The implications of Brain-derived neurotrophic factor in the biological activities of platelet-rich plasma.

doi:10.21203/rs.3.rs-4159186/v1

Download PDF

Research Article

The implications of Brain-derived neurotrophic factor in the biological activities of platelet-rich plasma.

https://doi.org/10.21203/rs.3.rs-4159186/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Platelet-rich plasma (PRP) is a biological blood-derived therapeutic that releases several proteins in injured tissue, regulating the inflammatory process and triggering tissue anabolism. Outside of the central nervous system (CNS), these platelets represent the major source of brain-derived neurotrophic factor (BDNF). The associated anti-inflammatory, antiapoptotic, and antioxidant properties of this neurotrophin could have a potential applicability applied in the pathophysiology of osteoarthritis (OA). In osteoarthritic joints, it is suggested that synovial cells release BDNF, being found higher concentrations of this protein in the patient’s synovial fluid. Thus, considering platelets as an important therapeutic source of BDNF and the potential role of this neurotrophin in regulate joint homeostasis and OA outcomes, this study aimed to evaluate the contribution of BDNF in PRP repair activities on an experimental model of osteoarthritis (EOA) induced by monoiodine acetate (MIA) insult. Initially, the characterization of the PRP was performed, obtaining a leukocyte-poor-platelet-rich plasma (LP-PRP). After, in vitro analysis indicated that platelets activated by Ca²⁺ release BDNF, and suppression of M1 macrophage polarization induced by LP-PRP is dependent on BDNF-TrkB receptor. The behavioral and ex-vivo analyses in EOA animals showed that functional recovery in gait parameters and mitigation on tissue damage induced by LP-PRP, such as downregulation of inflammatory cytokines (TNF-α), reduction of joint pain and tissue damage (OARSI score and neuronal injury through ATF-3 [+] cells), depends on Trk-B receptor. Thus, the results indicate that BDNF and Trk-B receptor appear to be essential in the mechanisms of joint repair induced by LP-PRP with implications on joint functional recovery as well. These findings contribute to clarifying the role of BDNF in joint homeostasis, repurposing its restricted therapeutic properties in the CNS to repair functions in non-neuronal tissues that could be an option for chronic pain management in osteoarthritis (OA).

BDNF

PRP

Platelets

Osteoarthritis

Inflammation

Joint Pain

Degenerative joint diseases are currently one of the biggest causes of physical disability worldwide, where osteoarthritis (OA) stands as one of the ten most [1–3]. Chronic pain is still the primary symptom of OA, resulting from the continued tissue injury triggered by aging catabolism, insufficient repair, and lack of effective therapy [4, 5].

Therapies that aim to improve cell recruitment, acting on the maintenance of inflammatory balance and leading to a speed-up in tissue-matrix components restoration have potential applicability on healing biological microenvironments where blood supply is restricted, and tissue cell turnover is compromised, such as osteoarthritic knee joints [6–9].

In the management of OA joint degeneration and triggered chronic pain, platelet-rich plasma (PRP) therapy has been widely used. Locally activated, platelets release several growth factors and proteins that lead to angiogenesis modulation, cartilage anabolism, and inflammation switch that can mitigate joint injury. These PRP-induced activities also counteract the mechanical sensitization of joint nociceptors triggered by chronic inflammation, cartilage breakdown, and nerve injury [10, 11].

Studies have shown that platelets can have a specific secretory behavior strictly regulated by different biological agonists, pointing to the fact that different pathological environments can influence the repair actions of PRP by dictating a sustained release from a specific growth factor [12–14].

Brain-derived neurotrophic factor (BDNF) was discovered in 1982 [15] being reported as a protein present in the mammalian brain capable of inducing survival and neurite outgrowth in neurons [16]. Despite significant data that support the pivotal role of BDNF on the nervous system [16, 17], studies have shown potential repair mechanisms from this neurotrophin on the periphery [18–23] where megakaryocytes and platelets are the primary sources [24, 25].

Mammalian platelets store a significantly higher concentration of BDNF compared to brain extracts [26, 27]. At the same time, the same healing, anti-inflammatory, and antiapoptotic seen for BDNF [18, 28–30] are shared by PRP on OA pre-clinical studies [31–33]. Although a strict relationship between BDNF and PRP actions could be plausible, there is no evidence linking this neurotrophin’s role to the repair mechanisms induced by PRP. Thus, the study goal was to investigate the role of BDNF on therapeutic activities induced by PRP in an experimental model of osteoarthritis (EOA) in rats.

2.1. Animals

Male Wistar rats (200-220g) were acquired from the Central Animal Facility of the University of Campinas (CEMIB, UNICAMP) and kept in polypropylene cages in the maintenance vivarium from the Pain Studies Lab - UNICAMP at a temperature of 22 ± 2°C, with a 12-hour light/dark cycle with food and water ad libitum. All animal experiments were approved by the Animal Use Ethics Committee from the Institute of Biology at UNICAMP, protocols 4706-1 and 4834-1A. All behavioral experiments followed the guidelines recommended by the International Association for the Study of Pain – IASP for the assessment of animal behavior in research animals[34].

2.2. PRP obtainment and characterization

To obtain an appropriate amount of PRP for experiments, 18 animals served as blood donors. The samples were characterized and quantified at each centrifugation step. The plasma samples were then mixed to create a pool for in-vitro/in-vivo experiments and were subjected to hematology quantification. The terminology used to describe the samples was assessed following the MARSPILL guidelines [35].

PRP preparation was carried out following the Amable et al (2013) protocol[36] with some modifications. Initially, animals were terminally anesthetized with Ketamine (300 mg/kg; 200 µL) and Xylazine (30 mg/kg;200 µL) co-injected intraperitoneally. A thoracotomy was performed for the retrieval of 5 mL of blood from each animal through a vein puncture of the hepatic vena cava. The blood collected was sent to sterile tubes containing citric acid dextrose anticoagulant solution (Vacutainer BD^TM). After, an amount of 0.5 ml of blood samples from each donor (Whole blood) was separated and the remaining 3.5 ml aliquot was destined to sterile silicone tubes (Labor Import^TM) for centrifugation (300G; 18°C; 5 minutes). In sequence, 500 µL of the platelet-rich plasma disposed on the upper layer of the tube was collected and sent to a hematology counter (Micro ES60; Horiba^TM). After this step, the samples were subjected to a second centrifugation (700G; 18°C; 17 minutes). Then, the upper-half plasma which comprehends the poor-platelet-plasma (PPP) was collected and the remaining volume, which consists of pure-platelet-rich plasma (P-PRP), or leukocyte-poor-platelet-rich plasma (LP-PRP) was homogenized and further collected. The P-PRP/LP-PRP samples were submitted to the hematology counter being PPP used as control.

2.3. Platelet degranulation assay and measurement of BDNF release

To investigate the BDNF release by platelets, an assay was carried out with LP-PRP samples stimulated with 10% Calcium Chloride (10%; CaCl2; agonist of platelet degranulation) [37, 38]. Initially, an amount of 1 mL from both LP-PRP and PPP samples was previously obtained and filtered on a 0.22 µm filter. Then, 160 μL/well of sterile LP-PRP or PPP was pipeted on 5 wells from a 48-well cell-culture plate. In sequence, 40 μL of 10% CaCl₂ solution was added to each well, and samples were left for 60 minutes in a flow cabinet at 22 ± 2 °C room temperature. After the clott gel formation, the samples were resuspended in 450 μL of sterile PBS solution for growth factors retrieval and were left for 30 minutes in an incubator at 37°C/5%CO₂. Then, samples were collected and centrifuged (8500 rpm; 15 minutes; 4°C). The supernatant was collected for a quantitative analysis of the BDNF released in LP-PRP and PPP samples through ELISA assay, according to the manufacturer's instructions (R&D system^TM; DY248). Following the same procedures, experiments with LP-PRP and PPP samples without activation were carried out together as a control.

Another aliquot of the supernatant collected was filtered through a 0.22 μM filter and later destined for the macrophage polarization assay. In an extra-set experiment and supplementary control, the clot gel formed on the cell plate was imaged using the bright field of a fluorescence microscope (Leica, DMI 6000B, Leica Microsystems, Germany) for the detection of the fibrin network, another resulting phenome from platelet activation [39].

2.4. Cell culture of bone marrow-derived macrophages

Bone marrow-derived macrophages (BMDMs) were obtained following the protocol described by Toda et al. (2021)[40]. Initially, bone marrow hematopoietic stem cells from femur and tibia of Wistar rats were collected and plated (1x10⁴cells/well) in 24-well plates containing RPMI medium (R6504; Sigma aldrich^TM) supplemented with 10% fetal bovine serum (12103C; Sigma aldrich^TM), 1% penicillin-streptomycin (P4333; Sigma aldrich^TM), 1% non-essential amino acid solution (M7145; Sigma aldrich^TM), 1% solution of vitamins (M6895; Sigma aldrich^TM), 1% sodium pyruvate (P2256; Sigma aldrich^TM) and 20 ng/mL macrophage colony-stimulating factor (M-CSF; Z03010-5; Genscript^TM). The cell medium was changed on the 3^rd day after the initial plating and on the fifth day, the culture medium was changed and added with different treatments intended for the polarization assay.

2.4.1. Macrophage polarization and SLPPRP treatment assay

Carried out with BMDMs previously obtained, macrophage cells were polarized to the M1 profile. All drugs were dissolved in a cell culture medium according to the experimental group assigned.

