A Cassava Protoplast System for Screening Genes Associated with the Response to South African Cassava Mosaic Virus.

doi:10.21203/rs.3.rs-41420/v2

Download PDF

Methodology

A Cassava Protoplast System for Screening Genes Associated with the Response to South African Cassava Mosaic Virus.

https://doi.org/10.21203/rs.3.rs-41420/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Nov, 2020

Read the published version in Virology Journal →

You are reading this latest preprint version

Background: The study of transient gene expression in cassava plants during virus infection using existing protocols is laborious and may take approximately fifteen weeks due to cassava’s recalcitrance to transformation. The combination of a protoplast system with CRISPR-mediated gene editing promises to shorten the turnaround time from plant tissue culture to high-throughput gene expression screening for candidate genes. Here, we detail a protocol for screening genes associated with the response to South African cassava mosaic virus(SACMV) in cassava protoplasts, with reference to the ubiquitin E3 ligase gene, MeE3L.

Methods: Cassava protoplasts of model, and SACMV-susceptible and -tolerant genotypes, were transformed with SACMV infectious clones and/or a CRISPR-editing construct targeting the MeE3L using PEG4000-mediated transfection. DNA and RNA were extracted from transformed protoplasts at 24 hours post-transfection. Relative SACMV DNA accumulation was determined using DpnI-digested total DNA via qPCR, MeE3L relative expression was determined via reverse transcriptase qPCR, and results were analysed using one-way ANOVA, Tukey’s HSD test and the 2^-ΔΔCTstatistical method. The MeE3Lexonic region was sequenced on the ABI 3500XL Genetic Analyzer platform; and sequences were analysed for mutations using MAFTT and MEGA-X software. Construction of a phylogenetic tree was done using the Maximum Likelihood method and Jones-Taylor-Thornton (JTT) matrix-based model.

Results: The differential expression of unedited and mutant MeE3L during SACMV infectionof model, susceptible and tolerant cassava protoplasts was determined within 7 weeks after commencement of tissue culture. The study also revealed thatSACMV DNA accumulation is cassava genotype-dependent and induces multiple mutations in the tolerant landrace MeE3L homolog. Notably, the susceptible cassava landrace encodes a RINGlessMeE3Lwhich is silenced by SACMV-induced mutations.SACMV also induces mutations which silence the MeE3L RING domain in protoplasts from and tolerant cassava landraces.

Conclusions: This protocol presented here halves the turnaround time for high-throughput screening of genes associated with the host response to SACMV. It provides evidence that a cassava E3 ligase is associated with the response to SACMV and forms a basis for validation of these findings by in plantafunctional and interaction studies

Stem Cell & Developmental Cell Biology

Cassava mosaic disease

geminivirus

protoplast

ubiquitin E3 ligase

South African cassava mosaic virus is one of many cassava mosaic geminivirus species that affect the important food crop, cassava (ManihotesculentaCrantz), causing the distinct foliar symptoms characterised as cassava mosaic disease (CMD). CMD symptoms include mosaic pattern leaf chlorosis, curling, shape distortion and reduced size; which lead to production of few or no tubers (Alabiet al., 2011; Muimba-Kankolongo, 2018).

South African cassava mosaic virus (SACMV) occurrence was first reported in South Africa and Swaziland (Berrieet al., 1997), then subsequently in Zimbabwe (Briddonet al., 2003) and Madagascar (De Bruynet al., 2016). This bipartite begomovirus with a single-stranded DNA genome was identified as a distinct geminivirus based on DNA A sequence comparison, serology, and amplification of a DNA B fragment; and it was shown to have high sequence similarity with tomato yellow leaf curl virus(TYLCV), a monopartite begomovirus (Berry et al., 1998; Berrieet al., 2001). SACMV is transmitted by the whitefly species complex (BemisiatabaciGenn.) (Kalyebiet al., 2018), and perpetuated through infected stem cuttings used for propagation (Chikotiet al., 2019). The effect of SACMV on cassava yield is dependent on the cassava genotype and environmental conditions, and it varies from no effect to total crop loss (Muimba-Kankolongo, 2018). Major regional pandemics of CMD can cause major food security destabilisation, such as that which occurred in East and Central Africa in the 1990s (Legg and Thresh, 2000; Legg et al., 2006).

Established strategies for reducing incidence of CMD, such as use of virus-free cuttings and conventional breeding for genetic improvement of cassava using resistant landraces (Jennings, 1994; Legg and Thresh, 2000; Okogbeninet al., 2007; Ceballos et al., 2015; Nzukiet al., 2017), have not been effective in reducing cassava yield loss. Genetic modification of cassava for introduction of resistance traits has been hampered by this non-model plant’s recalcitrance to transformation (Zainuddinet al., 2012; Lentz et al., 2018). Furthermore, these approaches are time-consuming, causing attention to shift to the use of newer biotechnological approaches such as CRISPR-mediated gene editing (Rey and Vanderschuren, 2017).

Certain cassava genotypes exhibit natural resistance or tolerance to cassava mosaic begomoviruses (CMBs), for example, tropical M. esculenta3 (TME3) (Akanoet al., 2002) and Tropical Manihot Series (TMS) 96/0023 (Hahn et al., 1980), whereas others (cv.60444, T200, TMS 8017) are susceptible to CMBs and do not recover from infection (reviewed in Legg et al., 2015; Fondong and Rey, 2018). Although it is not clear which particular genes are involved in cassava’s response to SACMV infection, the availability of naturally-resistant cassava genotypes, transcriptomic data from infected susceptible and tolerant cassava genotypes (Allie et al., 2014), genome-wide association study data (Wolfe et al., 2016) and the cassava genome (Prochniket al., 2012; Bredesonet al., 2016; Kuonet al., 2019) enables the selection of putative host interacting genes for screening and testing.

Existing methods of cassava transformation are laborious, taking at least fifteen weeks from commencement of plant cultures to gene expression assaying (Zainuddinet al., 2012; Lentz et al., 2018). Transforming plant protoplasts instead of whole plants has a relatively shorter turnaround time, and is desirable because protoplasts show comparable cell-independent responses as whole plants (Sheen, 2001; Yooet al., 2007). Transient transformation of plant protoplasts for rapid gene characterisation is well-established for several plant species (Abel and Theologis, 1994; Kim et al., 2009; Nanjareddyet al., 2016; Wu et al., 2017; Loyola-Vargas and Avilez-Montalvo, 2019; Ren et al., 2020). More recently, cassava protoplasts were used for rapid gene characterisation (Wu et al., 2017) because they are a demonstrably reliable system for correlating in planta activities. Further, co-transformation of plant protoplasts with multiple plasmid constructs is routinely conducted (Locatelli et al., 2003; Walter et al., 2004; Chen et al., 2006) and specifically plant protoplast co-transformation with virus infectious clones and plasmid constructs has been used to explore gene function during viral infection (Cheng et al., 2009; Vanitharaniet al., 2003).

We propose that simultaneous targeted mutagenesis and viral infection can characterisation of the genetic architecture during the diseased state, and if coupled in protoplasts, can provide a high-throughput rapid screening platform for genes that may be central to in planta host-virus interactions. Potential gene candidates can then be further validated in planta using virus-induced gene silencing (VIGS). To explore this, we targeted a cassava ubiquitin E3 ligase gene, MeE3L (Manes.12g069400), for CRISPR-mediated mutagenesis in SACMV-infected cassava protoplasts from the model cultivar (60444), and susceptible (T200) and tolerant (TME3) African cassava landraces. MeE3L was targeted because ubiquitin RING E3 ligases play a central role in the hijacking and redirection of ubiquitination by geminiviruses (Lozano-Duran et al., 2011; Alcaide-Loridan and Jupin, 2012; Hanley-Bowdoin et al., 2013; Verchot, 2016). Moreover, MeE3L has previously been implicated in the response to stress (Liao et al., 2016; Patanunet al., 2016) and associated with the CMD2 resistance locus (Lozano et al., 2015; Wolfe et al., 2016). We analysed primary MeE3L gene structure, predicted MeE3L protein tertiary structure, MeE3L expression and SACMV DNA accumulation to determine whether MeE3L may be involved in the response of cassava protoplasts to SACMV infection. Findings in this study demonstrated the suitability of the cassava protoplast system for high-throughput screening of the genes involved in cassava’s response to SACMV.

1. CRISPR-Cas9 vector construction

Two genomic gRNA targets,gRNA1 (forward strand: GCGCAGATTCAAGCACTCGA) and gRNA2 (reverse strand: ACGTCCATTGGCGATGATAG),were identified using the CRISPOR version 4.7 web-based program (www.crispor.tefor.net; Haeussleret al., 2016) and used in designing a duplex sgRNA that included an Arabidopsis thaliana U6-26 promoter, the sgRNA scaffold and terminator for each gRNA sequence. Synthesis of the duplex sgRNA was outsourced to Inqaba Biotech (Pretoria, South Africa) and the duplex was cloned into the pCambia1380 vector. A Cas9 insert (Tobacco mosaic viruspromoter + Cas9 gene + eGFP gene + Hsp terminator) from the pl1m-f2-p35s-cas9-egfp-nucleo-thsp Golden Gate vector was cloned into the pCambia1380-gRNA construct. The construct was confirmed by restriction digestion and sequencing.

