Medicago sativa Extracts Enhance the Anticancer Efficacy of GEM in PANC-1 Cells through Apoptosis Induction and BAX/BCL-2/CASP3 Expression Modulation

doi:10.21203/rs.3.rs-4143905/v1

Download PDF

Research Article

Medicago sativa Extracts Enhance the Anticancer Efficacy of GEM in PANC-1 Cells through Apoptosis Induction and BAX/BCL-2/CASP3 Expression Modulation

https://doi.org/10.21203/rs.3.rs-4143905/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction

Pancreatic cancer (PC) has a poor prognosis and limited response to therapies. Combinatorial approaches, such as natural product-based therapies, can enhance anticancer efficacy while minimizing side effects. This study evaluated M. sativa’s anticancer properties and its potential as adjunctive therapy with GEM to sensitize PANC-1 cells to chemotherapy.

Methods

The antioxidant activity (AA) and total phenolic content (TPC) of M. sativa extracts (MeOH, EtOAc, and water) were assessed using the DPPH radical scavenging assay. Cytotoxic effects on PANC1 and HUVEC cells were also evaluated by utilizing the MTT assay. Then, apoptosis detection was performed by Annexin V/PI-flow cytometry (FC). Besides, the DNA fragmentation analysis was conducted utilizing agarose gel electrophoresis (AGE). BCL-2, BAX, and CASP3 expression levels in PANC-1 cells using western blot analysis and qRT-PCR.

Results

Herein, DPPH IC₅₀ values for M. sativa extracts (water, MeOH, EtOH) were 76.21, 110.32, and 65.39 µg/ml, respectively. The water extract of M. sativa exhibited the highest TPC (4612.15 ± 119.4 mgGAE/g). The cytotoxicity IC₅₀ values for EtOH M. sativa extract, GEM, and combined GEM with EtOH M. sativa on PANC1 cells were 68.74, 43.53, and 41.22 µg/ml M. sativa + 25 µg/ml GEM, respectively, with no toxicity observed in HUVEC cells. FC analysis revealed that Combining GEM and EtOH M. sativa yielded the highest apoptosis rate (25.6%). Expression changes in BCL-2, BAX, and CASP3, as well as morphological alterations and DNA fragmentation, indicated apoptotic cell death.

Conclusion

Our findings suggested that combining M.sativa EtOH extracts with GEM may represent a promising strategy for treating PC.

Medicago sativa

GEM

Apoptosis

Combination therapy

Pancreatic cancer (PC) is the seventh most prevalent source of death from tumour globally and ranks 12th out of all malignancies [1]. It continues to be a major global burden because of its extreme aggression and low survival rate [2]. Unfortunately, only around 20% of PC patients are surgical candidates [3]. The pyrimidine antimetabolites GEM and 5-fluorouracil were the first effective therapies for PC. Multiagent regimens based on these antimetabolite substrates expanded the therapeutic insights decades later. Despite the emergence of novel chemotherapy approaches in recent decades, medication resistance remains a significant barrier [4]. To enhance the PC patients' overall survival rates, a large body of research has investigated the combination of gemcitabine (GEM) with different agents, e.g., natural products (NPs) [5–8]. NPs are vital in developing innovative treatments, accounting for over 60% of all recognized pharmaceuticals [9]. In vitro and animal model studies have suggested that compounds with diverse structures from numerous natural sources can exert both cancer chemo-preventive and chemotherapeutic effects [10]. The use of herbal medications as an alternative or supplemental cancer treatment option has been widely accepted [10, 11]. Consequently, several new cytotoxic chemicals are discovered in plants yearly, offering new avenues for cancer treatment [12, 13]. Clinical investigations suggest that using plant-derived chemicals in standard anti-tumor regimens may enhance the effectiveness of cancer treatment [14]. The considerable advances achieved in this research area have resulted in the therapeutic use of many secondary plant compounds, whereas others are being investigated in clinical trials serving as anticancer medicines [12].

Secondary metabolites are common compounds that naturally arise in microbes and plants, and their structure and biological properties are determined by the metabolic routes through which they are created [15, 16]. Secondary structural metabolites include alkaloids, terpenoids, organosulfur compounds, and polyphenols [17]. Polyphenols, which are the most frequent natural secondary metabolites, include stilbenes, phenolic acids, and flavonoids, with flavonoids accounting for around two-thirds of all polyphenolic substances [18]. Their chemo-preventive properties, e.g., anticarcinogenic, antioxidant, anti-inflammatory, and antimutagenic effects can be attributed to phenolic bioactivities. They are also involved in cellular mechanisms, e.g., apoptosis (aka programmed cell death), cell cycle arrest, regulating the metabolism of carcinogens, ontogenesis expression, inhibition of DNA binding, as well as cell migration, adhesion, proliferation, or differentiation, and blockage of signaling pathways [19]. Therefore, these non-toxic "NPs" derived from natural resources may be effective in combination with traditional chemotherapeutic medicines for treating human malignancies with fewer side effects and greater efficacy.

Alfalfa (Medicago sativa [M. sativa]), commonly referred to as lucerne, a perennial flowering plant species in pea family (Fabaceae or Leguminosae), which has long been used in China, India, Iran, Iraq, South Africa, Turkey, and the US as a traditional herbal medicine [20]. It has caught researchers' attention thanks to its high nutritional value, which includes high concentrations of amino acids, folate, proteins, vitamins, minerals (e.g., calcium and iron), and phytochemicals (e.g., L-canavanine, coumestrol, isoflavones, carotene, and chlorophyll) [21–24]. Phytoestrogens (e.g., lignans, coumestans, and isoflavones,) found in M. sativa have been associated with improved human health, including osteoporosis prevention, cardiovascular disease, menopausal symptoms, and cancer chemoprevention along with treatment [25]. M. sativa has demonstrated beneficial effects on cytotoxicity and apoptosis in mammary cancer and human erythroleukemia due to its flavonoid contents [26]. Additionally, M. sativa has medicinal benefits, including preventing diabetes, anemia, endometriosis, gastric ulcers, and poor bone density [27, 28].

Apoptosis is essential for preserving tissue homeostasis during development. Defective apoptosis can promote cancer and uncontrolled cell growth. Human cancers often exploit this mechanism by evading cell death, which promotes tumor expansion [29]. Most tumors' inability to initiate apoptosis in response to adequate stimuli represents one of the greatest unresolved difficulties in oncology [29]. Apoptosis can be induced by activating two distinct signaling pathways. The chemical-induced mitochondria-related apoptotic pathway is controlled by important apoptotic proteins (e.g., cytochrome c, Bax, and Bcl-2) and subsequently by the activation of poly(ADP-ribose) polymerase (PARP) and caspase-3 [30, 31]. Because natural compounds may affect apoptotic pathways that are typically inhibited in human malignancies, they may provide new opportunities for cancer therapy development. Natural compounds have garnered significant interest since they safely and efficaciously overcome tumor cells' apoptosis resistance, given the success rate and issues of currently available synthetic medicines for PC [32].