First, five groups were adopted following the experimental design below: three groups, the M1 (LPS/IFN-γ), M1 plus an antagonist of Trk-B receptor (LPS/IFN-γ/ANA-12), and M1 plus vehicle (LPS/IFN-γ/Vehicle), were stimulated with 300 µL of cell culture medium containing LPS (20 ng/mL; Sigma Aldrich^TM) and IFN-γ (20 ng/mL; Invitrogen^TM) added with, respectively, ANA-12 (100 µM; Alomone Lab^TM) or its vehicle (1% DMSO; Sigma Aldrich^TM). Then, 60 minutes after stimuli, these groups were treated with 150 µL of culture medium. The other two groups, LPS/IFN-γ/ANA-12 + LPPRP and LPS/IFN-γ/SLPPRP consisted respectively of BMDM cells stimulated with 300 µL of cell culture medium containing LPS/IFN-y/ANA-12 or LPS/IFN-y only, at the same concentrations mentioned above, and 60 minutes after treated with 150 µL of the supernatant collected on platelet activation assay (SLPPRP). At 180 minutes after LPS/IFN-γ, all groups were submitted to cell lysate for RNA extraction.

As supplemental controls, the following groups were adopted: control, ANA-12, and Vehicle. These groups consisted respectively of BMDM cells cultured initially in 300 µL medium or 300 µL with medium containing ANA-12 (100 µM) or its vehicle (1% DMSO). Then, after 60 minutes, these groups received more than 150 µL of culture medium and were also sent to cell lysate and RNA extraction in 180 minutes after the first treatment.

The M1 and M2 macrophage phenotypes were assessed, respectively, through the gene expression of Nos-2 and Arg-1 by quantitative real-time PCR (RT-qPCR).

2.5. RNA extraction and quantitative real-time PCR analysis (RT-qPCR)

RNA extraction was performed using Trizol reagent and RNA extraction kit (Tri-Reagent, T9424; Sigma-Aldrich®), following the manufacturer's instructions. Complementary DNA (cDNA) synthesis was performed using the Accuris qMax kit (Accuris, Benchmark Scientific, New Jersey, USA) following the manufacturer’s instructions. The gene expression of Nos-2 and Arg-1 genes (see table 1 for primer sequences) was determined by real-time PCR performed in a StepOnePlus system (Applied Biosystems^TM, USA) using the iTaq Universal SYBR Green Supermix reagent (Bio-rad laboratories^TM, USA). β-actin was used as a housekeeping gene. The relative change in gene expression was calculated using the 2^-ΔΔCtmethod [41].

*Target Gene*	Forward sequence 5’-3’	Reverse sequence – 5’-3’
β-actin	CGCGAGTACAACCTTCTTGC	CGTCATCCATGGCGAACTGG
Arg-1	CCAGTATTCACCCCGGCTAC	GTCCTGAAAGTAGCCCTGTCT
Nos-2	TCAGGCTTGGGTCTTGTTAGC	GAAGAGAAACTTCCAGGGGCA

Table 1. Primer sequences used for RT-qPCR.

2.6. Intra-articular injection

For intra-articular drug administration, the animals were initially anesthetized with isoflurane (Isoforine, Cristália^TM; 5% for anesthesia induction and 2% for maintenance). After, the tibiofemoral joint was shaved, and asepsis was performed with 70% alcohol solution and 1% povidone-iodine solution (Riodeine; Rioquímica^TM). Subsequently, the intra-articular injection was performed by flexing the right joint at 45° followed by the introduction through the patellar tendon of a 26G needle (13x0.45mm; BD^TM) coupled to a Hamilton syringe (Hamilton Company^TM). For each injection, the total volume injected did not exceed 25 µL.

2.7. LP-PRP treatment in experimental osteoarthritis and investigation from the role of TrkB receptor

For in-vivo investigation of the role of TrkB receptor and the effects induced by LP-PRP treatment, the animals were initially submitted to the experimental osteoarthritis (EOA) induction through an injection on day 0 of monoiodine acetate (MIA group; 2 mg; Sigma Aldrich^TM) via intra-articular on the tibiofemoral joint from the right knee. The control group consisted of animals injected with NaCl 0.9% solution (Saline group). On day 7, after OA induction, animals were randomly distributed in 4 groups: the leucocyte-poor-platelet-rich plasma group (LP-PRP group) received initially saline solution and 30 minutes after LP-PRP; the ANA-12 + LP-PRP group, which consisted of animals initially treated with ANA-12 (TrkB receptor antagonist; 100 µM; Alomone Labs^TM) and 30 minutes after received LP-PRP; The ANA-12 and ANA-12 Vehicle groups, designed as controls and which consisted of animals respectively treated with a single injection of ANA-12 (100 µM; Alomone Labs^TM) or its vehicle (1% DMSO; Sigma Aldrich^TM). This treatment approach was also performed on day 14 after OA induction. The same LP-PRP pool was used for injection in LP-PRP and ANA-12 + LP-PRP groups in all experiments conducted. Behavioral tests were performed on days 0, 3, 7, 14, and 21 post-MIA injections. An adapted electronic von Frey apparatus was used to assess the joint flexion mechanical threshold and the Catwalk System (NoldusTM) evaluated the dynamic motor function of animals on a walking track test. On day 21, animals were euthanized and harvested for the knee joint and L4/L5 dorsal root ganglia (DRG).

Assessment of mechanical threshold for joint flexion – adapted von Frey

The mechanical threshold for knee joint flexion was performed following the methodology of Guerrero et al. (2006) [42] with some modifications. Initially, the animals were placed in acrylic cages (23x20x18cm) 60 minutes before the tests for acclimatization in a quiet room. The cages were attached to a wire grid floor arranged on a suspended platform where at the bottom there is a mirror that allows the proper visualization of the animals during the test. The equipment used was an electronic von Frey (digital analgesimeter; Insight®, Brazil) that consists of a force transducer where at the end a 4.15 mm² polypropylene tip is fixed and connected to a device that reads the force applied to the animal paw, converting it to grams. A stimulus is applied to the metatarsal footpad, perpendicularly and in ascending motion until the induction of tibiofemoral joint flexion followed by paw withdrawal. The force required to induce the joint flexion followed by the paw withdrawal reflex is recorded in grams and assumed to be the mechanical threshold to induce such joint flexion. For all experiments, baseline, and post-treatment measurements were performed. The assessment was during the 0 (baseline), 3-, 7-, 14-, and 21-days post-MIA injection. The result represents the arithmetic mean of the 6 measurements performed at each time analyzed.

2.8. Assessment of joint dynamic motor function – Catwalk walk-track test

The assessment of motor function in treated animals was performed using the CatWalk walking track test (Noldus Inc., Wageningen, Netherlands). The equipment consists of an automated system comprehended by a hall coupled with an illuminated walkway glass floor that allows the spontaneous movement of the animal. The green LED plus a red-illuminated background creates a contrast in the glass floor that can be recorded by a high-speed video camera (Gevicam GP-3360; GEViCAM Inc., Milpitas, CA, USA) equipped with a wide-angle lens (6.0 mm; DF6HA-1B, Fujinon Corp., China). The camera is set at 56cm underneath the walkway. As animals cross a calibrated 20 x 10 cm length lane, paw prints are automatically recorded by the CatWalkTM XT 10.6 software, and the measurement of static and dynamic parameters associated with the animal's gait can be assessed. The gait analysis was performed at 0, 7, 14, and 21 days, after OA induction, always in the afternoon with the room lights switched off. During each period of analysis, each rat performed three runs following the parameters shown in Table 2.

Green Intensity

0.35 (a.u)

Max. allowed speed variation.

60 %

Min & Max crossing time

0.5–8.0 sec

Red Ceiling Light

17.8 (a.u)

Green walkaway light

16.5 (a.u)

Camera gain

25.01 (a.u)

Table 2. Catwalk XT configurations; a.u = arbitrary units.

2.9. Euthanasia and tissue harvest

At the end of experiments on day 21, the animals were terminally anesthetized with Ketamine (300 mg/kg; 200 µL) and Xylazine (30 mg/kg;200 µL), co-injected intraperitoneally and perfused through the ascending aorta with saline followed by a cold 4% paraformaldehyde (PFA) solution containing 0.1 M phosphate buffer. After the perfusion, the right knee joint and L4/L5 DRGs were collected.

2.9.1. Histopathological analysis of the tibiofemoral joint

The collected knee joints were left in a 4% PFA solution for 24 hours. After, they were transferred to another container with a decalcifying acid solution (4.5% HCl, EDTA, and Sodium Tartrate). This solution was replaced once per week. On the 14^th day, the joints were immersed in paraffin. The joint tissue was sectioned in 5 μm and stained with Hematoxylin/Eosin. For the assessment of quantitative scores in each group analyzed, the histopathological analysis was performed using an optical microscope (Nikon^TM; E800 model) and following the guidelines of the Osteoarthritis Research Society (OARSI) [43].

2.9.2. Assessment of neuronal injury by quantifying Transcriptional Activating Factor-3 (ATF-3) staining in dorsal root ganglia neurons

The harvested DRGs were left for 48 hours in a cryoprotectant solution containing 30% sucrose. Then, each DRG was embedded in an OCT compound (Tissuetech, Sakura Finetek, Torrance, CA, USA). Non-serial sections from L4 and L5 DRGs were made at 15 µm and optimum temperature using a cryostat. At least 8 sections were mounted on each slide, being stored at −20 °C until further fluorescence staining.