2. Protoplast isolation

Sterile nodal cultures of cassava (cv.60444, T200 and TME3 genotypes) were grown for 4 weeks at 28°C (3,000 lux; 12/12h light/darkness) on ½ Murashige and Skoog (MS) medium (2.2 g Murashige and Skoog Basal Medium, 2% sucrose, 0.002 mM CuSO₄, 0.78% plant tissue culture agar) (Murashige and Skoog, 1962) to provide 3 independent biological replicates of each genotype. For each treatment, 0.3 g of fully expanded leaves were transversely sliced into 2-3 mm strips, which were plasmolysed by immersion in CPW9M medium (0.5 M mannitol, 27.2 mg KH₂PO₄, 100 mg KNO₃, 150 mg CaCl₂, 250 mg MgSO₄, 2.5 mg Fe₂(SO₄)₃.6H₂0, 0.6 mg KI, 0.00025 mg CuSO₄ per litre; pH 5.8) for 1 h (Anthony et al., 1995). The strips were vacuum-infiltrated in enzyme digestion solution (5 mMmorpholinoethanesulphonic acid (MES), 1.6% cellulase, 0.8% macerozyme, CPW9M medium) for 30 min and then incubated at 25°C in the dark at 40 rpm for 16 h. Protoplasts were released by shaking the digested tissue at 80 rpm for 5 min and purified by filtering through a 75 μm sieve. The filtrate was centrifuged at 100 g and the protoplast pellet washed twice in CPW9M medium. Protoplast integrity was checked using the Olympus BX 63 OM/FM microscope (Olympus Scientific Solutions, Massachusetts, USA), viability was determined by Evans’ Blue Dye staining (Huang et al., 1986), and quantification conducted via flow cytometry using the BD Accuri™ C6 flow cytometer (BD Biosciences, New Jersey, USA). Flow cytometric data were analysed using FCS Express 7 Research Edition software (Treestar, Inc, Oregon, USA). Protoplasts were resuspended in MMg solution (0.4 M mannitol, 15 mM MgCl₂, 4 mM MES; pH 5.8) (Wu et al., 2017) to a concentration of 10⁴ cells per ml.

3. Protoplast transfection

For each of the 3 biological replicates for each cassava genotype, 15 μg of the CRISPR construct and 4 μg each of pBIN19-SACMV-DNA-A and pBIN19-SACMV-DNA-B infectious clones (Berrieet al., 2001) were mixed with 1 mL of protoplasts and 25% polyethylene glycol 4000 (PEG 4000), and incubated at room temperature for 20 min. The mixture was gently diluted with 3 volumes of W5 solution (154 mMNaCl, 125 mM CaCl₂, 5 mMKCl, 2 mM MES, pH 5.8) and centrifuged twice at 100 g for 2 min. Protoplasts were resuspended in 300 μL of WI solution (4 mM MES, 0.5 M mannitol, 20 mMKCl, pH 5.8) (Yooet al., 2007) and incubated overnight in the dark at room temperature to induce gene expression. The expression of eGFP was checked using fluorescence microscopy to confirm protoplast transformation. Protoplasts were washed with CPW9M medium at 24 h post-transfection.

4. Mutagenesis, viral load and gene expression assays

DNA was extracted from the transformed protoplasts 24 h post-transfection (hpt) using QIAzol Lysis Reagent according to a user-developed protocol (www.qiagen.com/it/resources/; Qiagen, Maryland, USA). Quantitative PCR (qPCR) for SACMV relative viral load quantitation using DpnI-digested (ThermoFisher Scientific, Massachusetts, USA) DNA as template was performed in triplicate using forward (5` GGCTAGTTCCCGGATTACAT 3`) and reverse (5` GACAAGGACGGAGACACC 3`) primers, and 18S rRNA as the reference gene. The exonic region of MeE3L was amplified using the Phusion U Green Hot Start DNA Polymerase (ThermoFisher Scientific) with forward (5` CGCGCAGATTCAAGC 3`) and reverse (5` TGTCCACATGGAATGAAAG 3`) primers. Sequencing of amplicons on the ABI 3500XL Genetic Analyzer was outsourced to Inqaba Biotec (Pretoria, South Africa), and sequencing results were analysed for variation and alignment using TIDE web tool (https://tide.deskgen.com/; Brinkman et al., 2014) and MAFTT version 7 (https://mafft.cbrc.jp/alignment/software/; Rozewickiet al., 2019) before being employed as query terms for protein structure and binding prediction using the I-TASSER On-line Server (https://zhanglab.ccmb.med.umich.edu/I-TASSER/; Yang et al., 2015) and protein similarity search in the Protein Data Bank (Berman et al., 2000). Analysed sequences were used to construct a phylogenetic tree using the MEGA X software based on the Maximum Likelihood method and Jones-Taylor-Thornton (JTT) matrix-based model (Kumar et al., 2018). Frequency of clones with altered sequence was obtained by expressing a number of amplicons from a polyclonal mix with sequence alteration as a ratio of 10 amplicons sequenced. Mutations were determined by aligning amplicon sequences with wild-type reference AM560-2 (Bredesonet al., 2016) and TME3 ((RefSeq ID: RSFT01000007; GenBank assembly GCA_003957995.1 (unpublished data)) MeE3L homologs. Alignment was conducted on MEGA-X (Kumar et al., 2018) using the CLUSTAL W algorithm for multiple sequence alignment (Larkin et al., 2007).

RNA was extracted from the transformed protoplasts 24 hpt using QIAzol and according to the manufacturer’s (Qiagen, Maryland, USA) protocol. First strand cDNA synthesis using RNA as template was performed using the RevertAid H Minus First Strand cDNA Synthesis Kit (ThermoFisher Scientific, Massachusetts, USA). Reverse transcriptase qPCR for MeE3L relative expression quantitation was performed in triplicate with cDNA as template using the Maxima SYBR Green/ROX qPCR Master Mix (2X) (ThermoFisher Scientific, Massachusetts, USA) with forward (5` CGCGCAGATTCAAGC 3`) and reverse (5` TGTCCACATGGAATGAAAG 3`) primers according to the manufacturer’s protocol using 18S rRNA as the reference gene. The qPCR data was analysed by one-way ANOVA and Tukey’s HSD test (p<0.05). Relative expression and relative viral load of MeE3L and SACMV, respectively, were determined using the 2^-ΔΔCT method (Livak and Schmittgen, 2001).

1. Isolation and transformation of cassava protoplasts

The in vitro growth of the cassava plantlets was conducted under controlled, sterile conditions and only young, expanded leaves were used as donors (Fig.1A). Different sizes (~15-35 µm) of cassava protoplasts of round and irregular shapewere observed (Fig.1B-D). The majority of protoplasts were round with chloroplasts positioned around the perimeter of a central vacuole. The viability of protoplasts was at least 85% as shown by staining with Evans’ Blue Dye (Fig.2A-C). Protoplast yields were 4.90-6.36x10⁶/g fresh weight (FW) (Additional File 1). The integrity of isolated protoplasts was analysed by flow cytometry forward versus side scatter (FSC vs SSC) gating (Haynes, 1988) prior to transfection (Fig.2D-F). The presence of protoplasts in the gated area as well as irregularly-shaped debris outside the gated area was detected. Approximately 10⁴ protoplasts of each cassava genotype were transfected with 15 µg eGFP-tagged CRISPR construct and/or 4µg SACMV infectious clones using PEG-mediated transformation. Stability of transient expression was verified by detection of eGFP expression 24 hpt, showing that at least 90% of protoplasts had been successfully transformed (Fig.2G-H).

2. Structure and phylogenetic analysis of MeE3L in protoplasts from model, susceptible and tolerant cassava genotypes

PCR amplification of the MeE3L partial transcript from leaves revealed that the susceptible T200 landrace homolog nucleotide sequence is slightly longer than the tolerant TME3 homolog (Fig.3B). Sequencing of the exonic region of susceptible T200 MeE3L showed that this is due to a 53 bp insertion mutation of 9 TGAGAA nucleotide repeats that are absent in model cv.60444 and tolerant TME3 (Fig. 3A). The resulting frameshift introduces a stop codon at amino acid 141 (Fig C-D). Computational analysis revealed that the truncated susceptible T200 MeE3L homolog is structurally distinct from the reference genome (AM560-2), model cv.60444 and tolerant TME3 MeE3L homologs (Fig 3E). It is also not significantly similar in structure to any protein in the Protein Data Bank (Berman et al., 2000), and it is not confidently predicted to bind any ligands. The other three (AM560-2, cv.60444 and TME3) homologs are structurally closest to the cIAP1 inhibitor of apoptosis protein which contains a RING domain with E3 ligase activity for autoubiquitination and modulates cell death (Dueberet al., 2011). An analysis of the phylogeny of E3 ligase homologs in plants (Fig. 3F) reveals that although the MeE3Ls share Heveabrasiliensis as a common ancestor, the susceptible T200 homolog is significantly more evolutionarily distant from AM560-2 than the TME3 and cv.60444 homologs.

3. Relative accumulation of SACMV DNA and relative MeE3L expression in transformed cassava protoplasts

Tukey’s HSD test showed significant differences in the qPCR data derived from SACMV-, CRISPR- and SACMV+CRISPR-transformed protoplasts (p<0.05) (Additional File 2). Relative SACMV DNA accumulation in wild-type protoplasts was highest in susceptible T200 at 8-fold, compared to 3-fold relative to the 18S rRNA gene in model cv.60444 and tolerant TME3 at 24 hpt. There was a substantial increase in accumulation of SACMV DNA in model cv.60444,susceptible T200 and tolerant TME3 (12-fold and 4-fold respectively) in CRISPR-transformed protoplasts(Fig. 4A). MeE3L expression was significantly upregulated with a log fold change of 1 and 9 in susceptible T200 and tolerant TME3 SACMV-infected protoplasts relative to MeE3L expression in untransformed protoplasts, respectively. There was significant upregulated expression ofMeE3L in tolerant TME3 but no significant effect on susceptible T200 MeE3L expression in CRISPR-transformed protoplasts. No significant change in MeE3L expression was observed under all conditions in model cv.60444 (Fig. 4B).