Consequently, this research sought to assess the unique anticancer and antiapoptotic properties of Medicago sativa, as well as its effectiveness as a GEM chemosensitizer to apoptosis in PC.

2.1 Chemicals and Reagents

RPMI1640 medium, Pen-Strep, and trypsin-EDTA were obtained from Thermo Fisher Scientific Inc. (Grand Island, NY, USA), whereas fetal bovine serum (FBS) was obtained from Cytiva (Kremplstraße, Pasching, Austria). The Naphenol™ total phenol assay kit (Navand Salamat Pishtaz Co, Urmia, Iran) was utilized to determine the TPC. Also, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was acquired from Invitrogen (Eugene, Oregon, USA). The Annexin V-FITC/PI Apoptosis Detection Kit (BioLegend, USA) was used for apoptosis detection. GEM hydrochloride was acquired from Sigma-Aldrich Corporation (Saint Louis, Missouri, USA).

2.2 Cell Lines and Culture Condition

The PANC-1 (i.e., Human pancreatic adenocarcinoma, IBRC 10156) and HUVEC CRL-1730 (i.e., Human Umbilical Vein Endothelial Cells) lines as normal cells were acquired from the cell bank of the Iranian Biological Resource Center (IBRCTM, Tehran, Iran) and Royan Stem Cell Bank (Tehran, Iran), respectively. They were then cultured in a mixture media of RPMI1640, 10% FBS, and 1% Pen-Strep (100 units penicillin and 100 µg streptomycin per ml). Afterward, they were incubated at 37°C, 95% relative humidity, and 5% CO2.

2.3 Isolation of plant extract

The M. sativa was prepared and taxonomic identity by the Iranian Plant Protection Research Institute (IRIPP), Tehran, Iran (Herbarium No IRIPP: 3460). The plant's aerial parts were first rinsed with deionized water to get rid of contaminants and subsequently oven-dried at 60°C. Then, the plant's dried aerial parts were mixed to a fine powder by means of a mixer. Extractions of M. sativa were performed with different solvents (MeOH, EtOAc, and water). 20 grams of dried powder were put into the flask and 50 mL of boiled water, 60% ethanol, and MeOH was added. Each sample (20 g) was incubated for 72 h. The extracts were then filtered through Whatman filter paper (No. 1). They were then stored frozen at − 20°C for later use.

2.4 Total Phenol Capacity Determination

TPC is determined by the total phenol assay kit (Naphenol™, Navand Salamat Pishtaz Co, Urmia, Iran) according to the manufacturer’s manual. In brief, 8µl of M.sativa extracts (100 µg/ml) and various concentrations of the standard solution (0, 50, 100, 150, 200, 250, 500 mg/ml) were mixed with 24µl of Reagent-1. This was followed by adding 40 µl of Reagent-2 to the resultant mixture after 5 min and incubating at average thermal condition indoors for 45 min in darkness. The mixture absorbance was calculated at 630 nm and recorded as mg gallic acid equivalents (GAE) per gram of extract using a UV-spectrophotometer (BioTek, Inc, USA). Each experiment was conducted in triplicates, whose results were indicated as mean ± SD.

2.5 Determining Antioxidant Properties

The extracts' free-radical-scavenging capacity was evaluated using the DPPH (1,1-diphenyl-2-picrylhydroxyl) radical scavenging assay kit (Zantox, Birjand, Iran) according to the manufacturer’s manual. In short, 0.15 mM DPPH ethanol solution was mixed with extract solutions at varying concentrations, followed by the vigorous shaking of the reaction mixture. After 30 min, a BioRad Benchmark Plus Microplate Reader (Hercules, California, USA) was used to quantify the remaining DPPH radicals at 517 nm. The extracts' AA was reported as percentage inhibition (I%) relative to a reference solution (e.g., Trolax). Each experiment was conducted in triplicates, whose results were recorded as mean ± SD. 96% ethanol was used as the blank solution, while the negative control comprised a mixture of 2.5 ml of 96% ethanol and 1.0 mM DPPH solution.

2.6 Cell Viability

At a confluence of 80%, the cells were passaged in trypsin/EDTA, each day; cells were examined for morphology and contaminants. They were then seeded in 96-well plates at 5×10⁴ cells/wells and thereafter incubated in standard conditions for 24 h. Next, they were treated three times with varying concentrations of M. sativa (0-150µg/ml), GEM (0-1000 µg/ml), and a combination of M. sativa with GEM for 24 and 48h and 72h. The HUVEC cell line was also treated with various concentrations of M. sativa (0-150µg/ml) for 24, 48h, and 72. Cell viability was evaluated by means of the MTT assay. In brief, the MTT solution was thereafter added per well at 5 mg/ml and then incubated for 2 h at 37°C. Formazan crystals formed were solubilized by adding 100µl DMSO and incubated in standard condition for four hours. The optical density (OD) was then calculated (read) by an ELISA multi-well plate reader at 570 nm. The absorbance of each well compared to control wells (wells not treated with any unique material) was examined and analyzed to determine IC₅₀.

Cell viability (%) = (treated cell OD - blank OD)/(vehicle control OD - blank OD) × 100 [33].

2.7 Morphological alterations assay

The PANC-1 cells were seeded at 5×10⁵ cells/wells in 6-well plates and incubated thereafter for 24 h in standard conditions. They were then treated with IC₅₀ of M. sativa and a combination of M. sativa with GEM for 10–30 h. In the end, an inverted phase-contrast microscope was utilized to monitor any observable morphological changes.

2.8 Apoptosis Detection Flowcytometry

The evaluation of apoptotic cells induced by M. sativa, GEM, and their combination on PANC-1 was conducted by FC using BioLegend's Annexin V-FITC Apoptosis Detection Kit (USA) based on the manufacturer’s manual. The cells (5×10⁵) were then seeded in 6-well plates, after 24h which cells became 80% confluent, they were treated with a pre-calculated IC₅₀ concentration. This was followed by incubating both treated and control cells at 37°C and 5% CO₂ for 48 h. Next, they were harvested using 2.5% trypsin and thereafter risened with phosphate-buffered saline (PBS). They were then resuspended in 500ul 1X binding buffer, followed by staining with PI staining solution (5 µL) and Annexin V-FITC (5 µL) for exactly 15 minutes at room temperature in darkness. Finally, they were immediately analyzed via a BD Biosciences' FACSCalibur flow cytometer by utilizing BD and FlowJo software.

2.9 Gene expression assay

Invitrogen TRIzol reagent (Carlsbad, California, USA) was employed to extract the total RNA from the cells that were untreated and treated with IC₅₀ concentration. Also, a NanoDrop Technologies ND-1000 Spectrophotometer was employed to calculate RNA concentrations at 260/280 nm by UV spectrophotometry. Agarose gel electrophoresis (AGE) was adopted as a measure of nucleic acid purity. The reverse transcription of 1µg RNA contained in each sample was performed using the Thermo Scientific RevertAid RT Reverse Transcription Kit (Cat No. K1691).