For the immunofluorescence detection of ATF-3 in DRG neurons, slides were incubated for 30 minutes in phosphate buffer saline (PBS) containing 0.1 M glycine and subsequently blocked with 2% of bovine serum albumin (BSA) and triton X-100 0.1% for 1 hour. After washing with 0.1 M PBS, the slides were incubated overnight with anti-ATF-3 (1:200, polyclonal rabbit; sc-188, Santa Cruz®) and anti-fox3-protein (NeuN; neuronal marker; 1:1000; mouse monoclonal; Ab104224; Abcam^TM) primary antibodies in a PBS solution containing 0.1% triton X-100 and 2% BSA. Then, the slides were washed once with the same solution used for the primary antibody and then washed 3 times for 5 minutes with 0.1 M PBS. In sequence, the sections were incubated with Alexa 594 secondary antibody (donkey; anti-rabbit;1:1000; Life Technologies^TM) and Alexa 488 (donkey; anti-mouse; 1:1000; Life Technologies^TM) for 90 minutes and after were washed 4 times for 5 min in 0.1 M PBS. Then, the slides were incubated for 10 minutes with DAPI for cell nuclei staining (0.25 μg/mL; Sigma Aldrich^TM). Negative controls were mounted and consisted of slides incubated only with secondary antibodies to confirm nonspecific binding. The slides were photographed on a confocal microscope (Zeiss^TM; LSM-780 NLO model) at 20x magnification.

For the assessment of ATF-3 expression on DRG neurons, three animals per group were adopted and one slide for each animal was analyzed. In the end, an average of 1000 cells and 24 sections per group were analyzed. In each section, the relative percentage expression of ATF-3 on each field analyzed was initially calculated by the formula: the number of neurons labeled with ATF-3 divided by the number of neurons per field x 100. Then, to obtain the normalized arithmetic mean of ATF-3 expression in each section counted, the percentages from each field were summed and further divided by the total number of fields analyzed. The final average obtained corresponds to the data included for the statistical analysis and graphical representation.

2.10. Statistical analysis

The analysis of the results was performed using GraphPad Prism v.8 software (GraphPad^TM, San Diego, USA). The t-student test was selected when two means were compared. When the comparison involved more than two means, a one-way or two-way analysis of variance (ANOVA) was performed according to the experimental design followed. When the level of significance indicated a statistical difference between the analyzed means, the Tukey test was used to compare the different analyzed groups. The level of significance adopted in the analysis of the results was p<0.05.

3.1. Characterization of platelet-rich plasma samples

Two sequential centrifugations of the whole blood collected were performed to isolate the PRP followed by cell quantification in the hematology analyzer. The results show the characterization from PRP samples of three donors that were sampled for statistical analysis and representation.

As seen in Supplementary Figures 1D, E, and F, the number of white blood cells (monocytes, lymphocytes, and granulocytes) present in PRP samples was significantly reduced after the 1^st and 2^ndcentrifugation compared to the whole blood fraction. As expected, platelets gradually increased at each centrifugation step, being the final solution significantly filled with high levels of platelets, with the absence of red blood cells, and lower levels of white blood cells. Particularly, despite not detectable values for monocytes and lymphocytes, a residual number of granulocytes were seen in the sample collected from donor 3, after the 2^nd step of centrifugation (Supplementary Figure 1F). Therefore, the correct designation for the final enriched plasma solution obtained was Leukocyte-poor platelet-rich plasma (LP-PRP), as a significant reduction in Leucocytes (more than 2.5x related to whole blood baseline) was observed in our PRP samples.

The pool of LP-PRP samples generated presented significantly higher levels of platelets (1429 ± 364 platelets/mm³) in comparison with PPP control (38.55 ± 7.27 platelets/mm³) (Supplementary Figure 1B). This range in platelets/mm³ values, both for PPP and LP-PRP pools, was similar in the other pools that were obtained from the other blood donors (data not shown).

Supplementary figure 1. Characterization of platelet-rich plasma samples obtained. Platelet concentration gradually increased at each centrifugation step being the final solution significantly filled with high levels of platelets, absence of red blood cells, and lower levels of white blood cells (A, C, D, and F). The pool obtained from LP-PRP samples (B) presented significantly higher levels of platelets in comparison with the control, PPP pool. Symbols * and **** indicate respectively, P<0.05 and P<0.0001 between highlighted groups. In (B) Welch T-Test; (A-F) One-way ANOVA, Tukey post-hoc test.

3.2. Activated platelets release BDNF

The stimulation with calcium chloride led to platelet degranulation, clearly evidenced by the formation of fibrin nets between platelets in LP-PRP samples activated (Figure 1A). In these samples, the amount of BDNF released was almost twice as seen for activated PPP (LP-PRP: 65.07 ± 11.83 pg/mL; PPP: 36.96 ± 2.98 pg/mL). Furthermore, the amount of BDNF released by activated LP-PRP was at least 8 times higher in comparison with non-activated controls (LP-PRP: 7.52 ± 1.44 pg/mL; PPP: 7.78 ± 0.88 pg/mL; Figure 1B).

Figure 1. Activated platelets release BDNF. Platelets from LP-PRP samples form fibrin nets after being exposed to 10% CaCl₂, indicating an activated state (A). BDNF amounts in the supernatant collected from activated LP-PRP samples were significantly higher in comparison to activated PPP and non-activated controls (PPP and LP-PRP). Results are shown as Mean ± Standard Deviation. Symbols * and ** indicate respectively, P<0.05 and P<0.01, for comparison between highlighted groups. One-way ANOVA, Tukey post-hoc test.

3.3. The effects of LP-PRP in M1 polarization induced are mediated by Trk-B receptor.

BMDM cells stimulated with LPS/IFN-γ exhibited robust M1 phenotype, confirmed by significant mRNA Nos-2 expression related to control (Figure 2A). This M1 phenotype was significantly decreased when the SLPPRP was applied in the culture medium, downregulating Nos-2 mRNA levels, being equivalent to non-stimulated cells (Figure 2A). Interestingly, it was observed that the pre-treatment with ANA-12, a Trk-B antagonist, blocked the effect of SLPPRP on Nos-2 mRNA expression (Figure 2A). This suggests that the Trk-B receptor can be involved in this suppression of M1 polarization induced by SLPPRP. However, although Nos-2 was effectively modulated by SLPPRP, the levels of Arg-1 mRNA expression remained unaltered (Figure 2C). Likewise, the mRNA levels related to M1 and M2 phenotypes in the complementary controls adopted in this assay were similar to non-stimulated cells (Figure 2B and D; ANA-12 and Vehicle groups).

Figure 2. LP-PRP effects on M1-like phenotype induced by LPS/IFN-γ are mediated by the Trk-B receptor. BMDM cells stimulated with LPS/IFN-γ exhibited marked Nos-2 mRNA expression in comparison with non-stimulated cells (A; control group). This marked Nos-2 expression is significantly reduced in BMDM cells that were initially primed with LPS/IFN-γ 2 hours in advance and then treated with SLPPRP (A; LPS/IFN-γ/SLPPRP vs LPS/IFN-γ group). The effects of SLPPRP at M1-like phenotype induced by LPS/IFN-γ are significantly reversed by Trk-B receptor antagonist, ANA-12 (A, LPS/IFN-γ/ANA-12+SLPPRP vs LPS/IFN-γ/SLPPRP group), suggesting Trk-B dependent mechanism for LPPRP suppression of M1-phenotype driven by LPS/IFN-γ stimulation. Although effective modulation was seen for Nos-2 with SLPPRP treatment, the levels of Arg-1 mRNA expression remained unaltered (Figure 2C). The mRNA levels related to M1 and M2 phenotypes in the complementary controls adopted were like non-stimulated cells (Figure 2B and D; ANA-12 and Vehicle groups). Results are shown as Mean ± Standard Deviation. Symbols * and ** indicate respectively, P<0.05 and P<0.01 for comparison between highlighted groups. One-way ANOVA, Tukey post-hoc test.

3.4. Trk-B receptor mediates the effects of LP-PRP on the joint injury induced in the MIA model.

Typical OA-like injuries were detected in knee joints of rats previously injected with MIA. In these animals, along with cartilage breakdown, the subchondral bone was exposed in focal areas followed by a reactive marrow (Figure 3B). All these findings were absent in the saline group that presented healthy and intact morphology of the joint (Figure 3A). The injection of LP-PRP could mitigate the OA-like features induced by MIA, once the joints that were submitted through this therapeutic protocol showed an intact articular cartilage with the absence of fissures (Figure 3C), and although fibrillogenesis and marrow reactivity were detected, these features were less extent in comparison with MIA group. Interestingly, the debilitated state observed in MIA-injected joints was similarly replicated on animals that received Trk-B antagonist followed by LPPRP injection (Figure 3D), indicating that Trk-B could be mediating the joint injury mitigation events promoted by LP-PRP in the MIA model. The histopathological features seen in animals that were previously injected with MIA and treated with ANA-12 alone or its vehicle were similar to those presented by the MIA group (Figures 3B, E, and F). Finally, the OARSI score analysis supported the qualitative data presented by all groups, where the LP-PRP treatment could lower the histopathological score induced by MIA, being the ANA-12 + LP-PRP, ANA-12, and ANA-12 vehicle groups not statistically different animals that were only injected with MIA (Figure 3G).