4. Predicted MeE3L primary structure in transformed cassava protoplasts

Predicted MeE3L protein primary structures based on the MeE3L genomic sequence in SACMV-infected protoplasts showed stop mutations (amino acid residues 133 and 99 respectively) (Fig. 4C-D) upstream of the RING domain in susceptible T200 and tolerant TME3 variants, compared to uninfected controls and reference sequence AM560-2. Sequencing of MeE3L from SACMV-infectedtolerant TME3 protoplasts revealed multiple random single base mutations along the length of MeE3L which translate to substitutions by altered amino acids (Fig. 4E). CRISPR editing efficiency was determined based on Sanger sequencing of 10 amplicons from a polyclonal mix. Sequencing indicated 80% and 50% mutation frequency for the gRNA1 and gRNA2 targets respectively. All mutations were substitution mutations and translated to 20% and 50% mutation efficiency for the gRNA1 and gRNA2 targets respectively in the predicted protein sequence (Fig. 4F).The turnaround time from commencement of plant tissue culture to gene expression assaying was 7 weeks (Fig. 4G).

1. African cassava landraces susceptible and tolerant to SACMV are amenable to enzymatic protoplast isolation and PEG-mediated transformation

Protoplasts were chosen for this transient gene expression study because they can conveniently and efficiently be transformed with several DNA constructs simultaneously, and they allow higher resolution imaging compared to cells in intact tissue (Faracoet al., 2011). Additionally, they can be used for high-throughput efficient screening of candidate genes, and those genes that show an effect can then be silenced by virus induced gene silencing (VIGS) in planta, which takes considerably longer (3-4 months) and requires more complicated procedures for the non-model host cassava. Leaf mesophyll was used as the source of protoplasts because SACMV exerts its effects mainly in the leaves, where symptoms arise.Leaf mesophyll protoplasts therefore provide functional information (Faracoet al., 2011) relating to the effect of SACMV at leaf tissue level. Round and irregularly-shaped protoplasts of different sizes were observed (Fig.1B-D), although spherical leaf mesophyll protoplasts dominated, as generally reported (Wu et al., 2017).

A previously determined enzyme concentration (1.6% cellulase, 0.8% macerozyme) that is suitable for obtaining the optimum number of viable protoplasts was used for leaf cell wall digestion (Wu et al., 2017). The viability of protoplasts in this study was at least 85% although cassava protoplast viability of up to 95% has been reported (International Plant Research Institute, 1984). The long digestion period (16 h) was ruled out as the cause of death for ~15% of protoplasts as this reportedly does not induce serious damage in protoplasts (Tang, 1982). It has been reported that micro-propagated plants grown in vitro lack epicuticular wax and thus allow rapid enzyme penetration (Kumar and Rao, 2018). Cassava, however, has a thick epicuticular layer which necessitates the long digestion period of 16h compared to 0.3-1h for Arabidopsis (Wu et al., 2009). Macerating enzymes such as macerase are known to cause wound reactions in protoplasts because of their degradation of the cell wall, which may lead to necrosis (Ishii, 1988), while cellulase is known to exert inadequate enzymatic activity at low concentrations and higher concentrations have no benefit or detriment (Uchimiya and Murashige, 1974). Therefore, a balance between digestion enzyme concentration and viability is essential in order to obtain the optimum yield of viable good quality protoplasts. Cassava protoplast viability presented herein may differ from previously reported percentages possibly due to differences inthe cassava genotypes used, and in this particular case could be due to the particular physiological characteristics of the African cassava landraces from which protoplasts were derived.

Although lower than the previously reported yields of 4.4x10⁷ protoplasts/g FW leaves from M. esculentacv. South China 8 (Wu et al., 2017) and 1.9x10⁷ protoplasts/g FW leaves from M. esculenta cv. M. Thai 8 (Anthony et al., 1995), the protoplast yields in this present study (4.90-6.36x10⁶/g FW) were sufficient to provide the recommended number of protoplasts (10⁴-10⁷) required for each transfection (Yooet al., 2007). Both pre-treatment of leaves in the dark (24-72 h) (Shahin and Shepard, 1980) and vacuum infiltration before enzyme digestion (Nanjareddy, 2016) have been shown to intensify enzyme penetration in bean leaves. We found that pre-treatment resulted in release of much undesirable plant debris alongside protoplasts, and that vacuum infiltration did indeed help increase protoplast yield. Flow cytometry indicated a high concentration of protoplasts compared to irregularly-shaped debris. Based on microscopy images of purified protoplasts (Fig.1B-D), the irregular debris outside the flow cytometry gated area was deemed to be free chloroplasts, plasmolysed cells, undigested cell wall fragments and other aggregates arising from the long digestion period of leaf material.

Stability of protoplast transformation was confirmed by expression of eGFP from the CRISPR construct at 24 hpt following PEG-mediated transfection of 10⁴ protoplasts with 15 µg CRISPR construct and 4 µg SACMV infectious clones. Protoplasts were deemed unsuitable for further analysis from 36 hpt as they rapidly lost viability. PEG-mediated plant protoplast transfection with plasmid DNA is a well-established procedure (Hayashimotoet al., 1990; Locatelli et al., 2003) and a popular protocol uses 10 μg DNA to transfect 2x10⁴ Arabidopsis protoplasts (Yooet al., 2007). At least 5 µg of plasmid DNA have previously been used to transform 10⁶tobacco protoplasts with African cassava mosaic virus (ACMV) (Ermaket al., 1993) and Cowpea mosaic comovirus (Wellinket al., 1993). Highly efficient co-expression of multiple constructs in plant protoplasts has been reported (Chen et al., 2006; Walter et al., 2004) and virus infectious clones have also been used in conjunction with other plasmid constructs for co-inoculation of plant protoplasts (Cheng et al., 2009). Nicotianatabacum protoplasts have been co-transformed with 5 µg eGFP construct, 3 μg siRNA and 4 μg each of ACMV or East African cassava mosaic virus (EACMV) with DNA/RNA extraction at 36 and 48 hpt (Vanitharaniet al., 2003). To our knowledge, the present study is the first report of co-transformation of cassava protoplasts with a CRISPR construct and geminivirus infectious clones.The number of constructs used for transformation can be increased for high-throughput studies to target multiple genes simultaneously since it has been shown that transformation efficiency is independent of plasmid amount (Locatelli et al., 2003).

The percentage mutation frequency of 50-80% at targeted sites in the cassava genome is comparable to the 70% and 60% attained in cassava (Wu et al., 2017) andN. tabacum(Lin et al., 2018) protoplasts respectively, and considerably less than the 100% previously obtained in cassava plants (Odipioet al., 2017).CRISPR targets with GC content greater than 50% are known to achieve higher efficiency than those with less than 50% (Ma et al., 2015), and this may explain why gRNA1 target sequence (55% GC content) has considerably higher mutation frequency than gRNA2 target sequence (50% GC content).

2. The M. esculentaT200 MeE3L encodes a truncated RING-less protein due to a nonsense mutation

The frameshift resulting from the insertion mutation in susceptible T200 MeE3L introduces a stop codon upstream of the RING domain, thus encoding a truncated protein in which the C3HC4-type RING finger motif is absent. Essentially, the E3 ligase domain in the T200 MeE3L would not be translated because of this mutation, making its potential protein product non-functional with respect to this E3 ligase activity. We were able to amplify the T200 MeE3L exon from cDNA, showing that this gene is transcribed, but we have no evidence of its translation or lack thereof. It is proposed that the loss of this substantial portion of the T200 MeE3L C-terminal region would not only avert E3 ligase activity but may also alter the spatial chemical conformation necessary for any other interactions (such as binding the ubiquitin-conjugated E2 and substrate) to occur. The protocol in this present study therefore enablesgene sequence comparison among wild type cassava genotypes, to determine the presence of single nucleotide polymorphisms (SNPs) or other forms of mutations, and to form a basis for in planta exploration of phenotypic differences among cassava genotypes.

The AM560-2, TME3, and cv.60444 cassava genotypes have previously been shown to cluster together under their nearest ancestor, Heveabrasiliensis(Bredesonet al., 2016). The evolutionary history of T200, a southern African landrace, is unknown and phylogenetic analysis suggests that the T200 MeE3L evolved after the cv.60444 and TME3 variants. It is known that wild plants in natural ecosystems co-evolve with their virus partners. While it is recognized that there is a relationship between virus virulence/pathogenicity and co-adaptation to plant hosts (Sacristan and Garcia-Arenal, 2008), information regarding how viruses apply selective pressure to alter plant susceptibility is not known. A study of Drosophila and its host-specific viruses found that coevolution may cause sustained genetic variation in susceptibility (Duxbury et al., 2019). This may explain why a southern African cassava landrace is highly susceptible to SACMV that appears to have migrated south from its origin, suspected to be in east Africa or the south-west Indian Ocean islands such as Madagascar (De Bruynet al., 2016) that geographically separated from the African continent (Lefeuvreet al. 2007). South African cassava mosaic virus is a recombinant between East African cassava mosaic virus and two other unknown geminiviruses which contributed the AC4 and IR regions (Berrieet al., 2001), and moved southwards into Mozambique, Zimbabwe and South Africa where it may have encountered the T200 landrace. Subsequent to its first discovery in South Africa, SACMV has been reported in Zimbabwe (Briddonet al. 2004) and Madagascar (De Bruynet al., 2016). It is known that infection with anew recombinant begomovirus requires the host to adjust to minor or major differences in virus-host interactions (Montes et al., 2019).It is suggested that the T200 landrace and SACMV may still be in the process of co-adaption, which would explain why T200 exhibits extreme susceptibility to SACMV.We speculate that the MeE3L is either a paralog in T200 or it was introgressed from a wild relative in southern Africa.