A Rotor-Gene Q MDx PCR cycler (Qiagen GmbH) was used to evaluate BAX, BCL2, and CASP3 expressions. Based on the manufacturer's instructions, the BAX, BCL2, and CASP3 genes were amplified by cDNA fragments as templates by employing 2X Real-Time PCR Master Mix^ⓗ (Biofact™, Korea, Cat No. DQ383-40H). Here is how the experimental protocol was performed: i) Thermocycling conditions included initial activation at a temperature of 95˚C for 15 min, and subsequently, 35 cycles at 94˚C for 35 sec and 60˚C for 40 sec; and ii) melting curve analysis. Table 1 lists qPCR's primer sequences. The GAPDH gene is employed as an endogenous normalizing gene. Gene expression levels were measured according to the Ct values by utilizing the 2^−ΔΔCt formula.

Table 1

Specific primer sequences for qRT-PCR
Name		Sequence (5'to3')	Length	GC%	Tm˚ C
CASP3	Forward	TTCAGAGGGGATCGTTGTAG	20	50	56.36
	Reverse	TCAATGCCACAGTCCAGTTC	20	50	58.10
BAX	Forward	CCACCCTGGTCTTGGATCCAGCCC	24	66.67	68.71
	Reverse	CCTGTGCACCAAGGTGCCGGAACT	24	62.50	69.46
BCL2	Forward	TTGTGGCCTTCTTTGAGTTCGGTG	24	50.00	63.77
	Reverse	GGTGCCGGTTCAGGTACTCAGTCA	24	58.33	66.18
GAPDH	Forward	TGCCTCCTGCACCACCAAC	19	63.16	62.79
	Reverse	CGGAGGGGCCATCCACAG	18	72.22	62.18

2.10 Western Blotting

To investigate the effects of M. sativa, GEM, and a combination of the two on Caspase 3, Bcl-2, and Bax, protein expression, the cells underwent treatment with the indicated IC₅₀ concentrations of M. sativa, GEM, and their combination for 48 h. Following treatment, cell lysis was performed in RIPA buffer and denatured. The protein samples were first equilibrated in a transfer buffer that contained 50 mM Tris, 40 mM glycine, 20% methanol, and 0.375% SDS, with pH 9.0. Afterward, they were separated on a 12% SDS-PAGE gel and transferred thereafter to an Immobilon-P Transfer Membrane (Millipore Co., Bedford, Massachusetts, USA).

The transferred membrane blocking was done for 30 min at room temperature with 5% non-fat milk. Once diluted in primary antibody dilution buffer (Coolaber, SL1360), primary antibodies were placed in an incubator overnight at 4°C with the nitrocellulose membranes. These included anti-caspase-3 (ABclonal, A2156), anti-Bax (Upstate, Lake Placid, NY, USA), and anti-Bcl-2 (Upstate Biotechnologies, Lake Placid, NY, USA). Next, the membranes were put into the incubator with HRP-conjugated secondary antibodies corresponding to them for 2 hours at room temperature. These antibodies were then added to the membrane upon washing to remove any unbound primary antibodies. The target proteins can be discovered because secondary antibodies can recognize and bind to primary antibodies. Protein levels were standardized by comparing them to the densitometry of GAPDH, which served as an internal reference, by employing the ImageJ software by the National Institutes of Health for quantified analysis of the band.

2.11 DNA Fragmentation Assay

The biochemical apoptotic hallmark is typically thought to be the DNA cleavage into oligonucleosomal fragments, which can be identified as a DNA ladder on AGE. The DNA fragmentation study was performed by selecting the IC₅₀ dose of M. sativa, GEM, and a combination of the two on PANC-1. This was followed by washing the cells (5x105 cells per sample) with PBS and lysing them using a cell lysis buffer [150mM NaCl, 10mM EDTA, 0.5% SDS, 10mM Tris-HCl (pH: 7.5), 500 mg/l proteinase K]. Thereafter, the mixture was incubated overnight at 50°C. This was followed by isolating the lysate with phenol, isopropyl alcohol, and chloroform, and subsequently, precipitating the DNA with ethanol and 3M sodium acetate (pH: 5.2). RNase A (20 g/ml) was then added to the Tris-EDTA buffer solution (10mM Tris, 1mM EDTA, pH: 8.0), and the DNA pellet was put into the incubator thereafter for 30 min at 37°C. The concentration of DNA at 260/280 nm was determined by a NanoDrop ND-1000 UV-VIS spectrophotometer. DNA electrophoresis (20 µg) was done on a 1%w/v EtBr-stained AG. The bands of DNA fragmentation were photographed and analyzed under UV light .

2.12 Statistical Analysis

The t-test was adopted to compare all experimental data, and the results were demonstrated as mean ± SD of the three abovementioned experiments (P < 0.05 was taken to be statistically significant). The IC50 values were computed by regression analysis after triplicate data points were plotted over a concentration range. The graphs were created by employing GraphPad Prism 8.0 (GraphPad, La Jolla, California, USA).

3.1 TPC in M. sativa extracts

In this research, M. sativa extraction was assessed for TPC. Three different solvents (Water, EtOAc, and MeOH) were utilized throughout the extraction TCP process. The TPC content of the water extraction was the highest (4612.15 ± 119.4 mgGAE/g), followed by the extraction of EtOH (3623.21 ± 152.39mg mgGAE/g) and MeOH (2523.18 ± 135.88 mgGAE/g), respectively.

3.2 DPPH radical-scavenging activity

Herein, the M.sativa extract was utilized to evaluate the antioxidant effects of DPPH radical scavenging assays. As a stable free radical, DPPH decolorizes after being exposed to antioxidants [34]. M.sativa has proven to have anti-inflammatory and antioxidant effects [35]. The scavenging effect of each solvent (water, EtOH, and MeOH) extract on DPPH was evaluated. Among extracts studied, EtOH exhibited powerful antioxidant abilities compared to other extracts with 65.39 ± 0.015 IC₅₀. The IC₅₀ values of M.sativa water and MeOH extract were 76.21 ± 0.016 and 110.32 ± 0.017 µg/ml, respectively (Fig. 1).

3.3 In vitro anticancer activities

3.3.1 Cytotoxic effects of M. sativa extracts on PANC-1 and HUVEC cell lines

The cytotoxic effects of various extracts (EtOH, MeOH, and H₂O) of M. sativa on PANC-1 and HUVEC cells at concentrations of 0-150 µg/mL were examined by the MTT colorimetric assay. The cell viability percentage was also calculated following 24, 48, and 72 h.

Treating PANC-1 with various M. sativa extract concentrations indicated the dose-dependent cytotoxicity of the M. sativa extracts. The amount of inhibitory concentration (IC₅₀) was 68.74, 98.66, and 83.12 µg/mL for EtOH, MeOH, and water extract, after 48h, respectively (Fig. 2A, B, C). Furthermore, it was tested whether the M.sativa extract's cytotoxic impact was extended to normal cells; extract treatment on HUVEC was used for this purpose. Interestingly, cytotoxicity was only observed at higher dosages on normal cells and showed that M. sativa extracts more inhibited the PANC-1 growth. The IC₅₀ of the noncancerous HUVEC cell was up to 150 𝜇g/ml.