Figure 3. Trk-B receptor mediates the effects of LP-PRP on the joint injury induced in the MIA model. Typical OA-like injuries were detected in knee joints of rats previously injected with MIA in comparison with control (A, B). The injection of LPPRP mitigates the OA-like features induced by MIA (C), where the debilitated state observed in MIA-injected joints was similarly replicated on animals that received Trk-B antagonist followed by LPPRP injection (D). The histopathological features seen in animals that were previously injected with MIA and treated with ANA-12 alone or its vehicle were like those presented by the MIA group as well (E, F). The OARSI score analysis (G) shows quantitative data from all groups, highlighting the decreased histopathological score presented by the LP-PRP group, and as in the MIA group, similar values were observed for ANA-12 + LP-PRP, ANA-12, and ANA-12 vehicle groups. Results are shown as Mean ± Standard Deviation. Symbols ** and *** indicate respectively, P<0.01 and P<0.001 for comparison between highlighted groups. One-way ANOVA, Tukey post-hoc test. Images at 2x magnification and scale bar at 50µm.

3.5. OA-Like injuries in MIA-injected joints are followed by neuronal injury in DRGs and mitigated by LP-PRP

The OA-like injuries in knee joints of rats previously injected with MIA were followed by a substantial increase in ATF-3 staining in DRG neurons (Figures 4A, B, and G). The LP-PRP therapeutic protocol was able to counteract this neuronal injury promoted by MIA, while the Trk-B antagonism paired with LP-PRP injection led to a similar outcome as observed in DRGs from MIA animals (Figures 4B, C, D, and G). No statistical difference was observed in the percentage of ATF-3-labeled neurons in animals previously injected with MIA and treated with ANA-12 or its vehicle alone in comparison with MIA control, indicating similar patterns of neuronal injury between these groups (Figures 4B, E, F, and G).

Taken together, the data provided in this subset of results complement the joint-histopathology findings and show an interplay between degenerative events occurring at the articular space and the predicted sensorial damage at the DRG, where therapies such as PRP that modulate these tissue-damage events will eventually interfere with the sensory outcome as well, especially neuronal injury.

Figure 4.MIA-induced neuronal injury is mitigated by LP-PRP with potential implications of the Trk-B receptor. Rats' knee joints previously injected with MIA (2 mg; 25 μL; intra-articular) were followed by a substantial increase in ATF-3 staining in DRG neurons in comparison with saline controls (A, B, and G) at day 21. The LP-PRP therapeutic protocol decreased this neuronal injury promoted by MIA, while the Trk-B antagonism (ANA-12; 100 µM; 25 µL; intra-articular) paired with LP-PRP injection led to a similar outcome as observed in DRGs from MIA animals (B, C, D, and G). No statistical difference is seen in the percentage of ATF-3-labeled neurons in animals previously injected with MIA and treated with ANA-12 (100 µM; 25 µL; intra-articular) or its vehicle alone 1% DMSO solution; 25 µl; intra-articular) in comparison with MIA control, showing similar patterns of neuronal injury between these groups (B, E, F, and G). Results are shown as Mean ± Standard Deviation. Results are shown as Mean ± Standard Deviation. Symbol **** indicates p<0.0001 for comparison between highlighted groups. Symbol NS indicates a non-significant comparison between the groups highlighted. One-way ANOVA, Tukey post-test. Images at 20x magnification and scale bar at 50µm.

3.6. Mitigation promoted by LP-PRP on TNF-α concentration in MIA-OA joints involves the participation of the Trk-B receptor.

Blocking the Trk-B receptor led to an increase of TNF-α release in joint homogenate from OA animals, as seen in ANA-12 + LP-PRP and in ANA-12 groups (Figure 5A). The LP-PRP protocol reduces TNF-α (Figure 5B), and a slight reduction was noticed for IL-1β titers, although non-significant when compared to the ANA-12 and ANA-12 + LP-PRP groups (Figure 5C and D). This result suggests an endogenous role of the Trk-B receptor by modulating TNF-α concentrations in MIA-induced osteoarthritic joints. Once this same event was replicated in the presence of LP-PRP, it is reasonable to consider that one of the mechanisms by which LP-PRP promotes TNF-α decrease on MIA-OA joints involves the participation of the Trk-B receptor.

Figure 5. LP-PRP decreases in the TNF-α concentrations in MIA-OA joints require the participation of the Trk-B receptor. (A) and (B) The blockade of the Trk-B receptor led to an increase in TNF-α concentrations in the joint homogenate from animals previously injected with MIA (2 mg; 25 μL; intra-articular). The amount of TNF-α cytokine in ANA-12 and ANA-12 + LP-PRP groups was significantly different from the other groups analyzed, especially MIA and LP-PRP. (C) and (D) No statistical difference was observed between groups regarding IL-1β concentrations in the samples analyzed. Results are shown as Mean ± Standard Deviation. Symbols *, **, and *** indicate respectively, P<0.05, P<0.01, and P<0.001 for comparison between highlighted groups. One-way ANOVA; Tukey post-hoc test.

3.7. The effects of LP-PRP on joint hyperalgesia induced by MIA require Trk-B receptor participation.

MIA injection into knee joints of rats promoted long-lasting joint mechanical hyperalgesia, as seen by the decrease of joint flexion mechanical thresholds starting at day 3 and persisting until day 21 post-MIA injection (Figure 6A). The LP-PRP treatment could significantly reduce the MIA-joint hyperalgesia at days 7 and 14 after MIA injection (Figure 6A). The analyzed area under the curve (AUC) of the LP-PRP group showed a significant increase in comparison with the MIA group. This suggests differences in time-displacement recovery regarding mechanical thresholds between these two groups (Figure 6B), implying a gain in recovery from joint-flexion mechanical thresholds produced by LP-PRP injection.

The effects of LP-PRP treatment at the hyperalgesic joints were reversed in animals where Trk-B receptor was blocked, such as seen in ANA-12 + LP-PRP group (Figure 6C). This result suggests that the Trk-B receptor is involved in the functional outcome promoted by LP-PRP in MIA-OA joints, especially for the joint flexion mechanical threshold recovery (Figure 6C and D). In addition, the Trk-B antagonism in animals previously injected with MIA, to investigate an endogenous Trk-B role in joint pain triggered by MIA, did not show differences in joint flexion mechanical thresholds comparing with OA controls just injected with MIA. However, as observed in (Figure 6C and D) the ANA-12 group displayed significant different joint flexion thresholds in comparison with LP-PRP treated animals.

Figure 6. The effects of LP-PRP on joint hyperalgesia induced by MIA require Trk-B receptor participation. (A) The injection of MIA into rats’ joints led to a long-lasting joint mechanical hyperalgesia evident throughout the significant decrease in the mechanical joint flexion thresholds 3 days after MIA intra-articular delivery (2 mg; 25 μL, at day 0). The LP-PRP protocol (25 μL; intra-articular) significantly mitigated the MIA-joint hyperalgesia at days 7 and 14 after MIA injection. (B) The analyzed area under the curve (AUC) between MIA and LP-PRP shows significant differences, suggesting a time-displacement recovery difference regarding mechanical thresholds between these two groups. (C) In animals where the Trk-B receptor blockade was paired with LP-PRP protocol (ANA-12; 100 μM; 25 μL; days 7 and 14 after MIA; ANA-12+ LP-PRP group), the effects of LP-PRP at the hyperalgesic joints were reversed and animals presented a slight significant decrease in the mechanical thresholds in comparison with the vehicle controls. These events seen for the Trk-B blockade on the LP-PRP protocol were replicated when we performed Trk-B antagonism in animals previously injected with MIA. (D) The AUC analysis showed that the Trk-B receptor blockade reversed the gain in time-displacement recovery induced by the LP-PRP protocol, as the AUC presented by the ANA-12 + LP-PRP group was significantly lower in comparison with the LP-PRP group. Results are shown as Mean ± Standard Deviation. Symbols *, **, *** and **** indicate respectively, P<0.05, P<0.01, P<0.001 and P<0.0001 for comparison between highlighted groups. (A) and (C) Two-way ANOVA; (B) and (D) One-way ANOVA; Tukey post-hoc test.

3.8. The improvement on gait dysfunction induced by LP-PRP on MIA-OA model requires Trk-B receptor participation.

The injection of MIA into the knee joints led to a prominent debilitation state reflected by a significant gait dysfunction three days after the insult and lasting at least until day 21 post-MIA injection (Figures A, E, and I). The LP-PRP treatment could mitigate significantly the alterations triggered by MIA in the spatiotemporal parameters Max contact area (Figure 7A), Print area (Figure 7E), and Print width (Figure 7I). Additionally, compared to the MIA group in all these previously mentioned parameters, the LP-PRP displayed a significantly differences in AUC analysis (respectively in Figures 7C, G, and K). Notably, these same gait improvements (Figures B, F, and J) and AUC (Figures 7D, H, and L) were also observed in the LP-PRP group in comparison to the ANA vehicle, ANA-12, and ANA+LP-PRP group.

These results suggest a role of the Trk-B receptor in biological activities exerted by LP-PRP in the joint compartment implied in gait performance, as changes in gait, especially related to spatiotemporal parameters, were followed by changes in AUC which infers differences in temporal pattern from time curves [44, 45]. In this sense, the results suggest that these changes in gait parameters might reflect time-dependent gain in joint function triggered by LP-PRP injection.

No significant changes in gait parameters were observed in animals injected with MIA and post-treated with ANA-12 or its vehicle in comparison with the MIA-OA control group (injected only with MIA; MIA group), or with ANA-12+LP-PRP group (Figure 7B-D; F-H; J-L).