3. SACMV DNA accumulation in cassava protoplasts is genotype-dependent

Quantitative PCR is a well-established method for precise quantitation of viral DNA amount in infected tissue and it requires a host reference gene with stable expression patterns under experimental conditions as the internal control for correct data normalisation (Moreno et al., 2011). Data from the qPCR measurement of SACMV DNA accumulation (relative to the 18S rRNA gene) show that SACMV DNA accumulates in cassava protoplasts, correlating well with previous reports of geminivirus DNA accumulation in planta and in vitro. Quantitative detection of African cassava mosaic virus and East African cassava mosaic virus using qPCR has been reported (Ottiet al., 2013) and SACMV titre, in particular, has been assayed in planta in Arabidopsis (Pierce and Rey, 2013) and cassava (Allieet al., 2014). Replication of the geminivirus, Cassava brown streak virus, in cassava leaf mesophyll protoplasts has been assayed at 6 hpt (Anjanappaet al., 2016) and it has been reported that there was significant viral DNA accumulation in tobacco BY-2 protoplasts 36 and 48 hpt by co-inoculating with infectious ACMV and EACMV clones and siRNA (Vanitharaniet al., 2003). The present study is the first to report accumulation of SACMV DNA in cassava protoplasts.

Based on previously reported in planta evidence (Allie et al., 2014) and the known presence of a CMD2 locus in tolerant TME3 (Akanoet al., 2002),it was expected that SACMV DNA accumulation would be genotype-dependent and significantly lower in TME3 than in the model cv.60444 and susceptible T200 protoplasts. Interestingly, there was differential SACMV accumulation in CRISPR-transformed cassava protoplasts expressing the gene-edited MeE3L. The upregulation of SACMV DNA accumulation in susceptible T200 and tolerant TME3 in the presence of mutant MeE3L suggests a role for MeE3L as one of the host genes involved in the response to SACMV infection. CRISPR-associated modification of MeE3L may enhance SACMV DNA accumulation in susceptible T200 and tolerant TME3 by interfering with the ubiquitin proteasome system-dependent tolerance/resistance response mechanisms of cassava.

4. Viral activity and gene editing of MeE3L affect the expression of MeE3L

Geminiviruses elude plant defense mechanisms by hijacking and redirecting ubiquitination, and interfering with responses regulated by ubiquitin E3 ligases (including responses to jasmonates, auxins, gibberellins, ethylene,abscisic acid) (Lozano-Duran et al., 2011). It follows then that alterations to E3 ligase genomic sequences may alter E3 ligase expression patterns during viral infection, as viruses are known to modulate RNA levels to enhance infection (Verchot, 2016). Both plant viruses and CRISPR systems are known to induce mutations in the genome (Machida et al., 2004; Cougotet al., 2005; Sander and Joung, 2014), and the employment of both against the MeE3L would provide an indication whether MeE3L may be involved in the plant’s response to SACMV.

Previously, plant E3 ligases have been shown to be induced by viral infection (Lai et al., 2009; Czosneket al., 2013; Chen et al., 2018) and plant defence elicitors (Libaultet al., 2007; Sadanandomet al., 2012).It is known that geminiviruses interact with plant E3 ligases and induce their up- or down-regulation to promote infection or undergo degradation (Lai et al., 2009; Lozano-Duran et al., 2011; Lozano-Duran and Bejarano, 2011; Shen et al., 2016). Results presented herein indicate that in TME3 protoplasts, MeE3L expression is upregulated during SACMV infection. The concurrent CRISPR-mediated gene editing of MeE3L and infection with SACMV appears to induce increased expression of the MeE3L, suggesting that MeE3L’s specific base sequence is important for the interaction between the virus and the plant host. The muted response of the T200 MeE3L to all treatments was expected given its nonsense mutation which silences the RING domain responsible for E3 ligase activity. However, the muted response of model cv.60444 MeE3L was unexpected and suggests that this MeE3L sequence variant is not responsive to SACMV infection.

The MeE3L homolog sequences in SACMV-infected protoplasts reflect a silenced RING domain, suggesting that SACMV may possibly induce silencing of the RING domain in order to achieve full infection of the host. The concomitant increase in SACMV DNA accumulation and gene-editedMeE3L in TME3 points to the response of MeE3L to SACMV being more directed at advancing susceptibility. There is evidence for geminiviral (Tomato yellow leaf curl sardinia virus) silencing of a plant E3 ligase, RHF2A, to promote infection (Lozano-Duran et al., 2011) and impairment of plant defenceduring Cabbage leaf curl virus (CaLCuV) infection due toinhibition of a RING E3 ligase (Sahuet al., 2013). The present study provides further evidence that geminiviruses may interfere with activity of a plant E3 ligase in plants.

5. SACMV’s interaction with a tolerant cassava genotype induces numerous mutations in MeE3L

Functions of E3 ligases in regulating immunity systems are orchestrated at the interface of host-virus interactions (Zhang et al., 2018) and some of these interactions occur in the nucleus (Kushwahaet al., 2017). Sequencing of genomic MeE3L from SACMV-infected TME3 protoplasts revealed multiple random single base mutations along the length of MeE3L,which translate to amino acid substitution (Fig. 4E). While these mutations do not alter the reading frame, they are predicted to silence the whole protein and not just the RING domain. The resulting disordered protein would presumably not only lack RING E3 ligase activity, but also the E2 and substrate binding activity. These mutations were present and similar in all 10 genomic DNA amplicons derived from the polyclonal mixes of each of 3 biological replicates. Similar mutations encoding multiple stop codons have been observed in an Argonaute 4-encoding gene (Manes.18g121900)from SACMV-transformed tolerant TME3 protoplasts (unpublished data; Chatukuta and Rey), indicating that other host genes may be similarly affected by SACMV infection.

Interestingly, the discovery of mutations in genomic DNA presented herein possibly point to a yet unknown geminivirus-induced host mechanism for genome editing. Geminiviruses are known to induce the expression of genes related to repair of double-stranded breaks (DSBs) and DNA synthesis (Lozano et al., 2015), and to promote somatic homologous recombination (Richter et al., 2014).Some E3 ligases and viral proteins can localise to the nucleus, such as the tobacco E3 ligase, NtHUB1 which has a nuclear localisation sequence, is recruited by geminiviral Rep protein, and co-localises and interacts with the Rep protein to monoubiquitinate cellular chromatin and thus enable infection (Kushwahaet al., 2017). The viral coat protein, CP, also has a nuclear localisation signal, can localise in the nucleolus and nucleoplasm, and facilitates entry of ssDNA into the nucleus (Wang et al., 2017; Kumar, 2019). However, the mechanisms for SACMV-mediated gene mutation induction in cassava protoplasts are yet to be investigated.

6. The response of MeE3L to SACMV is virus- and host-specific

Ubiquitin ligases are abundant in plants and provide substrate specificity to target particular proteins. In Arabidopsis alone, RING E3 ligases make up 499 out of over 1,500 E3 ligases (Mazzucotelliet al., 2006). A comparison of E3 ligase and E3 ligase complex-associated gene expression during other plant geminivirus infection studies (Additional File 3) was conducted to determine whether MeE3L’s response to SACMV is geminivirus-specific or host-dependent.

In susceptible cassava, E3 ligase expression is downregulated during SACMV infection at early, middle and late time points (12, 32 and 64 days post infection (dpi)) but there is no differential expression of E3 ligases in tolerant cassava at any time point (Allie et al., 2014). However, no differential expression of E3 ligases is recorded during SACMV infection of Arabidopsis which is susceptible (Pierce and Rey, 2013). A study of transcriptomic responses to geminivirusTomato leaf curl New Delhi virus (ToLCNDV) infection in potato found that five E3 ligases in the susceptible cultivar and two in the tolerant cultivar are upregulated at 30 dpi (Jeevalathaet al., 2017) while the geminivirusTomato yellow leaf curl virus (TYLCSV) has been shown to induce upregulation of E3 ligases in susceptible tomato at 42 dpi, except in the case of a CUL1 which is downregulated (Miozziet al., 2014). A transcriptome study of Arabidopsis during geminivirusCaLCuV infection found that, out of 1570 E3 ligases, 149 were up-regulated and 23 were downregulated (Ascencio-Ibanez et al., 2008; Lozano-Duran et al., 2013). The CaLCuV AC2 protein, in particular, induces downregulation of two E3 ligases in Arabidopsis (Liu et al., 2014). These findings, together with the current study, prove that plant E3 ligase responses to geminivirus infection are neither uniform nor similar, but they vary according to the specific geminivirus and host involved in the interaction.