To investigate the IC₅₀ of GEM by MTT assay of PANC-1 cells that were treated with varying GEM concentrations (e.g., 2.5, 5, 10, 25, 50, 100, 250, 500, and 1000 µg/ml). After a 48-hour incubation, the IC₅₀ of GEM was seen at 43.53 µg concentration, and the cell viabilities were 49.954 ± 1.286, as shown in Fig. 2D.

Figure 2. Cytotoxicity Evaluation of Different Extracts and GEM at 24, 48, and 72h on PANC-1 Cells. (A) EtOH extract; (B) MeOH extract; (C) water extract of M. sativa and (D) GEM.

3.3.2 Cytotoxic effects of EtOH M. sativa extract combined with GEM on PANC-1

The cytotoxic effects of the combination EtOH M. sativa (0-150 µg/ml) and GEM (25µg/ml) were evaluated and showed enhanced cytotoxic effects on PANC-1 cells (Fig. 3). By administering various dosages of EtOH M. sativa extract to the cells, we were able to detect IC₅₀ 41.22 µg/ml M. sativa + 25 µg/ml GEM. The effect of GEM (25 µg/ml) combined with EtOH extract of M.sativa (41.22 µg/ml) further reduced cell viability in PANC-1 after 48h against the use of each alone (Fig. 3).

3.3.3 EtOH M. Satvia extract induces cell apoptosis

To determine if the reduced cell viability was partially caused by apoptotic induction, the EtOH M. sativa extract, GEM, and their combination with an IC₅₀ concentration of 68.74µg/mL, 43.53µg/ml, and 41.22 + 25 µg/mL were utilized for Annexin V/PI expression research on PANC-1. Figure 4A, B, C, and D depict the results obtained from this research on PANC-1, indicating the cell percentage undergoing apoptosis/necrosis and if viable cells are present. The untreated PANC-1 had a greater number of living cells (98.8%). The EtOH M. sativa extract-treated cells exhibited apoptosis in 15.43% and necrosis in 0.113%, and GEM-treated cells showed apoptosis in 9.75% and necrosis in 13.1%, respectively (Fig. 4C). The apoptosis of 25.6% in PANC-1 cells treated with EtOH M. sativa extract combined with GEM was observed and dramatically higher than in the GEM, and EtOH M. sativa-treated cells (Fig. 4D).

3.4 qRT-PCR analysis

To examine the role molecular EtOH M. sativa extract may play in anti-cancer effects and gain a better understanding of the partial cell death mechanism by apoptosis, the BCL-2, BAX, and CASP3 expression were examined. In particular, their expression was evaluated after 48 hours of treatment with the IC₅₀ dose of EtOH M.sativa, GEM, and EtOH M.sativa combined with GEM. Our analysis revealed that treatment with EtOH M.sativa, GEM, and EtOH M. sativa combined with GEM dramatically increased the mRNA expression of BAX in PANC-1 (2.245, 3.387, and 3.482 fold, respectively, p < 0.05, p = 0.04, p < 0.05) (Fig. 5A). In contrast, mRNA expression of BCL2 significantly decreased in response to GEM and EtOH M. sativa combined with GEM treatment (0.274 and 0.169-fold, respectively, p < 0.001) (Fig. 5B). Additionally, EtOH M. sativa combined with GEM treatment significantly increased mRNA expression of CASP3 in PANC-1 (3.17-fold, respectively, p = 0.036). Our findings indicated that the regulation of genes related to apoptosis in PANC-1 by EtOH M.sativa combined with GEM treatment was more profound than that observed with M. sativa and GEM treatments. Overall, our results provide important insights into the potential anti-cancer effects of EtOH M. sativa extract and the molecular mechanisms underlying its action.

3.5 Western Blot Analysis of M. sativa Combined with GEM on PANC-1

To clarify the molecular mechanism underlying necrosis and apoptosis induced by M. sativa (68.74µg/ml), GEM (43.53 µg/ml), and M. sativa + GEM (41.22 µg/ml and 25µg/ml), we conducted Western blotting to assess the levels of proteins related to mitochondrial apoptosis, including Bax, Caspase-3, Bcl-2, and GAPDH.

The data revealed that M. sativa + GEM increased BAX and Caspase-3 levels, confirming the apoptosis-inducing effects of M. sativa + GEM on PANC-1 cells. Also, M. sativa + GEM decreased Bcl2 protein levels (Fig. 6).

Figure 6. Western blot bands of Caspase-3 Bcl-2, and Bax expression levels in M.sativa, GEM, and M.sativa + GEM for 48h treatment in PANC-1. Each protein band was normalized to the intensity of GAPDH used.

3.6 DNA fragmentation

Apoptosis is characterized by DNA degradation into a unique fragment pattern. AGE was used to identify these fragments as a DNA ladder. Apoptosis-associated DNA fragmentation is distinguished by DNA cleavage on a regular basis, unlike necrosis-associated random fragmentation. After treating PANC-1 with the IC₅₀ of EtOH M. sativa, GEM, and EtOH M. sativa combined with GEM for 48h, the genomic DNA from cells underwent AGE. In an EtBr-stained AG, a clear DNA fragment ladder was discovered (Fig. 7, lanes 2–4). The fragmentation pattern was observed in cells treated with EtOH M. sativa, GEM, and EtOH M. sativa combined with GEM concentrations for 48h (Fig. 7). On the contrary, the fragmentation pattern was not observable in the untreated control cells.

Secondary metabolites from plants have a unique potential for discovering novel anticancer medicines with diverse structural and chemical profiles [36, 37]. Phenolics are the most abundant secondary metabolites found in plants, and they are used as antioxidants as well as in herbal medicine [38]. Some research has been done on the secondary metabolites produced by M.sativa, particularly phenolic compounds with AA, and researchers have emphasized M.sativa's potential medicinal and pharmacological properties [39, 40]. NPs are gaining popularity in cancer treatment because they have fewer side effects, are less costly, and are more easily accessible than popular medications. A lecture through a published research review by Bouyahya et al, [41] showed that phenolic compounds are great sources of naturally occurring anticancer agents, offering various therapeutic and preventive options for the treatment of numerous cancer types. These chemicals can be employed solely or in conjunction with currently available anticancer medicines. However, additional research involving human subjects and other pharmacokinetic characteristics must be carried out to guarantee the safety of the medications above before being prescribed. Furthermore, clinical studies could be used to track the development process of a standardized dosage or extract.

The antioxidant properties of phenolic compounds are widely recognized, which are important in combating oxidative stress-related chronic diseases, e.g., CVD, Alzheimer's disease, cancer, and diabetes [42, 43]. Based on our data, we observed that the water extraction method yielded the highest TPC content (4612.15 mgGAE/g) in comparison to EtOAc (3623.21mg mgGAE/g) and MeOH (2523.18 mgGAE/g) extractions. Our results indicate that the recovery of phenolic compounds is affected by the solvent type, polarity, and solubility in the extraction solvent. In Akkol et al.'s study [44], TPC was determined in the sage extracts (Salvia virgata and Salvia halophila), varying in the range 2830–21230 mg/100g of extract, depending on the utilized extraction solvent. Moreover, solvent polarity contributes to enhancing the solubility of phenolic compounds. The hydroxyl group-containing TPC in M.sativa significantly contributes to its antioxidant capacity by releasing hydrogen and producing persistent radical intermediates [45].