Figure 7. The effects of LP-PRP on gait dysfunction induced by MIA require Trk-B receptor participation. (A), (E) and (I) MIA delivery (2 mg, 25 μL) on the knee joints from naive rats led to a prominent debilitation state reflecting significant gait dysfunction three days after the insult and lasting at least until day 21 after MIA intra-articular injection. The LP-PRP protocol (25 μL; intra-articular; days 7 and 14) could significantly mitigate the alterations led by MIA in the spatiotemporal parameters Max contact area, Print area, and Print width. (C) This gait improvement was also followed by a time-displacement recovery as shown by the significant differences between AUC present by LP-PRP in comparison with the MIA group. (D), (H) and (L) The paired intra-articular delivery from the Trk-B antagonist (ANA-12; 100 μM; 25 μL; days 7 and 14) with the LP-PRP protocol promoted a significant reversal both at gait and AUC altered by LP-PRP. No significant changes in gait parameters were observed in animals injected with MIA and post-treated intra-articularly with ANA-12 (ANA-12; 100 μM; 25 μL; days 7 and 14) or its vehicle (1%DMSO; 25 μL; days 7 and 14) in comparison with the OA control group (MIA group), or with ANA-12+LP-PRP group. Results are shown as Mean ± Standard Deviation. Symbols *, **, *** and **** indicate respectively, P<0.05, P<0.01, P<0.001 and P<0.0001 for comparison between highlighted groups. (A) and (C) Two-way ANOVA; (B) and (D) One-way ANOVA; Tukey post-hoc test.

To our knowledge, this is the first work that aimed to analyze the implications of the BDNF and the Tropomyosin Kinease B (Trk-B) receptor in the effects of PRP therapy in OA animals. Previous works reporting the presence of BDNF in other sites rather than neuronal tissue and implicated in functional activities of platelets have been reported by Chacón-Fernández et al.[24], Fujimura et al. [46], and Le Blanc et al. [47].

Evolutionarily, the platelet system was conceived in mammals to control hemostasis, ensure the mitigation of vascular damage, and avoid bleeding and tissue injury [48]. Such property allowed an effective regulation of the blood leakage associated with injuries of diverse nature, triggered from the most primitive animal experience to more particular contexts such as maintenance of placental and embryo development [48, 49].

In such reparative and physiological role, products such as ATP and calcium ions act as main agonists in platelet degranulation [12, 50].We observed that using 10% of CaCl₂ could stimulate platelet degranulation and BDNF release. Similar results were obtained by Le Blanc et al. (2020), that suggest a plasmatic predominance in BDNF concentrations coming from activated platelets through a series of agonists such as ADP, collagen, calcium and arachidonic acid.

Previous findings suggest that BDNF is stored in cytosol and at α-granules in platelets [24, 47]. These α-granules are structures that are present platelets plasmatic membrane and oscillations in intracellular calcium stores stimulate their exocytosis and content release [12]. Although it seems reasonable that, as previously mentioned, different sets of molecules implicated in tissue injury signaling can trigger BDNF release in platelets, the studies regarding mechanisms involved on the docking and release of this neurotrophin in platelets will be of quite interest to elucidate if classical exocytosis protein complexes that led to granule release in platelets, such as interactions between VAMP-8 and SNARE proteins, are also involved in BDNF release from platelet granules [12, 51].

Perhaps one of the most crucial cellular interactions for tissue repair where platelets play a pivotal role is the crosstalk with macrophages [52–54]. Macrophages are versatile cells and have an essential role in maintaining joint tissue homeostasis [55–57]. Beyond signaling molecules capable of initiating and drive a local inflammatory process such as IL-8, CCL2, and epinephrine, platelets may release other molecules that act on macrophage polarization and thus interfere with the dynamic plasticity of these cells, triggering the M1 (IL-1β, TNF- α) or M2 phenotype (TGF-β, Fibrinogen) of macrophages present at the injured site [52, 58, 59].

In OA, the importance of macrophage polarization takes place as a tool to improve tissue healing in compartments with poor vascularization, such as diarthrodial joints [56] . In releasing growth factors such as TGF-β or IGF-1, or anti-inflammatory cytokines and peptides such as IL-10, IL-4, and TIMPs, macrophages contribute for the shifting to an anabolic state in OA joints, that ultimately leads to a mitigation in tissue injury associated with catabolism and oxidative stress, especially in chondrocytes [60]. Importantly, the macrophage polarization triggered by platelet-rich plasma is one of the main therapeutic properties of PRP and further relief of OA long-term pain [58, 61, 62].

Among several growth factors present in the platelet compartment, BDNF is certainly stored at high concentrations. Of note, studies had shown that platelets compared with brain homogenates, have about 100 to 1,000 times fold of BDNF [24–26] . Thus, three relevant evidences were equal important in this work to propose a modulation effect of macrophage polarization induced by PRP depending on a BDNF-Trk-B receptor interaction: the significant bioavailability of BDNF in platelets allied to the immunomodulatory potential from this neurotrophin [63–65] and the Trk-B receptor expression in macrophages [66, 67].

In our hands, BMDM cells that were exposed to LPS/IFN-γ exhibited classical M1-like phenotype, confirmed by the significant increase in Nos-2 mRNA in comparison with controls (unstimulated BMDM cells). Given that in our platelet degranulation assays we showed significant amounts of BDNF release by activated platelets, we decided to incorporate the supernatant collected from activated samples of LP-PRP (SLPPRP) in our polarization assays to investigate the outcomes of BDNF in M1-macrophage inflammatory phenotype induced by LPS/IFN-γ. Notably, our results suggest that when cells previously triggered for M1-like phenotype were treated with SLPPRP for 2 hours, a decrease in Nos-2 mRNA expression was seen. Moreover, these effects of SLPPRP on M1 phenotype were significantly reversed in the presence of ANA-12, indicating a role of Trk-B receptor in the suppression of M1-phenotype induced by SLPPRP.

Although it seems reasonable that the effects of SLPPRP would be preventive in our assays due the short time window between the cell stimuli and treatments, evidence shows that 1 hour after the LPS there is already a substantial increase in iNOS expression and message in macrophage cells that lasts at least for 24 hours [68]. In this sense, it seems reasonable that SLPPRP would be acting in these M1-like cells to reprogram or counteract an inflammatory state, which Trk-B receptor seems to be involved.

Despite significant modulation was seen by SLPPRP in M1-phenotype, at least after a 2-hour incubation period, no changes in Arg-1 expression were detected, indicating no changes for an M2-like phenotype could be triggered by SLPPRP. Indeed, the in-vitro time-coursefor M2-phenotype triggered by Arg-1 modulation induced by PRP and its therapeutic derivatives such as LP-PRP and PRGF seems to occur in a timely manner, with significant levels of Arg-1 mRNA being seen between 6 and 24h after incubation [69–71]. In this sense, the failure of SLPPRP in induced an M2-like phenotype in our experiments could be attributed to the earlier cells harvesting in the third hour after LPS/IFN-γ stimuli, which would reflect undetectable changes in Arg-1 message in comparison with our unstimulated control cells.

The interaction between BDNF and Trk-B receptor in neurons led to the activation of signaling cascades mainly ruled by PI3K, MAPK, PLCγ, and GTPases enzymes that ultimately lead to cell growth & dendrite branching, cell survival and synaptic plasticity [72, 73]. Of interest, BDNF signaling through PI3K leads to further phosphorylation of AKT kinase inhibiting the intrinsic and extrinsic pathways and further neuronal apoptosis. It is also suggested that blockade of Trk-B receptor by selective antagonists such as ANA-12 increases expression of the p38 protein, IL-6, TNF-α, IL-1β, and iNOS, indicating that BDNF has an anti-inflammatory role depending on TrkB activation [74].

In this sense, the interactions between BDNF and AKT signaling could be implicated in macrophage polarization. It is known that the isoforms AKT₁ and AKT₂ directly regulate macrophage polarization-modulating iNOS expression [75, 76]. The absence of AKT₁ in macrophages promotes hyperresponsiveness to LPS and increased iNOS gene expression, exacerbating M1 inflammatory response mediated by increase in IL-1β, TNF-α, and IL-6 cytokines while the opposite is observed in the absence of AKT₂, that leads to an exacerbation of anti-inflammatory response by upregulating Arg-1[76].

After sets of in-vitro experiments suggesting the LP-PRP role in macrophage polarization associated with the TrK-B activation, we investigated the implications of the Trk-B receptor in the repair activities induced by LP-PRP in OA animals. This receptor is expressed in synoviocytes, chondrocytes, osteoclasts, and osteoblasts [22, 77–80]. In addition, although not directly linked with OA pathogenesis, BDNF might have potential therapeutic activities through the anti-inflammatory, anti-apoptotic, and antioxidant actions and modulation of autophagy in the affected OA tissue damage, that leads to the joint healing process [73, 81].

The OA model triggered by MIA insult comprehends a chronic-degenerative pathology that led to tissue injury and release of pro-inflammatory molecules into the synovial fluid, such as ADP, Ca²⁺, collagen peptides, and aggrecan [82–84]. Thus, once these molecules are major agonists of platelet degranulation, the local intra-articular injection of LP-PRP preparations without prior activation was conducted to ensure more bioavailability of BDNF in the knee joint compartment.

As in humans, MIA-OA animals display similar pathological changes seen resulting from oxidative stress in joint cells, which leads to ongoing tissue catabolism, inflammation, cartilage breakdown, nerve injury, and chronic pain [82, 83].