Responses of cassava to the ssRNApotyvirusesCassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV) with respect to E3 ligase expression variably show both downregulation and upregulation in the susceptible varieties. Interestingly, there is no differential expression of E3 ligases in resistant cassava varieties except in Kaleso where a CUL1 is upregulated and a RZPF34 is downregulated (Maruthiet al, 2014; Anjanappaet al., 2016; Amugeet al., 2017). This variable expression of E3 ligases with respect to the virus in the same host suggests that while responses to viral infection are host-dependent, they are also modulated according to the particular virus infecting the plant.

SACMV infection in planta is associated with occurrence of severe symptoms leading to persistent severe infection in susceptible T200 and mild symptoms with recovery at 67 days post infection (dpi) in tolerant TME3 (Allie et al., 2014). The SACMV-induced genetic mutations and differential expression of MeE3L post-infection in TME3 and T200 indicate that it is one of the significant genes involved in the plant’s response to the virus.In planta proteome data from our laboratory shows that during SACMV infection, an E3 ligase (Manes.08G075100) is upregulated in susceptible T200 and downregulated in tolerant TME3 cassava plants at 32 and 67 dpi (unpublished data; Rey), supporting indications from the protoplast system that E3 ligases are responsive to SACMV infection.

7. Limitations

This protocol presented herein suffers some limitations due to the independent cell nature of protoplasts and the short-lived viability of cassava protoplasts in particular. It cannot be used to study cell wall-related genes, cell-to-cell signalling, intercellular movement, long-term responses, or long-term stability of CRISPR-induced gene edits. Further, the use of mesophyll protoplasts may not be suitable to correlate responses in other organs such as roots or flowers. The widely used T7 endonuclease I (T7EI) assay for detecting gene editing activity produced inconclusive results for this present study, and therefore gene editing was indicated by restriction digestion and confirmed by sequencing. It has been reported that CRISPR-Cas9 activity is more accurately reflected by Next Generation Sequencing (NGS) (Sentmanatet al., 2018).In planta validation of results from this protoplast protocol, particularly overexpression and virus-induced gene silencing (VIGS)of targeted genes, as well as functional and interaction studies, must be conducted to confirm the specific roles played by candidate genes in the host-virus interaction.

We have developed a simple and faster protocol for CRISPR-mediated transient gene expression assay in cassava protoplasts infected with SACMV. While existing gene editing protocols for cassava plants takes about 15 weeks, our protoplast-based method takes 7 weeks to provide experimental data that is suitable for screening candidate genes and informing in planta functional genomics studies. Using this protocol, we show that SACMV DNA accumulation in cassava protoplasts is genotype-dependentand it induces silencing of the MeE3L RING domain in susceptible T200 and tolerant TME3 landraces. We provide evidence for differential expression of native and mutantMeE3L during SACMV infection of cassava protoplasts. We also reveal that a SACMV-susceptible southern African cassava landrace (T200) expresses a mutant MeE3L with a silenced RING domain.

While this protocol cannot account for events relating to cell-to-cell signalling and movement, it does provide a basis for tentative identification of genes that respond to geminiviral infection in cassava. It may be adapted for high-throughput screening by targeting several genes simultaneously using a CRISPR multiplex approach.

AC4: post-transcriptional gene silencing suppressor protein

ACMV: African cassava mosaic virus

APC: anaphase-promoting complex

APC2: APC Regulator of WNT Signaling Pathway 2

ASK: Arabidopsis SKP1-related

BLAST: Basic local alignment search tool

bp: base pair

BSCTV: Beet severe curly top virus

BTB: bric a brac, tramtrack and broad complex

C2: Transcriptional activator protein

C4: post-transcriptional gene silencing suppressor protein

CaLCuV: Cabbage leaf curl virus

CCNF: cyclin F

cIAP1: Cellular inhibitor of apoptosis protein 1

CMD: Cassava mosaic disease

CPW9M: Cell and Protoplast Washing 9 Mannitol

CRISPR: Clustered regularly interspaced short palindromic repeats

CRL: Cullin ring

CUL1: Cullin 1

CUL4-DDB: cullin4-damaged DNA-binding protein

cv: cultivar

DBS: double-stranded break

DDB1: DNA damage-binding protein 1

DNA: Deoxyribonucleic acid

dpi: days post infection

DUB: Deubiquitinating enzyme

EACMV: East African cassava mosaic virus

eGFP: Enhanced Green Fluorescent Protein

FAO: Food and Agriculture Organisation

FW: fresh weight

g: gram

g: standard acceleration due to gravity

GFP: Green Fluorescent Protein

h: hour

HECT: Homologous to E6-associated protein C-terminus

hpt: hours post-transfection

Hsp: Heat shock protein

IAP: Inhibitor of apoptosis protein

IR: intergenic region

I-TASSER: Iterative Threading ASSEmbly Refinement

JTT: Jones-Taylor-Thornton

µg: microgram

µM: micromolar

M: molar

MeE3L: Manihotesculenta E3 Ligase

MEGA X: Molecular Evolutionary Genetics Analysis X

mg: milligram

min: minute

ml: millilitre

mM: millimolar

MMg: mannitol magnesium

N→C: amino terminus to carboxy terminus

NbSKP1: Nicotianabenthamiana S-phase kinase-associated protein 1

NLR: nucleotide-binding leucine-rich repeat

NMD: nonsense-mediated mRNA decay

NtHUB1: Nicotianabenthamiana homologous to ubiquitin protein 1

PCR: Polymerase chain reaction

PEG: polyethylene glycol

qPCR: Quantitative polymerase chain reaction

QTL: quantitative trait locus

R protein: resistance protein

RBR: RING-between-RING RING

RBX1: RING-box protein 1

Rep: Replication-associated protein

RHF2A: RING-H2 finger E3 ubiquitin ligase protein

RING: Really Interesting New Gene

RNA: Ribonucleic acid

rpm: revolutions per minute

rRNA: ribosomal RNA

RZPF34: RING zinc finger protein 34

SACMV: South African cassava mosaic virus

SCF: Skp, Cullin, F-box containing complex

sgRNA: single guide RNA

siRNA: small interfering RNA

ssRNA: single stranded RNA

T200: Tropical Manihotesculenta 200

TIDE: Tracking of indels by decomposition

TME3: Tropical Manihotesculenta3

ToLCNDV: Tomato leaf curl New Delhi virus

TYLCCV: Tomato yellow leaf curl China virus

TYLCSV: Tomato yellow leaf curl Sardinia virus

UCBSV: Ugandan cassava brown streak virus

UPS: ubiquitin proteasome system

UTR: untranslated region

βC1: movement protein

Ethics approval and consent to participate

Not applicable

Consent to publication

Not applicable

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing Interests

The authors declare that they have no competing interests.

Funding

The study was supported by a National Research Foundation of South Africa Blues Skies grant for project ID 104829. Funders played no role in in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Authors’ contributions

CR conceptualised the study. PC performed experiments, analysed results and wrote the manuscript. Both authors interpreted data, and read and approved the final manuscript.

Acknowledgements

The authors thank Prof Hervé Vanderschuren (University of Liège, Belgium) for the Cas9 vector, Prof Stefan FT Weiss (Wits University) for access to the flow cytometer, and the Microscopy and Microanalysis Unit (Wits University) for assistance with fluorescence microscopy.

