene expression data using biological knowledge 14. In the current study, the Cancer Genome Atlas Stomach Adenocarcinoma (TCGA-STAD) datasets was analyzed by GSEA software (v2.0.13; Broad Institute, Cambridge, USA) following the detailed protocol on website (http://www.broad.mit.edu/gsea). GSEA was used to generate an ordered list of genes according to their correlation to UBE2D1 expression. The phenotype marker was UBE2D1-high vs UBE2D1-low.
Hematoxylin-eosin (HE) staining
After fixing in 4% paraformaldehyde, the lung samples were paraffin-embedded, sliced (4 µm), baked, and stained with Hexion and E staining kit (Bio-Rad Laboratories) according to the manufacturer’s protocol. Images were acquired by light microscopy (Leica, Germany).
Co-Immunoprecipitation (Co-IP)
Treated cells were lysed as previously described15. Whole cellular lysates were incubated with anti-UBE2D1 or anti-SMAD4 beads (Bio-Rad Laboratories) at 4° C overnight. Then the proteins which bound to beads were eluted and detected by western blot.
Immunohistochemistry (IHC)
Human gastric tissue microarray (Avilabio.com, Sanxi, China) was deparaffinized, rehydrated, antigen retrieved with 3% H2O2 in methanol, blocked, and incubated with anti-UBE2D1 antibody at 4°C overnight. After washing twice with PBS-T for 10 minutes each, the slice was incubated with second antibody 1 h and DAB buffer for detection. Images were acquired by light microscopy (Leica, Germany).
Statistical analysis
All data are reported as means ± standard deviation (SD). Student’s t-test and one-way ANOVA were used in data analysis. Survival curves were calculated using the Kaplan-Meier method and P < 0.05 was considered significant.