These OA-like alterations triggered by MIA are divided into two phases: during the acute phase (inflammatory phase), previous studies shown an increase in inflammatory cytokines such as IL-1β, TNF-α, IL-6, IL-8, and chemokines such as CCL-2 are observed [82, 85–90]. Additionally, an enhancement on cell recruitment occurs in the knee joint, resulting on an increasing number of inflammatory cells such as macrophages, dendritic cells, neutrophils, and mast cells [75, 90–93]. Particularly, a shifting to M1 profile is noticed in macrophages, driven by the massive released of tissue degradation products and cytokines (as previously mentioned) that ultimately contribute to boost the late phase of MIA-OA model looping the pro-inflammatory context through their released pro-inflammatory products and stablishing an ongoing tissue injury that sets the degenerative process [82, 87, 90, 94]. At the late phase (chronic phase), a decrease in the expression of enzymes linked with cell survival against oxidative damage, such as SOD-2 and Catalase, and increased expression of matrix metalloproteinases (MMP), such as MMP3 and 9 are observed [82, 86, 95, 96]. As this catabolic state goes by, the cell-death tied to a hyperactivity of MMPs lead to cartilage breakdown and further sensitization of sensory fibers due to nerve injury of primary afferent terminals in subchondral bone. In addition, this sensitization of joint nociceptors is also driven by inflammatory products that could be present on synovial fluid such as IL-1β, TNF-α, IL-6 and NGF [55, 82, 90].

In our studies, an interesting decrease in knee joint injury followed by functional recovery of both joint-flexion mechanical thresholds and gait was observed after LP-PRP treatment. These mitigation on OA-like injuries triggered by MIA are dependent on Trk-B receptor, since the effects of LP-PRP, both at behavioral and wound-healing outcomes (joint and nerve injury) were significantly reversed in the presence of the selective Trk-B antagonist ANA-12.

Despite limited studies investigating the mechanisms behind the healing properties of PRP in OA models, studies conducted Chiou et al. [32], Woodell-May et al. [97] and Aniss et al. [98] support the use of PRP as a therapeutic intervention to promote joint repair in OA. These works indicated an essential role of the PRP for in-vitro cellular differentiation of chondrocytes via regulation of cyclins B1, D1, and E2, decrease in apoptotic signaling induced by caspase-3 and p53 expression, and alleviates ROS-induced oxidative damage triggered by IL-1β treatment in chondrocyte cells. Of note, chondrocyte differentiation is a key activity to boost tissue matrix peptides synthesis and further mitigate joint catabolism triggered in OA. Interestingly, PI3K and AKT signaling that are activated by BDNF-Trk-B interaction, play an important role in chondrocyte terminal differentiation in murine embryos [99]. In this sense, studies showing a relationship between BDNF and chondrogenic signaling with impact in OA pathology will be of interest. Particularly, an interaction of BDNF and Runx-2, a transcriptional factor known to regulate chondrogenesis and mitigate OA cartilage injury downregulating matrix metalloproteinases as MMP-13 and Adamts-5, is described in a non-OA animal model [100].

In-vivo studies demonstrated that the PRP treatment decreases the expression of MMPs 1, 3, and 13 [32, 97, 98]. Of interest, some of these repair activities mentioned for PRP, are seen also for BDNF as well, such as the decrease in ROS-induced oxidative damage towards modulation of the SOD-2 enzyme [101–103] and modulation of the apoptosis proteins as caspase-3 [104, 105]. Complementary, some studies have shown that BDNF can activate FOXO₃ protein signaling [106], which integrates the FOXO proteins complex that is involved in cell defense against oxidative stress and modulation of autophagy genes such as Sesn3 and Bnip3 that prevent chondrocyte apoptosis and cartilage aging[107].

In summary, it seems reasonable to conclude that the interaction between BDNF-TrkB arising after LP-PRP injection and further platelet degranulation, has as one of main therapeutic axis the attenuation of oxidative stress triggered in MIA-OA model [82, 95, 96]. Complementary, the anti-inflammatory profile of PRP and also seen for BDNF, such as a decrease in inflammatory IL-1β/TNF-α and enhance of the anti-inflammatory IL-10/IL-4 cytokine axis [63, 65]could be contributing to a suppression on macrophage-M1 profile, and thus, a decrease in further ongoing-tissue injury, as our therapeutic protocol with LP-PRP was started at day 7 after MIA insult, which comprehends the transitioning period between the acute phase and chronic phase of MIA-OA model [82, 87].

In this sense, this downward on tissue inflammatory and catabolic state clearly provided by LP-PRP and BDNF-TrkB interaction reflects the findings in our tissue pathology assays (joint and DRG) and corroborates with our behavior results: MIA-OA outcomes are attenuated in the presence of LP-PRP, where its therapeutic activities are reversed in the presence of Trk-B antagonist. The importance of these BDNF-TrkB biological activities for joint repair are highlighted at the functional (gait and pain behavior) outcomes obtained in presence and absence of the antagonist, with some worsening seen particularly on joint pain and inflammation, as the increase in pain phenotype in groups where TrkB receptor blockade was made by intra-articular injection.

Joint nociceptive neurons typically evoke action potentials in response to a range of stimulus that would breakthrough the tissue physiological working range[108–110]. Thus, when a static or dynamic pressure stimulus exceeds the joint baseline resistancesuch asintense pressure, sharp rotation or twisting, the result is an avoidance of harmful motion, withdrawal of and preservation of the affected limb.

Interestingly, although some murine models shown an overlap between antalgic gait and pain behavior such as seen in diabetic neuropathy [111], a study have shown no reversal of antalgic gait parameters in presence of analgesics, especially in CFA and spared nerve injury pain models [112] . Particularly for MIA-OA models, there is still no concise data, where some studies report none to mild changes in gait after MIA [113] and some seen markable joint dysfunction regarding spatiotemporal parameters at the acute and late phase of the model [85, 114–116]. In these mentioned studies, it is a common understanding that joint dysfunction triggered by MIA is followed by changes in print-area, print length and print width parameters[85, 114–116].

In our experiments, the LP-PRP therapeutic protocol was able to increase the max contact area as well as print-length, and print-width gait parameters at day 14 and 21st after MIA injection. These improvements in gait were also followed in joint mechanical thresholds and reversed in the presence of Trk-B antagonist ANA-12. Interestingly, rats in the ANA-12 and ANA-12+LP-PRP groups displayed significantly decreased joint-flexion mechanical thresholds in comparison with both OA controls treated with antagonist vehicle (ANA-12 vehicle group). However, despite this worsening in joint-flexion mechanical thresholds, this event was not replicated in the gait parameters analyzed between these 3 groups.

It is important to note that although there is some significant degree of interdependence between antalgic gait and mechanical thresholds linked with joint injury (as joint flexion thresholds or secondary tactile allodynia), these parameters might not follow strictly covariance over time [85, 113, 115].

In this sense, joint nociceptive afferents have prominent response to noxious flexion or twisting stimuli [108–110, 117]. Although it seems plausible that the nerve injury tied to the persistent inflammatory phenotype driven by increased TNF-α in ANA-12 and ANA-12 + LP-PRP groups would imply an increase in gait behavior related to joint noxious dysfunction, the animal ability in promote adjustment in joint motion would bias our conclusions showing no changes related to spatiotemporal parameters, at least at the endpoint measurements. Or the antalgic gait seen in MIA-OA model could be related to a significant impairment in joint mechanobiology properties, that limit joint movement and further proper animal ambulation. This impairment would be more depreciated in the model early phase due to an inflammatory input linked with swelling and joint sensitization. Such gait alterations would been resolving as the inflammatory burst decreases and acquire a latent characteristic, and the pain phenotype could be implicated with the ectopic activity of primary afferents which the background relies on nerve injury triggered in the model, where nociception and pain behavior would be achieved through induction of joint flexion [117, 118].

In addition, this nerve injury seen mechanistically by increasing on ATF-3 expression in dorsal root ganglia neurons implicated in joint nociceptive response can be associated with a persistent plasticity of these cells triggered by massive release of inflammatory peptides in the early phase of MIA or due to a mechanical injury of peripheral terminals present at joint capsule and subchondral bone [119, 120]. Of note, chemical (inflammatory cytokines and peptides, algogens) or mechanical (chronic constriction, axotomy) injury are primarily mechanisms involved in ATF-3 increase on the DRG [121–123].

Concluding, the improvements in joint performance by LP-PRP could be attributed to a shift in inflammation profile driven by this therapeutic after injection. This alternate in inflammatory and degenerative profile would be likely associated with a downregulation activity in macrophage M1-profile, mitigation in tissue catabolism and preservation in joint integrity that ultimately led to a decrease in inflammation and nerve injury of nociceptive afferents. These biological activities seem to involve an interaction between BDNF and Trk-B receptors with implications in functional aspects as well, once both changes in histopathological, molecular, and pain phenotype evoked by LP-PRP were reversed in presence of Trk-B antagonist.

Although the searching for an effective drug in OA remission and chronic pain remains a challenge, our results support the use of PRP as a therapy for pain control and wound healing. Through behavioural and molecular experiments, the data presented in this work provide clarity on the discussion about the role of growth factors, particularly BDNF, in joint homeostasis.

The clinical relevance of neurotrophins in non-neuronal tissues, particularly for joint homeostasis, come with data from pre-clinical studies that had shown expression of TrkA (NGF) and TrkB (BDNF) receptors in synovium, bone, and cartilage tissue [78, 102, 124]. Notably, genomic alterations that lead to a dysfunction in these receptors have as an outcome dwarfism, insensitivity to pain and arthritic phenotype [78, 125, 126]. These disease conditions are commonly attributed to the anabolism and sensory perception properties, particularly from BDNF and NGF, in maintain bone and joint development as well as regulate joint proprioception and pain signalling [125, 127].