Abel S, Theologis A. Transient transformation of Arabidopsis leaf protoplasts: a versatile experimental system to study gene expression. Plant J. 1994 Mar;5(3):421–7.
Akano A, Dixon A, Mba C, Barrera E, Fregene M. Genetic mapping of a dominant gene conferring resistance to cassava mosaic disease. TheorAppl Genet. 2002 Sep;105(4):521–5. Available from: http://link.springer.com/10.1007/s00122-002-0891-7
Alabi OJ, Kumar LP, Naidu RA. Cassava Mosaic Disease: A curse to food security in Sub-Saharan Afrca. APSnetFeatur. 2011;
Alcaide-Loridan C, Jupin I. Ubiquitin and Plant Viruses, Let’s Play Together! Plant Physiol. 2012 Sep 1;160(1):72–82. Available from: http://www.plantphysiol.org/lookup/doi/10.1104/pp.112.201905
Allie F, Pierce EJ, Okoniewski MJ, Rey C. Transcriptional analysis of South African cassava mosaic virus-infected susceptible and tolerant landraces of cassava highlights differences in resistance, basal defense and cell wall associated genes during infection. BMC Genomics. 2014 Nov 20;15(1):1006. Available from: http://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-1006
Amuge T, Berger DK, Katari MS, Myburg AA, Goldman SL, Ferguson ME. A time series transcriptome analysis of cassava (ManihotesculentaCrantz) varieties challenged with Ugandan cassava brown streak virus. Sci Rep. 2017 Dec 29;7(1):9747. Available from: http://www.nature.com/articles/s41598-017-09617-z
Anjanappa RB, Mehta D, Maruthi MN, Kanju E, Gruissem W, Vanderschuren H. Characterization of Brown Streak Virus–Resistant Cassava. Mol Plant-Microbe Interact. 2016 Jul;29(7):527–34. Available from: https://apsjournals.apsnet.org/doi/10.1094/MPMI-01-16-0027-R
Anthony P, Davey MR, Power JB, Lowe KC. An improved protocol for the culture of cassava leaf protoplasts. Plant Cell Tissue Organ Cult. 1995 Sep;42(3):299–302. Available from: https://doi.org/10.1007/BF00030004
Ascencio-Ibáñez JT, Sozzani R, Lee T-J, Chu T-M, Wolfinger RD, Cella R, et al. Global Analysis of Arabidopsis Gene Expression Uncovers a Complex Array of Changes Impacting Pathogen Response and Cell Cycle during Geminivirus Infection. Plant Physiol. 2008 Sep;148(1):436–54. Available from: http://www.plantphysiol.org/lookup/doi/10.1104/pp.108.121038
Berman HM. The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235–42. Available from: https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/28.1.235
Berrie LC, Palmer KE, Rybicki EP, Rey MEC. Molecular characterisation of a distinct South African cassava infecting geminivirus. Arch Virol. 1998 Nov 8;143(11):2253–60. Available from: https://doi.org/10.1007/s007050050457
Berrie LC, Palmer K, Rybicki EP, Hidayat SH, Maxwell DP, Rey MEC. A new isolate of African cassava mosaic virus in South Africa. African J Root Tuber Crop. 1997;
Berrie LC, Rybicki EP, Rey MEC. Complete nucleotide sequence and host range of South African cassava mosaic virus: further evidence for recombination amongst begomoviruses. J Gen Virol. 2001 Jan 1;82(1):53–8. Available from: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/0022-1317-82-1-53
Berry S, Rey MEC. Molecular evidence for diverse populations of cassava-infecting begomoviruses in southern Africa. Arch Virol. 2001 Sep 1;146(9):1795–802. Available from: http://link.springer.com/10.1007/s007050170065
Bredeson J V, Lyons JB, Prochnik SE, Wu GA, Ha CM, Edsinger-Gonzales E, et al. Sequencing wild and cultivated cassava and related species reveals extensive interspecific hybridization and genetic diversity. Nat Biotechnol. 2016 May 18;34(5):562–70. Available from: https://doi.org/10.1038/nbt.3535
Briddon RW, Robertson I, Markham PG, Stanley J. Occurrence of South African cassava mosaic virus (SACMV) in Zimbabwe. Plant Pathol. 2004 Apr 1;53(2):233–233. Available from: https://doi.org/10.1111/j.0032-0862.2004.00963.x
Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014 Dec 16;42(22):e168–e168. Available from: http://academic.oup.com/nar/article/42/22/e168/2411890/Easy-quantitative-assessment-of-genome-editing-by
Ceballos H, Kawuki RS, Gracen VE, Yencho GC, Hershey CH. Conventional breeding, marker-assisted selection, genomic selection and inbreeding in clonally propagated crops: a case study for cassava. TheorAppl Genet. 2015 Sep 21;128(9):1647–67. Available from: http://link.springer.com/10.1007/s00122-015-2555-4
Chen S, Tao L, Zeng L, Vega-Sanchez Me, Umemura K, Wang G-L. A highly efficient transient protoplast system for analyzing defence gene expression and protein-protein interactions in rice. Mol Plant Pathol. 2006 Sep 1;7(5):417–27. Available from: http://doi.wiley.com/10.1111/j.1364-3703.2006.00346.x
Chen X, He Z, Fu M, Wang Y, Wu H, Li X, et al. The E3 Ubiquitin Ligase Siah-1 Suppresses Avian Reovirus Infection by Targeting p10 for Degradation. López S, editor. J Virol. 2018 Jan 10;92(6). Available from: https://jvi.asm.org/content/92/6/e02101-17
Cheng C-W, Hsiao Y-Y, Wu H-C, Chuang C-M, Chen J-S, Tsai C-H, et al. Suppression of Bamboo Mosaic Virus Accumulation by a Putative Methyltransferase in Nicotianabenthamiana. J Virol. 2009 Jun 1;83(11):5796–805. Available from: https://jvi.asm.org/content/83/11/5796
Chikoti PC, Mulenga RM, Tembo M, Sseruwagi P. Cassava mosaic disease: a review of a threat to cassava production in Zambia. J Plant Pathol. 2019 Aug 12;101(3):467–77. Available from: http://link.springer.com/10.1007/s42161-019-00255-0
Cougot D, Neuveut C, Buendia MA. HBV induced carcinogenesis. J ClinVirol. 2005 Dec;34:S75–8. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1386653205800149
Czosnek H, Eybishtz A, Sade D, Gorovits R, Sobol I, Bejarano E, et al. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing. Viruses. 2013 Mar 22;5(3):998–1022. Available from: http://www.mdpi.com/1999-4915/5/3/998
De Bruyn A, Harimalala M, Zinga I, Mabvakure BM, Hoareau M, Ravigné V, et al. Divergent evolutionary and epidemiological dynamics of cassava mosaic geminiviruses in Madagascar. BMC Evol Biol. 2016 Dec 6;16(1):182. Available from: https://doi.org/10.1186/s12862-016-0749-2
Dueber EC, Schoeffler AJ, Lingel A, Elliott JM, Fedorova A V, Giannetti AM, et al. Antagonists Induce a Conformational Change in cIAP1 That Promotes Autoubiquitination. Science (80- ). 2011 Oct 21;334(6054):376–80. Available from: https://www.sciencemag.org/lookup/doi/10.1126/science.1207862
Duxbury EM, Day JP, Maria Vespasiani D, Thüringer Y, Tolosana I, Smith SC, et al. Host-pathogen coevolution increases genetic variation in susceptibility to infection. Lemaître B, Tautz D, Lemaître B, editors. Elife. 2019 Apr 30;8:e46440. Available from: https://doi.org/10.7554/eLife.46440
Ermark G, Paszkowski U, Wohlmuth M, Scheid OM, Paszkowski J. Cytosine methylation inhibits replication of African cassava mosaic virus by two distinct mechanisms. Nucleic Acids Res. 1993 Jul 25;21(15):3445–50. Available from: https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/21.15.3445
FAO. Save and grow: Cassava - a guide to sustainable production intensification. 2013. p. 78.
Faraco M, Di Sansebastiano G Pietro, Spelt K, Koes RE, Quattrocchio FM. One Protoplast Is Not the Other! Plant Physiol. 2011 Jun;156(2):474–8. Available from: http://www.plantphysiol.org/lookup/doi/10.1104/pp.111.173708
Fondong VN, Rey C. Recent Biotechnological Advances in the Improvement of Cassava. In: Waisundara V, editor. Cassava. InTech; 2018. p. 139–61. Available from: http://www.intechopen.com/books/cassava/recent-biotechnological-advances-in-the-improvement-of-cassava
Haeussler M, Schönig K, Eckert H, Eschstruth A, Mianné J, Renaud J-B, et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 2016 Dec 5;17(1):148. Available from: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-1012-2
Hahn SK, Terry ER, Leuschner K. Breeding cassava for resistance to cassava mosaic disease. Euphytica. 1980 Nov;29(3):673–83. Available from: https://doi.org/10.1007/BF00023215
Hanley-Bowdoin L, Bejarano ER, Robertson D, Mansoor S. Geminiviruses: masters at redirecting and reprogramming plant processes. Nat Rev Microbiol. 2013 Nov 8;11(11):777–88. Available from: http://www.nature.com/articles/nrmicro3117
Haynes JL. Principles of flow cytometry. Cytometry. 1988;9(S3):7–17. Available from: http://doi.wiley.com/10.1002/cyto.990090804
Huang C-N, Cornejo MJ, Bush DS, Jones RL. Estimating viability of plant protoplasts using double and single staining. Protoplasma. 1986 Jun;135(2–3):80–7. Available from: http://link.springer.com/10.1007/BF01277001
Ishii S. Factors Influencing Protoplast Viability of Suspension-Cultured Rice Cells during Isolation Process. Plant Physiol. 1988 Sep 1;88(1):26–9. Available from: http://www.plantphysiol.org/lookup/doi/10.1104/pp.88.1.26
Jeevalatha A, Siddappa S, Kumar A, Kaundal P, Guleria A, Sharma S, et al. An insight into differentially regulated genes in resistant and susceptible genotypes of potato in response to tomato leaf curl New Delhi virus-[potato] infection. Virus Res. 2017 Mar;232:22–33. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0168170216304816