Therefore, it is crucial to carefully consider extraction method factors when evaluating the antioxidant activities of plant extracts. Our results on the DPPH• scavenging test are consistent with previous studies. Kudan and Anupam reported that M. sativa extracts exhibit high AA, which can be ascribed to numerous phenolic components, e.g., quercetin and kaempferol [46]. Similarly, Rana et al. demonstrated that extracts from M. sativa roots possess high AA [47]. Overall, our findings suggest that M.sativa extract is a promising source of natural antioxidants with potential benefits for health.

This research examined the impact of M.sativa treatment on PANC-1 cells at various doses and time points. Our results indicate that the reduction in PANC-1 cell viability was time-/dose-dependent, with a best IC₅₀ value of 68.74 µg/mL for the EtOH extract from M.sativa following 48 hours of treatment. Previous research has also reported that M.sativa treatment reduces cell viability in several cancer cells, including leukemia, cervix, and breast cancer, in a dose-dependent manner [48]. Notably, M.sativa exhibits low cytotoxicity against normal cells, making it a potential candidate for safe cancer therapy. To explore the cytotoxic effect mechanism of M.sativa on PANC-1 cells, we conducted microscopic, flow cytometry, and molecular evaluation. Our results revealed that M.sativa-treated PANC-1 cells exhibited rounder morphology compared to untreated cells, indicating apoptotic cell death. The morphological analysis further demonstrated that M.sativa induces apoptosis in PANC-1 cells, as demonstrated by nuclear condensation, fragmentation, and the production of apoptotic bodies. Also, flow cytometric analysis revealed a significant increase in early apoptosis (14.2%) and late apoptosis (1.23%) in cells treated with an IC₅₀ concentration of EtOAc M.sativa extract compared to untreated cells.

Our findings align with earlier research regarding the apoptotic effects of Medicago sativa. Gatouillat et al. demonstrated that the alfalfa leaf extracts' cytotoxic effects were evaluated on a number of multidrug-resistant (MDR) and sensitive tumor cell lines, including the P388 mouse leukemia cell line as well as its doxorubicin-resistant counterpart (i.e., P388/DOX). According to a study by Gatouillat et al., apoptosis induction caused by PARP cleavage and caspase-3 activation was the mechanism by which alfalfa leaf extracts inhibited cell growth. According to their research, alfalfa leaf extract may be useful for cancer treatment and chemoprevention [26]. Additionally, Samani et al. investigated the anticancer effect of twenty medicinal herbs from Chaharmahal and Bakhtiari Province in Iran on PC cell lines. The plants were extracted using 70% ethanol, and The MTT assay was used to evaluate their anti-proliferative activity on DU145, HDF, and PC-3 cell lines [49]. According to Samani et al.'s results, Achillea wilhelmsii and Euphorbia szovitsii Fisch. & C.A.Mey. demonstrated the strongest anti-proliferative activity on PC-3. Besides, M. sativa, Urtica dioica, and Euphorbia szovitsii Fisch. & C.A.Mey. had the lowest IC50 values on DU-145 and a strong anti-proliferative activity on PC cells. These plants could provide efficient sources of NPs for developing novel anti-PC drugs [49].

Apoptosis is a desirable cell death process in many cancer therapy regimens, and various genes, including BCL2, BAX, and CASP3, regulate it. In the current study, we used qRT-PCR and western blot use to explore the impact of M. sativa on the protein and mRNA expression of anti- and pro-apoptotic genes BCL2, BAX, and CASP3 in PANC1 cells. Our qRT-PCR findings suggested that BCL2 expression was high in untreated PANC-1 cells and decreased significantly in response to M.sativa treatment in a time-dependent manner. Additionally, our qRT-PCR results revealed low expression of BAX in untreated PANC-1 cells, which significantly increased in response to M.sativa treatment in a time-dependent manner. Both M.sativa and M.sativa + GEM in PANC-1 cells resulted in an activated intrinsic pathway of apoptosis through reducing anti- apoptotic protein (i.e., Bcl-2) and increasing pro-apoptotic proteins (i.e., Caspase-3 and Bax). Programmed cell death is inhibited by the anti-apoptotic gene BCL2, whereas cell death is promoted by the pro-apoptotic gene BAX. An imbalance between BCL2 and BAX expression can lead to chemoresistance, making cancer cells less susceptible to chemotherapy-induced apoptosis [50]. Thus, chemo-preventive drugs that can decrease BCL2 expression and increase BAX expression may enhance sensitivity to anticancer treatments by promoting apoptosis in cancer cells.

Recent years have seen a significant interest in using NPs to enhance the chemotherapeutic effects of GEM, particularly in the field of PC. Previous research has shown that NPs can improve GEM's therapeutic benefits in cancer treatment. Many standard chemotherapies are known to cause significant toxicity, highlighting the need for innovative combination approaches that can induce apoptosis without causing harmful side effects [51–54].

This research aimed to investigate the potential of combining GEM, a chemotherapeutic drug, with M. sativa at lower doses (25–41.22 µg/ml). We found that treating PANC-1 cells with GEM alone resulted in a time-/dose-dependent reduction of cell viability, with an IC₅₀ of 43.53 µg/ml at 48 hours of treatment. Our findings indicated that M. sativa enhances the growth inhibitory effects of Gem at sub-lethal doses, with the combination leading to a more pronounced decrease in cell viability than either compound alone. This suggests that M. sativa improves the efficacy of GEM against cancer cells, particularly at lower dosages, thus reducing damage to normal cells and improving overall survival. Combining M.sativa with conventional treatment strategies, such as GEM, has the potential to minimize adverse effects associated with these treatments.

According to scientific articles, cancer is the second most prevalent cause of mortality immediately after CVD [55, 56]. However, conventional cancer treatments have limitations due to their poor selectivity and adverse side effects. The term "cancer chemoprevention" refers to the role of external agents in suppressing cancer development; numerous plants have been identified to contribute to the chemoprevention process through various mechanisms [57]. In recent times, NPs have acquired significant attention from researchers as potential chemo-preventive agents owing to their widespread availability, low toxicity, and cost-effective production [58]. Plant-derived NPs could be used to develop innovative and improved cancer treatments that can effectively target multiple hallmarks of cancer [59]. NPs are diverse in their chemical structure and have fairly low toxicity, making them a promising option for further exploration [59].

The trend of presenting studies using plant extracts in combination with cancer therapies is increasing, Cancan Zhou et al. argued that resveratrol can enhance PC cells' GEM sensitivity by inhibiting lipid synthesis through the downregulation of SREBP1, a key lipid synthesis regulator [60].