There is an increase interest in pharmacological approaches capable of regulate neurotrophins activity in osteoarthritic joints, particularly, NGF [127, 128]. However, although anti-NGF therapies appear to be effective in mitigate joint pain in OA models, no improvements in cartilage damage score were evidenced in a range of studies [128]. In this sense, our approach with LP-PRP gives some advantages once we notice mitigation of joint injury and pain behavior with the therapeutic protocol adopted in the study. The behavioral and tissue damage outcomes obtained with Trk-B blockade paired or not with LP-PRP injections highlights the importance of BDNF-TrkB interaction to regulate inflammation and joint repair, where increase bioavailability can de achieve with LP-PRP therapy to provide better disease outcomes.

Despite platelets also stored in their granules Pro-BDNF protein, it is well understood that platelet activation by a series of agonists such ADP, collagen, calcium, and arachidonic acid, are followed only by the release of BDNF [47]. However, the residual amount of Pro-BDNF in plasma that does not originate from activated platelets can be one of the reasons why we detected limited improvements in tissue pathology and further joint function.

As the main goal of this study was to investigate the functional outcome of platelet BDNF in an osteoarthritis model, we directed our assays to analyze the contributions of this neurotrophin in biological activities of PRP in a pre-clinical OA murine model that mimics both inflammatory and degenerative state of the disease. Hence, we can assume that TrkB receptor is involved in joint repair activities induced in PRP therapy and suggest a role in endogenous control of joint homeostasis given the results obtained in our endpoint measurements. However, more studies with broad follow-ups (further than 21 days) and tissue-specific knockdowns are needed to unravel the role of BDNF-TrkB interaction in joint homeostasis, with great interests on those capable of trigger repair mechanisms in osteoarthritis disease.

Ethics approval and consent to participate.

The experiment was approved by the Ethics Committee on the Use of Animals (CEUA) for protocols 4706-1 and 4834-1A on November 9^th, 2017. All experiments were conducted and performed according to the guidelines of the Brazilian National Council for Animal Experimentation Control (CONCEA).

AVAILABILITY OF DATA AND MATERIALS

The datasets generated during the current study are available from the corresponding authors upon reasonable request.

COMPETING INTERESTS

The authors declare no competing interests.

FUNDING

The present study was supported by grants awarded from the following Brazilian Research Institutes: Higher Education Personnel Improvement Coordination – (CAPES - Financing Code 001) and the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP - process 2018/10205-2) for scholarships and financial support essential to the development of the study.

AUTHORS' CONTRIBUTIONS

KFM: conceptualization, methodology, validation, formal analysis, investigation, writing-original draft, writing - review & editing, visualization, and funding acquisition; DMS, CCF: writing-original draft, writing - review & editing; JBP, ALLO, MOP, NSC, CMN, CRRS: methodology; investigation; formal analysis; writing - review & editing; SRC, CRS, CHT: resources, writing - original draft, writing - review & editing; CAP: conceptualization, resources, writing - original draft, writing - review & editing manuscript, project administration, and funding acquisition.

ACKNOWLEDGMENTS

The authors gratefully acknowledge the Laboratories of Nerve Regeneration, of Histology at the Institute of Biology (IB; UNICAMP), the Laboratory for the Development of Biotechnological Processes at the School of Chemical Engineering (FEQ; UNCAMP), and the National Institute of Science and Technology on Photonics Applied to Cell Biology (INFABIC) for technical support.

NOTE

This work was derived from the doctoral thesis of Kaue Franco Malange.