Jennings DL. Breeding for resistance to African cassava mosaic geminivirus in East Africa. Trop Sci. 1994;34(1):110–22.
Kalyebi A, Macfadyen S, Parry H, Tay WT, De Barro P, Colvin J. African cassava whitefly, Bemisiatabaci, cassava colonization preferences and control implications. Gao Y, editor. PLoS One. 2018 Oct 9;13(10):e0204862. Available from: https://doi.org/10.1371/journal.pone.0204862
Kim MJ, Baek K, Park C-M. Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis. Plant Cell Rep. 2009 Aug 30;28(8):1159–67. Available from: http://link.springer.com/10.1007/s00299-009-0717-z
Kumar RV. Plant Antiviral Immunity Against Geminiviruses and Viral Counter-Defense for Survival. Front Microbiol. 2019 Jun 26;10:1460. Available from: https://www.frontiersin.org/article/10.3389/fmicb.2019.01460/full
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Battistuzzi FU, editor. MolBiolEvol. 2018 Jun 1;35(6):1547–9. Available from: https://academic.oup.com/mbe/article/35/6/1547/4990887
Kuon J-E, Qi W, Schläpfer P, Hirsch-Hoffmann M, von Bieberstein PR, Patrignani A, et al. Haplotype-resolved genomes of geminivirus-resistant and geminivirus-susceptible African cassava cultivars. BMC Biol. 2019 Dec 18;17(1):75. Available from: https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-019-0697-6
Kushwaha NK, Bhardwaj M, Chakraborty S. The replication initiator protein of a geminivirus interacts with host monoubiquitination machinery and stimulates transcription of the viral genome. Zhou X, editor. PLOS Pathog. 2017 Aug 31;13(8):e1006587. Available from: https://doi.org/10.1371/journal.ppat.1006587
Lai J, Chen H, Teng K, Zhao Q, Zhang Z, Li Y, et al. RKP, a RING finger E3 ligase induced by BSCTV C4 protein, affects geminivirus infection by regulation of the plant cell cycle. Plant J. 2009 Mar;57(5):905–17. Available from: http://doi.wiley.com/10.1111/j.1365-313X.2008.03737.x
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007 Nov 1;23(21):2947–8. Available from: https://academic.oup.com/bioinformatics/article-lookup/doi/10.1093/bioinformatics/btm404
Lefeuvre P, Martin DP, Hoareau M, Naze F, Delatte H, Thierry M, et al. Begomovirus “melting pot” in the south-west Indian Ocean islands: molecular diversity and evolution through recombination. J Gen Virol. 2007 Dec 1;88(12):3458–68. Available from: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.83252-0
Legg JP, Thresh JM. Cassava mosaic virus disease in East Africa: a dynamic disease in a changing environment. Vol. 71, Virus research. Netherlands; 2000. p. 135–49. Available from: https://pubmed.ncbi.nlm.nih.gov/11137168
Legg JP, Owor B, Sseruwagi P, Ndunguru J. Cassava Mosaic Virus Disease in East and Central Africa: Epidemiology and Management of A Regional Pandemic. In: Plant Virus Epidemiology. Academic Press; 2006. p. 355–418. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0065352706670103
Legg JP, Lava Kumar P, Makeshkumar T, Tripathi L, Ferguson M, Kanju E, et al. Cassava Virus Diseases. In: Advances in virus research. United States; 2015. p. 85–142. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0065352714000025
Lentz E, Eisner S, McCallum E, Schlegel K, Campos F, Gruissem W, et al. Genetic Transformation of Recalcitrant Cassava by Embryo Selection and Increased Hormone Levels. Methods Protoc. 2018 Nov 13;1(4):42. Available from: http://www.mdpi.com/2409-9279/1/4/42
Liao W, Li Y, Yang Y, Wang G, Peng M. Exposure to various abscission-promoting treatments suggests substantial ERF subfamily transcription factors involvement in the regulation of cassava leaf abscission. BMC Genomics. 2016 Dec 3;17(1):538. Available from: http://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-016-2845-5
Libault M, Wan J, Czechowski T, Udvardi M, Stacey G. Identification of 118 Arabidopsis Transcription Factor and 30 Ubiquitin-Ligase Genes Responding to Chitin, a Plant-Defense Elicitor. Mol Plant-Microbe Interact. 2007 Aug;20(8):900–11. Available from: https://apsjournals.apsnet.org/doi/10.1094/MPMI-20-8-0900
Lin C-S, Hsu C-T, Yang L-H, Lee L-Y, Fu J-Y, Cheng Q-W, et al. Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnol J. 2018/01/10. 2018 Jul;16(7):1295–310. Available from: http://doi.wiley.com/10.1111/pbi.12870
Liu L, Chung HY, Lacatus G, Baliji S, Ruan J, Sunter G. Altered expression of Arabidopsis genes in response to a multifunctional geminivirus pathogenicity protein. BMC Plant Biol. 2014 Dec 18;14(1):302. Available from: https://doi.org/10.1186/s12870-014-0302-7
Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001 Dec;25(4):402–8. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1046202301912629
Locatelli F, Vannini C, Magnani E, Coraggio I, Bracale M. Efficiency of transient transformation in tobacco protoplasts is independent of plasmid amount. Plant Cell Rep. 2003 Jun 7;21(9):865–71. Available from: http://link.springer.com/10.1007/s00299-003-0593-x
Lokko Y, Dixon A, Offei S, Danquah E, Fregene M. Assessment of genetic diversity among African cassava ManihotesculentaGrantz accessions resistant to the cassava mosaic virus disease using SSR markers. Genet Resour Crop Evol. 2006 Oct 31;53(7):1441–53. Available from: http://link.springer.com/10.1007/s10722-005-6841-x
Loyola-Vargas VM, Avilez-Montalvo RN. Plant Tissue Culture: A Battle Horse in the Genome Editing Using CRISPR/Cas9. In: Methods in molecular biology (Clifton, NJ). United States; 2018. p. 131–48. Available from: http://link.springer.com/10.1007/978-1-4939-8594-4_7
Lozano R, Hamblin MT, Prochnik S, Jannink J-L. Identification and distribution of the NBS-LRR gene family in the Cassava genome. BMC Genomics. 2015 Dec 7;16(1):360. Available from: http://www.biomedcentral.com/1471-2164/16/360
Lozano-Duran R, Bejarano E. Geminiviral Co-option of Post-Translational Modification Pathways. In 2013.
Lozano-Duran R, Bejarano ER. Geminivirus C2 protein might be the key player for geminiviral co-option of SCF-mediated ubiquitination. Plant Signal Behav. 2011 Jul 28;6(7):999–1001. Available from: http://www.tandfonline.com/doi/abs/10.4161/psb.6.7.15499
Lozano-Durán R, Rosas-Díaz T, Gusmaroli G, Luna AP, Taconnat L, Deng XW, et al. Geminiviruses Subvert Ubiquitination by Altering CSN-Mediated Derubylation of SCF E3 Ligase Complexes and Inhibit JasmonateSignaling in Arabidopsis thaliana. Plant Cell. 2011 Mar 1;23(3):1014–32. Available from: http://www.plantcell.org/lookup/doi/10.1105/tpc.110.080267
Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015 Aug;8(8):1274–84. Available from: https://linkinghub.elsevier.com/retrieve/pii/S167420521500204X
Machida K, Cheng KT-N, Sung VM-H, Shimodaira S, Lindsay KL, Levine AM, et al. Hepatitis C virus induces a mutator phenotype: Enhanced mutations of immunoglobulin and protooncogenes. Proc NatlAcad Sci. 2004 Mar 23;101(12):4262–7. Available from: http://www.pnas.org/cgi/doi/10.1073/pnas.0303971101
Maruthi MN, Bouvaine S, Tufan HA, Mohammed IU, Hillocks RJ. Transcriptional Response of Virus-Infected Cassava and Identification of Putative Sources of Resistance for Cassava Brown Streak Disease. Fang DD, editor. PLoS One. 2014 May 20;9(5):e96642. Available from: https://doi.org/10.1371/journal.pone.0096642
Mazzucotelli E, Belloni S, Marone D, De Leonardis A, Guerra D, Di Fonzo N, et al. The E3 Ubiquitin Ligase Gene Family in Plants: Regulation by Degradation. Curr Genomics. 2006 Dec 1;7(8):509–22. Available from: http://www.eurekaselect.com/openurl/content.php?genre=article&issn=1389-2029&volume=7&issue=8&spage=509
Miozzi L, Napoli C, Sardo L, Accotto GP. Transcriptomics of the Interaction between the Monopartite Phloem-Limited Geminivirus Tomato Yellow Leaf Curl Sardinia Virus and Solanum lycopersicumHighlights a Role for Plant Hormones, Autophagy and Plant Immune System Fine Tuning during Infection. Di Cunto F, editor. PLoS One. 2014 Feb 28;9(2):e89951. Available from: https://dx.plos.org/10.1371/journal.pone.0089951
Montes N, Alonso-Blanco C, García-Arenal F. Cucumber mosaic virus infection as a potential selective pressure on Arabidopsis thaliana populations. Guo H-S, editor. PLOS Pathog. 2019 May 28;15(5):e1007810. Available from: https://doi.org/10.1371/journal.ppat.1007810
Moreno I, Gruissem W, Vanderschuren H. Reference genes for reliable potyvirus quantitation in cassava and analysis of Cassava brown streak virus load in host varieties. J Virol Methods. 2011 Oct;177(1):49–54. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0166093411002771
Muimba-Kankolongo A. Root and Tuber Crops. In: Muimba-Kankolongo ABT-FCP by SF in SA, editor. Food Crop Production by Smallholder Farmers in Southern Africa. Elsevier; 2018. p. 123–72. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780128143834000098
Murashige T, Skoog F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol Plant. 1962 Jul 28;15(3):473–97. Available from: http://doi.wiley.com/10.1111/j.1399-3054.1962.tb08052.x