Originating from Chinese herbs, emodin (1,3,8-trihydroxy-6-methylanthraquinone [61–63]) is an anthraquinone derivative found in the rhizomes and roots of various plants (e.g., Polygonum cuspidatum, Rheum palmatum, Cassia obtusifolia, Polygonum multiflorum, and Aloe vera) and various fungal species (e.g., Aspergillus wentii and Aspergillus ochraceus). This herb has been proven to both sensitize tumor cells to radiotherapy and chemotherapy as well as to block pathways that result in treatment resistance. In vitro, studies have shown that emodin can reverse resistance to GEM in PC cell lines by downregulating MDR-1 (P-gp), Bcl-2, and NF-κB expression, upregulating cytochrome-C, Bax, and caspase-3 and caspase-9 expression levels, and inducing cell apoptosis. Notably, emodin has shown the capability of inducing apoptosis in GEM-resistant PC cell lines [64]. In addition, in vitro/in vivo studies have suggested that emodin can downregulate NF-κB and XIAP and enhance apoptosis in mice with human PC cells [53]. A recent study also surveyed the anticancer properties of C5E, an herbal mixture extract, in PC cells (i.e., PANC-1) with or without GEM treatment. As the co-treatment with C5E and GEM, these findings suggest that the combined treatment of GEM and C5E may synergistically affect PANC-1 cells [65].

Our results demonstrate that M. sativa extracts have high total phenolic content and AA. The combination of EtOH M. sativa with GEM leads to a sharp decrease in cell viability and induction of apoptosis in PANC-1 cells. Besides, this combined treatment led to reduced BCL-2 expression and increased BAX and CASP3 expression, confirming apoptotic cell death. Importantly, M. sativa extracts were not toxic to HUVEC normal cells.

The data obtained from this study is crucial for determining the appropriate dosage for future pre-clinical studies. additional research must be conducted to investigate the impacts of combining GEM and M. Satvia extract in PC xenograft models. These results may lay the foundation for the development and production of herbal medicines and pave the way for performing clinical trials on patients with PC in the future. Additionally, future studies should investigate the efficacy of M. Satvia extract and its derivatives as a stand-alone treatment or when combined with other chemotherapy medicines for PC treatment.

Acknowledgments

The authors hereby express their sincerest gratitude to the RIGLD staff at SBUM in Tehran, Iran.

Funding

This research was funded by the RIGLD, SBUM, Tehran, Iran.

Ethical statement

This research was approved by The Board of the RIGLD, SBMU, Tehran, Iran.

Author Contributions

Vahid Chaleshi, Hamid Asadzadeh-Aghdaei: Conceptualization, Supervision, Reviewing, and Editing, designed the work plan, Project administration, Funding acquisition; Nazanin Jamshidi, Vahid Chaleshi, and Farnaz RoshanFarzad: Methodology, Examination, Authorship, Preparation of the Original Draft; Maha Chehresaz and Negar Jamshidi: Data curation, Validation, Formal analysis.

Competing Interest Statement

There is no conflict of interest disclosed by the authors.

