Cell culture and treatments
TNBC cell line MDA-MB-231 was kindly donated by Professor Erwei Song, University of Sun Yat-Sen on 11/2018. The TNBC cell lines MDA-MB-468 and 1937 were purchased from Genechem Company (Shanghai, China) on 01/2019. All cells were free from mycoplasma contamination, and their identities were authenticated by short tandem repeat (STR) DNA profiling by Shanghai Biowing Applied Biotechnology Co., Ltd in 31/10/2019. All cells were used in experiments within 30 passages after thawing. MDA-MB-231 was cultured in DMEM with 10% FBS (Gibco). Cells were incubated in a 37°C humidified atmosphere containing 5% CO2. In vitro, cells were treated with 500nM PD (PD-0332991, SelleckChem, Houston, TX, USA) or vehicle (PBS, BOSTER, Wuhan, China). MDA-MB-231 was treated with 50μM CDDP (SelleckChem, Houston, TX, USA).
Apoptosis analysis
Cells (5×104/well) were seeded in triplicate in 10% RPMI-1640/DMEM-FBS (full media) in 6-well plates and treated with PD and CDDP separately or combined at indicated concentrations. After treatment for the defined times, cells were washed, resuspended in binding buffer, and stained with Annexin V-FITC/PI according to the manufacturer’s instructions (BD Biosciences). The apoptotic cell populations were analyzed using flow cytometry (Beckman Coulter, CA). All assays were independently performed three times.
Cell cycle analysis
For cell cycle analysis, cells were harvested, washed with PBS, fixed in pre-chilled 70% ethanol, and kept overnight at -20°C. Fixed cells were then collected, washed, and resuspended in PBS. The cells were incubated with 1 mg/mL RNase and 50µg/mL propidium iodide (PI) in the dark for 30 min at 37°C, and subjected to flow cytometry (Beckman Coulter, CA). The cell cycle results were analyzed using FlowJo version 7.6.1. All assays were independently performed in triplicate.
Assessment of cell viability
Viability of cells were assessed by Cell Counting Kit-8 reagent (CCK8, Dojindo, Tokyo, Japan). 5000 to 10000 cells per well depending on growth characteristics of each cell line were seeded in 96-well plates in triplicate. After adhering overnight, different concentrations and/or sequences of the designated drug were added to the wells. After defined times, supernatants were removed and 100μl of CCK8 solution (1:10 dilution) was added to the cells. After 2h incubation at 37°C in dark, optical density (OD) at 450nm was measured by a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA). Each experiment was performed three times. The half maximal inhibitory concentration (IC50) was determined from dose-response curves generated by GraphPad Prism version 6.0. The combination index (CI) value was calculated with CompuSyn version 1.0 for the combined treatments of PD and CDDP [21].
Colony formation assay
Cells (500-1000/well) were seeded in 6-well plates and treated with indicates drugs. After combination treatments, media was replenished every 3 days until control wells reached 80-100% confluence. Monolayers were then fixed and stained with a solution of 4% paraformaldehyde and 0.5% crystal violet for 30 min severally at room temperature, washed with water, and dried. Colonies greater than or equal to 50 cells were visually identified and counted. Assays were performed with three independently treated cell populations.
Tumor xenograft studies
The study was approved by the Ethics Committees of Tongji Hospital, and performed in accordance with the Guide for the Care and Treatment of Laboratory Animals of Tongji Hospital. Four-week-old female BALB/c nude mice were bought from Beijing Vital River Laboratory Animal Technology Co., Ltd., and reared in laminar flow cabinets under specific pathogen-free conditions. For MDA-MB-231 cell lines xenograft models, 7×106 cells were suspended in 100μl PBS plus 50μl matrigel (BD Biosciences) and subcutaneously injected into the left axilla. One week later, mice bearing engrafted tumors of 50mm3 were randomized to oral treatment with 150mg/kg PD (n=4), intraperitoneal injection with 5mg/kg CDDP (n=4), PD-CDDP treatment (n=4) or vehicle (PBS) treatment (n=4), according to the dosing schedule provided in Fig. 4a. The perpendicular tumor diameters were measured with calipers. Tumor volumes were calculated as (length × width2)/ 2 every three days. The tumor weight was weighed when mice were euthanized by cervical dislocation. All mice were sacrificed when the tumor burden of vehicle group was equal to 1000mm3 for IHC analysis. Tumors were fixed in 10% paraformaldehyde for paraffin embedding and used for immunohistochemical staining.
Immunohistochemistry
Tissue sections were incubated with antibody Ki-67 (#9027, 1:400) (Cell-signaling Technology) overnight at 4°C and stained by 3, 3’-diaminobenzidine (DAB). Densitometry analysis was performed using Image J version 1.48v.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, California, USA). RB expression was measured in triplicate using SYBR Green qPCR Mix (Toyobo, Shanghai, China) according to the manufacturer’s instructions. Primer sequences were as follows: RB Forward: 5´- CTCTCGTCAGGCTTGAGTTTG-3´, RB Reverse: 5´-GACATCTCATCTAGGTCAACTGC-3´; GAPDH Forward: 5´- GGAGCGAGATCCCTCCAAAAT-3´, GAPDH Reverse: 5´-GGCTGTTGTCATACTTCTCATGG-3´. The comparative Ct method was used to calculate the relative mRNA expression and GAPDH was used as an internal control.
Cell transfection
The plasmids contained small hairpin RNA (shRNA) targeting RB and negative-control shRNA (shNC) were purchased from RiboBio (Guangzhou, China) and were transfected into MDA-MB-231 cells by X-tremeGENE HP DNA Transfection Reagent (Roche, CHE) according to the manufacturer’s instructions. ShRNA sequences were as follows: shNC, 5’-TTCTCCGAACGTGTCACGT-3’, shRB, 5’- CGGCTAAATACACTTTGTGAA -3’.
Immunofluorescence assay
Breast cancer cells were subjected to indirect immunofluorescence staining with γH2AX (Ser139, #9718, 1:400), phospho-histone H3 (Ser10, #53348, 1:1600) (Cell-signaling Technology) and then labeling with FITC Goat Anti-Rabbit IgG (#AS007, 1:200) for γH2AX and Cy3 Goat Anti-Rabbit IgG (#AS011, 1:100) (ABclonal) for Ser10. Nuclei were stained with DAPI (Life Technology). Fluorescence images were acquired using an inverted fluorescence microscope (Olympus). Image J version 1.48v was utilized for foci measurement and image analysis.
Western blot analysis
Cell lysates were separation by SDS-PAGE and then transferred to PVDF membranes. Proteins were detected using the following antibodies: RB (ab181616, 1:2000), Cyclin D1 (ab40754, 1:1000), E2F1 (ab179445, 1:1000) (Abcam), p-RB (S780) (#8180, 1:1000), PARP/Cleaved PARP (#9542, 1:1000) (Cell Signaling Technology), β-Actin (AC026, 1:100000) (ABclonal). Specific bands were visualized by ECL (Advansta, USA) and detected with an imaging system (Bio-Rad, USA).
Statistical analysis
Statistical significance, means and standard deviation were calculated by GraphPad Prism version 6.0. All analyses were performed in triplicate and P <0.05 were considered statistically significant. Data were expressed as the mean ± SD or mean. The statistical differences between two groups were analyzed by two-tailed Student’s t test. Chou-Talalay method was performed to calculate combination index (CI).