Nanjareddy K, Arthikala M-K, Blanco L, Arellano ES, Lara M. Protoplast isolation, transient transformation of leaf mesophyll protoplasts and improved Agrobacterium-mediated leaf disc infiltration of Phaseolus vulgaris: tools for rapid gene expression analysis. BMC Biotechnol. 2016 Dec 24;16(1):53. Available from: http://bmcbiotechnol.biomedcentral.com/articles/10.1186/s12896-016-0283-8
Nzuki I, Katari MS, Bredeson J V, Masumba E, Kapinga F, Salum K, et al. QTL Mapping for Pest and Disease Resistance in Cassava and Coincidence of Some QTL with Introgression Regions Derived from Manihotglaziovii. Front Plant Sci. 2017 Jul 21;8:1168. Available from: http://journal.frontiersin.org/article/10.3389/fpls.2017.01168/full
Odipio J, Alicai T, Ingelbrecht I, Nusinow DA, Bart R, Taylor NJ. Efficient CRISPR/Cas9 Genome Editing of Phytoene desaturase in Cassava. Front Plant Sci. 2017 Oct 18;8:1780. Available from: https://www.frontiersin.org/article/10.3389/fpls.2017.01780
Okogbenin E, Porto MCM, Egesi C, Mba C, Espinosa E, Santos LG, et al. Marker-Assisted Introgression of Resistance to Cassava Mosaic Disease into Latin American Germplasm for the Genetic Improvement of Cassava in Africa. Crop Sci. 2007 Sep;47(5):1895–904. Available from: http://dx.doi.org/10.2135/cropsci2006.10.0688
Otti G, Bouvaine S, Kimata B, Mkamillo G, Kumar PL, Tomlins K, et al. High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants. J ApplMicrobiol. 2016 May 1;120(5):1346–56. Available from: https://doi.org/10.1111/jam.13043
Patanun O, Ueda M, Itouga M, Kato Y, Utsumi Y, Matsui A, et al. The Histone Deacetylase Inhibitor SuberoylanilideHydroxamic Acid Alleviates Salinity Stress in Cassava. Front Plant Sci. 2017 Jan 9;7:2039. Available from: http://journal.frontiersin.org/article/10.3389/fpls.2016.02039/full
Pierce EJ, Rey MEC. Assessing Global Transcriptome Changes in Response to South African Cassava Mosaic Virus [ZA-99] Infection in Susceptible Arabidopsis thaliana. Rosenberg HF, editor. PLoS One. 2013 Jun 27;8(6):e67534. Available from: https://doi.org/10.1371/journal.pone.0067534
Prochnik S, Marri PR, Desany B, Rabinowicz PD, Kodira C, Mohiuddin M, et al. The Cassava Genome: Current Progress, Future Directions. Trop Plant Biol. 2012 Mar 5;5(1):88–94. Available from: http://link.springer.com/10.1007/s12042-011-9088-z
Ren R, Gao J, Lu C, Wei Y, Jin J, Wong S-M, et al. Highly Efficient Protoplast Isolation and Transient Expression System for Functional Characterization of Flowering Related Genes in Cymbidium Orchids. Int J Mol Sci. 2020 Mar 25;21(7):2264. Available from: https://www.mdpi.com/1422-0067/21/7/2264
Rey C, Vanderschuren H. Cassava Mosaic and Brown Streak Diseases: Current Perspectives and Beyond. Annu Rev Virol. 2017 Sep 29;4(1):429–52. Available from: http://www.annualreviews.org/doi/10.1146/annurev-virology-101416-041913
Richter KS, Kleinow T, Jeske H. Somatic homologous recombination in plants is promoted by a geminivirus in a tissue-selective manner. Virology. 2014 Mar;452–453:287–96. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0042682214000373
Rogans SJ, Rey C. Unveiling the Micronome of Cassava (ManihotesculentaCrantz). Barozai M, editor. PLoS One. 2016 Jan 22;11(1):e0147251. Available from: https://dx.plos.org/10.1371/journal.pone.0147251
Rozewicki J, Li S, Amada KM, Standley DM, Katoh K. MAFFT-DASH: integrated protein sequence and structural alignment. Nucleic Acids Res. 2019 May 7;47(W1):W5–10. Available from: https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz342/5486273
SACRISTÁN S, GARCÍA‐ARENAL F. The evolution of virulence and pathogenicity in plant pathogen populations. Mol Plant Pathol. 2008 May 5;9(3):369–84. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1364-3703.2007.00460.x
Sadanandom A, Bailey M, Ewan R, Lee J, Nelis S. The ubiquitin-proteasome system: central modifier of plant signalling. New Phytol. 2012 Oct 1;196(1):13–28. Available from: https://doi.org/10.1111/j.1469-8137.2012.04266.x
Sahu PP, Sharma N, Puranik S, Muthamilarasan M, Prasad M. Involvement of host regulatory pathways during geminivirus infection: a novel platform for generating durable resistance. FunctIntegr Genomics. 2014 Mar 14;14(1):47–58. Available from: https://doi.org/10.1007/s10142-013-0346-z
Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 2014 Apr 2;32(4):347–55. Available from: http://www.nature.com/articles/nbt.2842
Sentmanat MF, Peters ST, Florian CP, Connelly JP, Pruett-Miller SM. A Survey of Validation Strategies for CRISPR-Cas9 Editing. Sci Rep. 2018 Dec 17;8(1):888. Available from: https://doi.org/10.1038/s41598-018-19441-8
Shahin EA, Shepard JF. Cassava mesophyll protoplasts: Isolation, proliferation, and shoot formation. Plant Sci Lett. 1980 Mar;17(4):459–65. Available from: https://linkinghub.elsevier.com/retrieve/pii/0304421180901339
Sheen J. Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol. 2001 Dec;127(4):1466–75. Available from: http://www.ncbi.nlm.nih.gov/pubmed/11743090
Shen Q, Hu T, Bao M, Cao L, Zhang H, Song F, et al. Tobacco RING E3 Ligase NtRFP1 Mediates Ubiquitination and Proteasomal Degradation of a Geminivirus-Encoded βC1. Mol Plant. 2016/03/24. 2016 Jun 6;9(6):911–25. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1674205216300028
Tang AF. Process and nutrient medium for micropropagation of cassava. United States of America; US4473648A, 1984.
Uchimiya H, Murashige T. Evaluation of Parameters in the Isolation of Viable Protoplasts from Cultured Tobacco Cells. Plant Physiol. 1974 Dec 1;54(6):936–44. Available from: http://www.plantphysiol.org/lookup/doi/10.1104/pp.54.6.936
Vanitharani R, Chellappan P, Fauquet CM. Short interfering RNA-mediated interference of gene expression and viral DNA accumulation in cultured plant cells. Proc Natl Acad Sci. 2003 Aug 5;100(16):9632–6. Available from: http://www.pnas.org/cgi/doi/10.1073/pnas.1733874100
Verchot J. Plant Virus Infection and the Ubiquitin Proteasome Machinery: Arms Race along the Endoplasmic Reticulum. Viruses. 2016 Nov 19;8(11):314. Available from: http://www.mdpi.com/1999-4915/8/11/314
Walter M, Chaban C, Schütze K, Batistic O, Weckermann K, Näke C, et al. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant J. 2004 Nov 14;40(3):428–38. Available from: https://doi.org/10.1111/j.1365-313X.2004.02219.x
Wang L, Tan H, Wu M, Jimenez-Gongora T, Tan L, Lozano-Duran R. Dynamic Virus-Dependent Subnuclear Localization of the Capsid Protein from a Geminivirus. Front Plant Sci. 2017 Dec 22;8:2165. Available from: http://journal.frontiersin.org/article/10.3389/fpls.2017.02165/full
Wellink J, van Lent JW, Verver J, Sijen T, Goldbach RW, van Kammen A. The cowpea mosaic virus M RNA-encoded 48-kilodalton protein is responsible for induction of tubular structures in protoplasts. J Virol. 1993 Jun;67(6):3660–4. Available from: https://jvi.asm.org/content/67/6/3660
Wolfe MD, Rabbi IY, Egesi C, Hamblin M, Kawuki R, Kulakow P, et al. Genome-Wide Association and Prediction Reveals Genetic Architecture of Cassava Mosaic Disease Resistance and Prospects for Rapid Genetic Improvement. Plant Genome. 2016 Jul;9(2):plantgenome2015.11.0118. Available from: http://doi.wiley.com/10.3835/plantgenome2015.11.0118
Wu F-H, Shen S-C, Lee L-Y, Lee S-H, Chan M-T, Lin C-S. Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method. Plant Methods. 2009;5(1):16. Available from: https://doi.org/10.1186/1746-4811-5-16
Wu J-Z, Liu Q, Geng X-S, Li K-M, Luo L-J, Liu J-P. Highly efficient mesophyll protoplast isolation and PEG-mediated transient gene expression for rapid and large-scale gene characterization in cassava (ManihotesculentaCrantz). BMC Biotechnol. 2017 Dec 14;17(1):29. Available from: http://bmcbiotechnol.biomedcentral.com/articles/10.1186/s12896-017-0349-2
Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods. 2015 Jan 30;12(1):7–8. Available from: http://www.nature.com/articles/nmeth.3213
Yoo S-D, Cho Y-H, Sheen J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2007 Jul 21;2(7):1565–72. Available from: http://www.nature.com/articles/nprot.2007.199
Zainuddin IM, Schlegel K, Gruissem W, Vanderschuren H. Robust transformation procedure for the production of transgenic farmer-preferred cassava landraces. Plant Methods. 2012;8(1):24. Available from: https://doi.org/10.1186/1746-4811-8-24
Zhang Y, Li L-F, Munir M, Qiu H-J. RING-Domain E3 Ligase-Mediated Host–Virus Interactions: Orchestrating Immune Responses by the Host and Antagonizing Immune Defense by Viruses. Front Immunol. 2018 May 22;9:1083. Available from: https://www.frontiersin.org/article/10.3389/fimmu.2018.01083/full

Download PDF

Journal Publication

published 23 Nov, 2020

Read the published version in Virology Journal →

Editorial decision: Accept
24 Oct, 2020
Editor assigned by journal
18 Oct, 2020
Submission checks completed at journal
17 Oct, 2020
Editor invited by journal
17 Oct, 2020

You are reading this latest preprint version

A Cassava Protoplast System for Screening Genes Associated with the Response to South African Cassava Mosaic Virus.

Status:

Journal Publication

Version 2

Abstract

Figures

Background

Methods And Materials

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 2