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394–424. https://doi.org/10.3322/caac.21492
Huang J, Lok V, Ngai CH, Zhang L, Yuan J, Lao XQ et al (2021) Worldwide Burden of, Risk Factors for, and Trends in PC. Gastroenterology 160(3):744–754. https://doi.org/10.1053/j.gastro.2020.10.007
Siegel RL, Miller KD, Fuchs HE, Jemal A (2022) Cancer statistics, CA Cancer J Clin, 2022. 72(1): p. 7–33. https://doi.org/10.3322/caac.21708
Beutel AK, Halbrook CJ (2023) Barriers and opportunities for GEM in PC therapy. Am J Physiol Cell Physiol 324(2). https://doi.org/10.1152/ajpcell.00331.2022. p. C540-C552
Jie Z, Jinna Z, Jingjun Z, Pengcheng L, Fang Y, Qinyang C et al (2022) Antitumor Effects of 10058-F4 and Curcumin in Combination Therapy for PC In Vitro and In Vivo. J Healthc Eng, 2022: p. 1620802. https://doi.org/10.1155/2022/1620802
Liu Y, Liu L, Zhang Y, Qin L (2022) Adenosylmethionine enhances the inhibitory effect of GEM against PC cells via suppression of the EGFR/AKT pathways. Mol Cell Toxicol 1–10. https://doi.org/10.1007/s13273-021-00220-y
Rutz J, Maxeiner S, Juengel E, Chun FK, Tsaur I, Blaheta RA (2022) Olive Mill Wastewater Inhibits Growth and Proliferation of Cisplatin- and GEM-Resistant Bladder Cancer Cells In Vitro by Down-Regulating the Akt/mTOR-Signaling Pathway. Nutrients 14(2):369. https://doi.org/10.3390/nu14020369
Salim EI, Aboueisha SS, Khamis AA (2022) Balanitoside as a Natural Adjuvant to GEM in Lung Cancer Experimental Model. Nutr Cancer 1–15. https://doi.org/10.1080/01635581.2022.2062396
Hashem S, Ali TA, Akhtar S, Nisar S, Sageena G, Ali S et al (2022) Targeting cancer signaling pathways by NPs: Exploring promising anti-cancer agents. Biomed Pharmacother 150:113054. https://doi.org/10.1016/j.biopha.2022.113054
Cragg GM, Pezzuto JM (2016) NPs as a vital source for the discovery of cancer chemotherapeutic and chemopreventive agents. Med Principles Pract 41–59 25(Suppl. 2. https://doi.org/10.1159/000443404
Yuan H, Ma Q, Ye L, Piao G (2016) The Traditional Medicine and Modern Medicine from NPs. Molecules 21(5). https://doi.org/10.3390/molecules21050559
Dehelean CA, Marcovici I, Soica C, Mioc M, Coricovac D, Iurciuc S et al (2021) Plant-Derived Anticancer Compounds as New Perspectives in Drug Discovery and Alternative Therapy. Molecules 26(4):1109. https://doi.org/10.3390/molecules26041109
Dasari S, Njiki S, Mbemi A, Yedjou CG, Tchounwou PB (2022) Pharmacological Effects of Cisplatin Combination with NPs in Cancer Chemotherapy. Int J Mol Sci 23(3):1532. https://doi.org/10.3390/ijms23031532
Park T, Lee S (2016) Clinical Experiences of Korean Medicine Treatment against Urinary Bladder Cancer in General Practice. Evid Based Complement Alternat Med, 2016: p. 3759069. https://doi.org/10.1155/2016/3759069
Nawrot-Chorabik K, Sułkowska M, Gumulak N (2022) Secondary Metabolites Produced by Trees and Fungi: Achievements So Far and Challenges Remaining. Forests 13(8). https://doi.org/10.3390/f13081338
Yuan M, Zhang G, Bai W, Han X, Li C, Bian S (2022) The role of bioactive compounds in NPs extracted from plants in cancer treatment and their mechanisms related to anticancer effects. Oxidative Medicine Cellular Longevity, 2022. https://doi.org/10.1155/2022/1429869
Nwodo N, Ibezim JA, Simoben CV, Ntie-Kang F (2016) Exploring cancer therapeutics with NPs from African medicinal plants, part II: alkaloids, terpenoids and flavonoids. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents), 16(1): p. 108–127
Tapiero H, Tew K, Ba GN, Mathe G (2002) Polyphenols: do they play a role in the prevention of human pathologies? Biomed Pharmacother 56(4):200–207. https://doi.org/10.1016/s0753-3322(02)00178-6
Huang W-Y, Cai Y-Z, Zhang Y (2009) Natural phenolic compounds from medicinal herbs and dietary plants: potential use for cancer prevention. Nutr Cancer 62(1):1–20. https://doi.org/10.1080/01635580903191585
DerMarderosian A, Beutler JA (2002) The review of NPs: the most complete source of natural product information. Facts and Comparisons
Zrig A, Saleh A, Hamouda F, Okla MK, Al-Qahtani WH, Alwasel YA et al (2021) Impact of Sprouting under Potassium Nitrate Priming on Nitrogen Assimilation and Bioactivity of Three Medicago Species. Plants (Basel) 11(1):71. https://doi.org/10.3390/plants11010071
Gaweł E (2012) Chemical composition of lucerne leaf extract (EFL) and its applications as a phytobiotic in human nutrition. Acta Scientiarum Polonorum Technologia Aliment 11(3):303–309
Wrona O, Rafinska K, Walczak-Skierska J, Mozenski C, Buszewski B (2019) Extraction and Determination of Polar Bioactive Compounds from Alfalfa (Medicago sativa L.) Using Supercritical Techniques. Molecules 24(24):4608. https://doi.org/10.3390/molecules24244608
Chen L, Beiyuan J, Hu W, Zhang Z, Duan C, Cui Q et al (2022) Phytoremediation of potentially toxic elements (PTEs) contaminated soils using alfalfa (Medicago sativa L.): A comprehensive review. Chemosphere 293:133577. https://doi.org/10.1016/j.chemosphere.2022.133577
Tucak M, Čupić T, Horvat D, Popović S, Krizmanić G, Ravlić M (2020) Variation of phytoestrogen content and major agronomic traits in alfalfa (Medicago sativa L.) populations. Agronomy 10(1):87. https://doi.org/10.3390/agronomy10010087
Gatouillat G, Magid AA, Bertin E, Okiemy-Akeli MG, Morjani H, Lavaud C et al (2014) Cytotoxicity and apoptosis induced by alfalfa (Medicago sativa) leaf extracts in sensitive and multidrug-resistant tumor cells. Nutr Cancer 66(3):483–491. https://doi.org/10.1080/01635581.2014.884228
Stochmal A, Piacente S, Pizza C, De Riccardis F, Leitz R, Oleszek W (2001) Alfalfa (Medicago sativa L.) flavonoids. 1. Apigenin and luteolin glycosides from aerial parts. J Agric Food Chem 49(2):753–758. https://doi.org/10.1021/jf000876p
Rodrigues F, Almeida I, Sarmento B, Amaral MH, Oliveira MBP (2014) Study of the isoflavone content of different extracts of Medicago spp. as potential active ingredient. Ind Crops Prod 57:110–115. https://doi.org/10.1016/j.indcrop.2014.03.014
Singh P, Lim B (2022) Targeting Apoptosis in Cancer. Curr Oncol Rep 24(3):273–284. https://doi.org/10.1007/s11912-022-01199-y
Yang JY, Della-Fera MA, Baile CA (2006) Esculetin induces mitochondria-mediated apoptosis in 3T3-L1 adipocytes. Apoptosis 11(8):1371–1378. https://doi.org/10.1007/s10495-006-7691-5
Hsu CL, Yen GC (2007) Effects of capsaicin on induction of apoptosis and inhibition of adipogenesis in 3T3-L1 cells. J Agric Food Chem 55(5):1730–1736. https://doi.org/10.1021/jf062912b
Srivastava R, Tiwari P (2022) Medicinal Plant Used Against Cancer: A Review. Asian J Pharm Res Dev 10(4):76–85. https://doi.org/10.22270/ajprd.v10i41150
Chugh H, Sood D, Chandra I, Tomar V, Dhawan G, Chandra R (2018) Role of gold and silver nanoparticles in cancer nano-medicine. Artif Cells Nanomed Biotechnol 46(sup1):1210–1220. https://doi.org/10.1080/21691401.2018.1449118
Mishra K, Ojha H, Chaudhury NK (2012) Estimation of antiradical properties of antioxidants using DPPH assay: A critical review and results. Food Chem 130(4):1036–1043. https://doi.org/10.1016/j.foodchem.2011.07.127
Karimi E, Oskoueian E, Oskoueian A, Omidvar V, Hendra R, Nazeran H (2013) Insight into the functional and medicinal properties of Medicago sativa (Alfalfa) leaves extract. J Med Plants Res 7(7):290–297. https://doi.org/10.5897/JMPR11.1663
Cheuka PM, Mayoka G, Mutai P, Chibale K (2016) The Role of NPs in Drug Discovery and Development against Neglected Tropical Diseases. Molecules 22(1):58. https://doi.org/10.3390/molecules22010058
Gu J, Gui Y, Chen L, Yuan G, Lu H-Z, Xu X (2013) Use of NPs as chemical library for drug discovery and network pharmacology. PLoS ONE 8(4):e62839. https://doi.org/10.1371/journal.pone.0062839
Hwang SJ, Yoon WB, Lee OH, Cha SJ, Kim JD (2014) Radical-scavenging-linked antioxidant activities of extracts from black chokeberry and blueberry cultivated in Korea. Food Chem 146:71–77. https://doi.org/10.1016/j.foodchem.2013.09.035
Orak HH, KaramaĆ M, Orak A, TenİKecİEr HS, AmarowİCz R (2021) AA and Total Phenolic Contents of Different Alfalfa (Medicago sativa L.) Varieties Grown in Turkey. Yüzüncü Yıl Üniversitesi Tarım Bilimleri Dergisi. 31(4):995–1000. https://doi.org/10.29133/yyutbd.946487
Rafińska K, Pomastowski P, Wrona O, Górecki R, Buszewski B (2017) Medicago sativa as a source of secondary metabolites for agriculture and pharmaceutical industry. Phytochem Lett 20:520–539. https://doi.org/10.1016/j.phytol.2016.12.006
Bouyahya A, Omari NE, Bakrim S, Hachlafi NE, Balahbib A, Wilairatana P et al (2022) Advances in Dietary Phenolic Compounds to Improve Chemosensitivity of Anticancer Drugs. Cancers (Basel) 14(19):4573. https://doi.org/10.3390/cancers14194573
Ceylan Y, Usta K, Usta A, Maltas E, Yildiz S (2015) Evaluation of AA, phytochemicals and ESR Analysis of Lavandula Stoechas. Acta Phys Pol A 128(2):483–487. https://doi.org/
Boutemak K, Safta B, Ayachi N (2015) Study of the Anti-Inflammatory Activity of Flavonic Extract of Globularia alypum L. Acta Phys Pol A 128(2B):B–239. https://doi.org/10.12693/APHYSPOLA.128.B-239
Akkol EK, Goger F, Kosar M, Baser KH (2008) Phenolic composition and biological activities of Salvia halophila and Salvia virgata from Turkey. Food Chem 108(3):942–949. https://doi.org/10.1016/j.foodchem.2007.11.071
Alam MN, Bristi NJ, Rafiquzzaman M (2013) Review on in vivo and in vitro methods evaluation of AA. Saudi Pharm J 21(2):143–152. https://doi.org/10.1016/j.jsps.2012.05.002
Bora KS, Sharma A (2010) vitro antioxidant and free radical scavenging potential of Medicago sativa Linn. J Pharm Res 3(6):1206–1210
Rana M, Katbamna R, Padhya A, Dudhrejiya A, Jivani N, Sheth N (2010) vitro antioxidant and free radical scavenging studies of alcoholic extract of Medicago sativa L. Romanian J Biology-Plant Biology 55(1):15–22
Rosenthal GA, Nkomo P (2000) The natural abundance of L-canavanine, an active anticancer agent, in alfalfa, medicago sativa (L). Pharm Biol 38(1):1–6. https://doi.org/10.1076/1388-0209(200001)3811-BFT001
Asadi-Samani M, Rafieian-Kopaei M, Lorigooini Z, Shirzad H (2018) A screening of growth inhibitory activity of Iranian medicinal plants on prostate cancer cell lines. Biomed (Taipei) 8(2):8. https://doi.org/10.1051/bmdcn/2018080208
Delbridge AR, Grabow S, Strasser A, Vaux DL (2016) Thirty years of BCL-2: translating cell death discoveries into novel cancer therapies. Nat Rev Cancer 16(2):99–109. https://doi.org/10.1038/nrc.2015.17
Banerjee S, Zhang Y, Ali S, Bhuiyan M, Wang Z, Chiao PJ et al (2005) Molecular evidence for increased antitumor activity of GEM by genistein in vitro and in vivo using an orthotopic model of PC. Cancer Res 65(19):9064–9072. https://doi.org/10.1158/0008-5472.CAN-05-1330
Kunnumakkara AB, Guha S, Krishnan S, Diagaradjane P, Gelovani J, Aggarwal BB (2007) Curcumin potentiates antitumor activity of GEM in an orthotopic model of PC through suppression of proliferation, angiogenesis, and inhibition of nuclear factor-kappaB-regulated gene products. Cancer Res 67(8):3853–3861. https://doi.org/10.1158/0008-5472.CAN-06-4257
Wang ZH, Chen H, Guo HC, Tong HF, Liu JX, Wei WT et al (2011) Enhanced antitumor efficacy by the combination of emodin and GEM against human PC cells via downregulation of the expression of XIAP in vitro and in vivo. Int J Oncol 39(5):1123–1131. https://doi.org/10.3892/ijo.2011.1115
Wei WT, Chen H, Wang ZH, Ni ZL, Liu HB, Tong HF et al (2012) Enhanced antitumor efficacy of GEM by evodiamine on PC via regulating PI3K/Akt pathway. Int J Biol Sci 8(1):1–14. https://doi.org/10.7150/ijbs.8.1
Global Burden of Disease, Cancer C, Kocarnik JM, Compton K, Dean FE, Fu W, Gaw BL et al (2022) Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life Years for 29 Cancer Groups From 2010 to 2019: A Systematic Analysis for the Global Burden of Disease Study 2019. JAMA Oncol 8(3):420–444. https://doi.org/10.1001/jamaoncol.2021.6987
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71(3):209–249. https://doi.org/10.3322/caac.21660
George BP, Chandran R, Abrahamse H (2021) Role of Phytochemicals in Cancer Chemoprevention: Insights. Antioxid (Basel) 10(9):1455. https://doi.org/10.3390/antiox10091455
Bishayee A, Sethi G (2016) Bioactive NPs in cancer prevention and therapy: Progress and promise. in Seminars in cancer biology. Elsevier
Zou H, Li Y, Liu X, Wu Z, Li J, Ma Z (2021) Roles of plant-derived bioactive compounds and related microRNAs in cancer therapy. Phytother Res 35(3):1176–1186. https://doi.org/10.1002/ptr.6883
Zhou C, Qian W, Ma J, Cheng L, Jiang Z, Yan B et al (2019) Resveratrol enhances the chemotherapeutic response and reverses the stemness induced by GEM in PC cells via targeting SREBP 1. Cell Prolif 52(1):e12514. https://doi.org/10.1111/cpr.12514
Lu P, Zhao X, Cui T (2010) Production of emodin from Aspergillus ochraceus at preparative scale. Afr J Biotechnol, 9(4)
Tang T, Yin L, Yang J, Shan G (2007) Emodin, an anthraquinone derivative from Rheum officinale Baill, enhances cutaneous wound healing in rats. Eur J Pharmacol 567(3):177–185. https://doi.org/10.1016/j.ejphar.2007.02.033
Dong X, Fu J, Yin X, Cao S, Li X, Lin L et al (2016) Emodin: A Review of its Pharmacology, Toxicity and Pharmacokinetics. Phytother Res 30(8):1207–1218. https://doi.org/10.1002/ptr.5631
Liu DL, Bu H, Li H, Chen H, Guo HC, Wang ZH et al (2012) Emodin reverses GEM resistance in PC cells via the mitochondrial apoptosis pathway in vitro. Int J Oncol 40(4):1049–1057. https://doi.org/10.3892/ijo.2011.1285
Pak PJ, Lee DG, Sung JH, Jung SH, Han TY, Park SH et al (2021) Synergistic effect of the herbal mixture C5E on GEM treatment in PANC–1 cells. Mol Med Rep 23(5):315. https://doi.org/10.3892/mmr.2021.11954

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Medicago sativa Extracts Enhance the Anticancer Efficacy of GEM in PANC-1 Cells through Apoptosis Induction and BAX/BCL-2/CASP3 Expression Modulation

Status:

Version 1

Abstract

Introduction

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials and Methods

2.1 Chemicals and Reagents

2.2 Cell Lines and Culture Condition

2.3 Isolation of plant extract

2.4 Total Phenol Capacity Determination

2.5 Determining Antioxidant Properties

2.6 Cell Viability

2.7 Morphological alterations assay

2.8 Apoptosis Detection Flowcytometry

2.9 Gene expression assay

2.10 Western Blotting

2.11 DNA Fragmentation Assay

2.12 Statistical Analysis

3. Results

3.1 TPC in M. sativa extracts

3.2 DPPH radical-scavenging activity

3.3 In vitro anticancer activities

3.3.1 Cytotoxic effects of M. sativa extracts on PANC-1 and HUVEC cell lines

3.3.2 Cytotoxic effects of EtOH M. sativa extract combined with GEM on PANC-1

3.3.3 EtOH M. Satvia extract induces cell apoptosis

3.4 qRT-PCR analysis

3.5 Western Blot Analysis of M. sativa Combined with GEM on PANC-1

3.6 DNA fragmentation

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1