Suri, Pradeep, David C. Morgenroth, and David J. Hunter. 2012. Epidemiology of Osteoarthritis and Associated Comorbidities. PM and R 4. Elsevier Inc.: S10–S19. https://doi.org/10.1016/j.pmrj.2012.01.007.
Wallace, Ian J., Steven Worthington, David T. Felson, Robert D. Jurmain, Kimberly T. Wren, Heli Maijanen, Robert J. Woods, and Daniel E. Lieberman. 2017. Knee osteoarthritis has doubled in prevalence since the mid-20th century. Proceedings of the National Academy of Sciences 114: 201703856. https://doi.org/10.1073/pnas.1703856114.
Hunter, David J., and Sita Bierma-Zeinstra. 2019. Osteoarthritis. The Lancet 393: 1745–1759. https://doi.org/10.1016/S0140-6736(19)30417-9.
Martel-Pelletier, Johanne, Andrew J. Barr, Flavia M. Cicuttini, Philip G. Conaghan, Cyrus Cooper, Mary B. Goldring, Steven R. Goldring, Graeme Jones, Andrew J. Teichtahl, and Jean Pierre Pelletier. 2016. Osteoarthritis. Nature Reviews Disease Primers 2. https://doi.org/10.1038/nrdp.2016.72.
Thakur, Matthew, Anthony H. Dickenson, and Ralf Baron. 2014. Osteoarthritis pain: Nociceptive or neuropathic? Nature Reviews Rheumatology 10. Nature Publishing Group: 374–380. https://doi.org/10.1038/nrrheum.2014.47.
Krajewska-Włodarczyk, Magdalena, Agnieszka Owczarczyk-Saczonek, Waldemar Placek, Adam Osowski, and Joanna Wojtkiewicz. 2018. Articular Cartilage Aging-Potential Regenerative Capacities of Cell Manipulation and Stem Cell Therapy. International Journal of Molecular Sciences 19: 623. https://doi.org/10.3390/ijms19020623.
Duan, Ran, Hui Xie, and Zheng-Zhao Liu. 2020. The Role of Autophagy in Osteoarthritis. Frontiers in Cell and Developmental Biology 8: 1–9. https://doi.org/10.3389/fcell.2020.608388.
Armiento, Angela R., Mauro Alini, and Martin J. Stoddart. 2019. Articular fibrocartilage - Why does hyaline cartilage fail to repair? Advanced Drug Delivery Reviews 146. The Authors: 289–305. https://doi.org/10.1016/j.addr.2018.12.015.
Eming, Sabine A., Thomas A. Wynn, and Paul Martin. 2017. Inflammation and metabolism in tissue repair and regeneration. Science 356: 1026–1030. https://doi.org/10.1126/science.aam7928.
Andia, Isabel, Eva Rubio-Azpeitia, and Nicola Maffulli. 2015. Platelet-rich Plasma Modulates the Secretion of Inflammatory/Angiogenic Proteins by Inflamed Tenocytes. Clinical Orthopaedics and Related Research 473: 1624–1634. https://doi.org/10.1007/s11999-015-4179-z.
Andia, Isabel, and Nicola Maffulli. 2013. Platelet-rich plasma for managing pain and inflammation in osteoarthritis. Nature Reviews Rheumatology 9. Nature Publishing Group: 721–730. https://doi.org/10.1038/nrrheum.2013.141.
Heijnen, H., and P. van der Sluijs. 2015. Platelet secretory behaviour: as diverse as the granules … or not? Journal of Thrombosis and Haemostasis 13: 2141–2151. https://doi.org/10.1111/jth.13147.
Jonnalagadda, Deepa, Leighton T. Izu, and Sidney W. Whiteheart. 2012. Platelet secretion is kinetically heterogeneous in an agonist-responsive manner. Blood 120: 5209–5216. https://doi.org/10.1182/blood-2012-07-445080.
Kim, Joong Il, Hyun Cheol Bae, Hee Jung Park, Myung Chul Lee, and Hyuk Soo Han. 2020. Effect of Storage Conditions and Activation on Growth Factor Concentration in Platelet-Rich Plasma. Journal of Orthopaedic Research 38. John Wiley & Sons, Ltd: 777–784. https://doi.org/10.1002/jor.24520.
Barde, Y. A., D. Edgar, and H. Thoenen. 1982. Purification of a new neurotrophic factor from mammalian brain. The EMBO journal 1: 549–553. https://doi.org/10.1002/j.1460-2075.1982.tb01207.x.
Bathina, Siresha, and Undurti N. Das. 2015. Brain-derived neurotrophic factor and its clinical implications. Archives of Medical Science 6: 1164–1178. https://doi.org/10.5114/aoms.2015.56342.
Lima Giacobbo, Bruno, Janine Doorduin, Hans C. Klein, Rudi A. J. O. Dierckx, Elke Bromberg, and Erik F. J. de Vries. 2019. Brain-Derived Neurotrophic Factor in Brain Disorders: Focus on Neuroinflammation. Molecular Neurobiology 56. Molecular Neurobiology: 3295–3312. https://doi.org/10.1007/s12035-018-1283-6.
Kilian, Olaf, Sonja Hartmann, Nicole Dongowski, Srikanth Karnati, Eveline Baumgart-Vogt, Frauke V. Härtel, Thomas Noll, Reinhard Schnettler, and Katrin Susanne Lips. 2014. BDNF and its TrkB receptor in human fracture healing. Annals of Anatomy - Anatomischer Anzeiger 196. Elsevier GmbH.: 286–295. https://doi.org/10.1016/j.aanat.2014.06.001.
Sariola, H. 2001. The neurotrophic factors in non-neuronal tissues. CMLS, Cell. Mol. Life Sci. Vol. 58.
Hong, Jun Hee, Hyoung Min Park, Kyung Hee Byun, Bong Hee Lee, Woong Chol Kang, and Goo Bo Jeong. 2014. BDNF expression of macrophages and angiogenesis after myocardial infarction. International Journal of Cardiology 176. Elsevier Ireland Ltd: 1405–1408. https://doi.org/10.1016/j.ijcard.2014.08.019.
Simão, Adriano Prado, Vanessa Amaral Mendonça, Tássio Málber De Oliveira Almeida, Sérgio Antunes Santos, Wellington Fabiano Gomes, Candido Celso Coimbra, and Ana Cristina Rodrigues Lacerda. 2014. Involvement of BDNF in knee osteoarthritis: The relationship with inflammation and clinical parameters. Rheumatology International 34: 1153–1157. https://doi.org/10.1007/s00296-013-2943-5.
Hutchison, Michele R. 2012. BDNF Alters ERK/p38 MAPK Activity Ratios to Promote Differentiation in Growth Plate Chondrocytes. Molecular Endocrinology 26: 1406–1416. https://doi.org/10.1210/me.2012-1063.
Papathanassoglou, Elizabeth D.E., Panagiota Miltiadous, and Maria N. Karanikola. 2015. May BDNF Be Implicated in the Exercise-Mediated Regulation of Inflammation? Critical Review and Synthesis of Evidence. Biological Research for Nursing 17: 521–539. https://doi.org/10.1177/1099800414555411.
Chacón-Fernández, Pedro, Katharina Säuberli, Maria Colzani, Thomas Moreau, Cedric Ghevaert, and Yves Alain Barde. 2016. Brain-derived neurotrophic factor in megakaryocytes. Journal of Biological Chemistry 291: 9872–9881. https://doi.org/10.1074/jbc.M116.720029.
Yamamoto, Hirotaka, and ME Gurney. 1990. Human platelets contain brain-derived neurotrophic factor. The Journal of Neuroscience 10: 3469–3478. https://doi.org/10.1523/JNEUROSCI.10-11-03469.1990.
Burnouf, Thierry, Ya-Po Kuo, David Blum, Sylvie Burnouf, and Chen-Yao Su. 2012. Human platelet concentrates: a source of solvent/detergent-treated highly enriched brain-derived neurotrophic factor. Transfusion 52: 1721–1728. https://doi.org/10.1111/j.1537-2995.2011.03494.x.
Chacón-Fernández, Pedro, Katharina Säuberli, Maria Colzani, Thomas Moreau, Cedric Ghevaert, and Yves Alain Barde. 2016. Brain-derived neurotrophic factor in megakaryocytes. Journal of Biological Chemistry 291: 9872–9881. https://doi.org/10.1074/jbc.M116.720029.
Kermani, Pouneh, and Barbara Hempstead. 2007. Brain-Derived Neurotrophic Factor: A Newly Described Mediator of Angiogenesis. Trends in Cardiovascular Medicine 17: 140–143. https://doi.org/10.1016/j.tcm.2007.03.002.
Chen, Shang-Der, Chia-Lin Wu, Wei-Chao Hwang, and Ding-I Yang. 2017. More Insight into BDNF against Neurodegeneration: Anti-Apoptosis, Anti-Oxidation, and Suppression of Autophagy. International Journal of Molecular Sciences 18: 545. https://doi.org/10.3390/ijms18030545.
Ji, Xin Chao, Yuan Yuan Dang, Hong Yan Gao, Zhao Tao Wang, Mou Gao, Yi Yang, Hong Tian Zhang, and Ru Xiang Xu. 2015. Local Injection of Lenti–BDNF at the Lesion Site Promotes M2 Macrophage Polarization and Inhibits Inflammatory Response After Spinal Cord Injury in Mice. Cellular and Molecular Neurobiology 35. Springer US: 881–890. https://doi.org/10.1007/s10571-015-0182-x.
Zhu, Y., M. Yuan, H.Y. Meng, A.Y. Wang, Q.Y. Guo, Y. Wang, and J. Peng. 2013. Basic science and clinical application of platelet-rich plasma for cartilage defects and osteoarthritis: a review. Osteoarthritis and Cartilage 21. Elsevier Ltd: 1627–1637. https://doi.org/10.1016/j.joca.2013.07.017.
Chiou, Chi-Sheng, Chi-Ming Wu, Navneet Kumar Dubey, Wen-Cheng Lo, Feng-Chou Tsai, Tran Dang Xuan Tung, Wei-Ching Hung, Wei-Che Hsu, Wei-Hong Chen, and Win-Ping Deng. 2018. Mechanistic insight into hyaluronic acid and platelet-rich plasma-mediated anti-inflammatory and anti-apoptotic activities in osteoarthritic mice. Aging 10: 4152–4165. https://doi.org/10.18632/aging.101713.
Andia, Isabel, and Nicola Maffulli. 2013. Platelet-rich plasma for managing pain and inflammation in osteoarthritis. Nature Reviews Rheumatology 9. Nature Publishing Group: 721–730. https://doi.org/10.1038/nrrheum.2013.141.
Zimmermann, Manfred. 1983. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 16: 109–110. https://doi.org/10.1016/0304-3959(83)90201-4.
Lana, Jose Fabio Santos Duarte, Joseph Purita, Christian Paulus, Stephany Cares Huber, Bruno Lima Rodrigues, Ana Amélia Rodrigues, Maria Helena Santana, et al. 2017. Contributions for classification of platelet rich plasma – proposal of a new classification: MARSPILL. Regenerative Medicine 12: 565–574. https://doi.org/10.2217/rme-2017-0042.
Amable, Paola Romina, Rosana Bizon Vieira Carias, Marcus Vinicius Telles Teixeira, Ítalo da Cruz Pacheco, Ronaldo José Farias Corrêa do Amaral, José Mauro Granjeiro, and Radovan Borojevic. 2013. Platelet-rich plasma preparation for regenerative medicine: Optimization and quantification of cytokines and growth factors. Stem Cell Research and Therapy 4: 1–13. https://doi.org/10.1186/scrt218.
Varga-Szabo, D., A. Braun, and Bernhard Nieswandt. 2009. Calcium signaling in platelets. Journal of Thrombosis and Haemostasis 7: 1057–1066. https://doi.org/10.1111/j.1538-7836.2009.03455.x.
Journal of Thrombosis and Haemostasis 13: 2141–2151. https://doi.org/10.1111/jth.13147.
Perez, Amanda G. M., Ana A. Rodrigues, Angela C. M. Luzo, José F. S. D. Lana, William D. Belangero, and Maria H. A. Santana. 2014. Fibrin network architectures in pure platelet-rich plasma as characterized by fiber radius and correlated with clotting time. Journal of Materials Science: Materials in Medicine 25: 1967–1977. https://doi.org/10.1007/s10856-014-5235-z.
Toda, Gotaro, Toshimasa Yamauchi, Takashi Kadowaki, and Kohjiro Ueki. 2021. Preparation and culture of bone marrow-derived macrophages from mice for functional analysis. STAR Protocols 2. Elsevier Inc.: 100246. https://doi.org/10.1016/j.xpro.2020.100246.
Schmittgen, Thomas D., and Kenneth J. Livak. 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3: 1101–1108. https://doi.org/10.1038/nprot.2008.73.
Guerrero, Ana T.G., Waldiceu A. Verri, Thiago M. Cunha, Tarcilia A. Silva, Francisco A.C. Rocha, Sérgio H. Ferreira, Fernando Q. Cunha, and Carlos A. Parada. 2006. Hypernociception elicited by tibio-tarsal joint flexion in mice: A novel experimental arthritis model for pharmacological screening. Pharmacology Biochemistry and Behavior 84: 244–251. https://doi.org/10.1016/j.pbb.2006.05.008.
Pritzker, Kenneth P.H., S. Gay, S. A. Jimenez, K. Ostergaard, J. P. Pelletier, K. Revell, D. Salter, and W. B. van den Berg. 2006. Osteoarthritis cartilage histopathology: Grading and staging. Osteoarthritis and Cartilage 14: 13–29. https://doi.org/10.1016/j.joca.2005.07.014.
Pham, B, A Cranney, M Boers, A C Verhoeven, G Wells, and P Tugwell. 1999. Validity of area-under-the-curve analysis to summarize effect in rheumatoid arthritis clinical trials. The Journal of rheumatology 26: 712–6.
Kahan, Barry D., Maria Welsh, and Lynne P. Rutzky. 1995. Challenges in Cyclosporine Therapy: The Role of Therapeutic Monitoring by Area Under the Curve Monitoring. Therapeutic Drug Monitoring 17: 621–624. https://doi.org/10.1097/00007691-199512000-00013.
Fujimura, Hironobu, C. Anthony Altar, Ruoyan Chen, Takashi Nakamura, Takeshi Nakahashi, Jun-ichi Ichi Kambayashi, Bing Sun, and Narendra N. Tandon. 2002. Brain-derived neurotrophic factor is stored in human platelets and released by agonist stimulation. Thrombosis and Haemostasis 87: 728–734. https://doi.org/10.1055/s-0037-1613072.
Le Blanc, Jessica, Samuel Fleury, Imane Boukhatem, Jean Christophe Bélanger, Mélanie Welman, and Marie Lordkipanidzé. 2020. Platelets Selectively Regulate the Release of BDNF, But Not That of Its Precursor Protein, proBDNF. Frontiers in Immunology 11: 1–12. https://doi.org/10.3389/fimmu.2020.575607.
Martin, John F., and Günter P. Wagner. 2019. The origin of platelets enabled the evolution of eutherian placentation. Biology Letters 15: 20190374. https://doi.org/10.1098/rsbl.2019.0374.
Griffith, Oliver W., Arun R. Chavan, Stella Protopapas, Jamie Maziarz, Roberto Romero, and Gunter P. Wagner. 2017. Embryo implantation evolved from an ancestral inflammatory attachment reaction. Proceedings of the National Academy of Sciences 114: E6566–E6575. https://doi.org/10.1073/pnas.1701129114.
Plattner, Helmut, and Alexei Verkhratsky. 2016. Inseparable tandem: evolution chooses ATP and Ca 2 + to control life, death and cellular signalling. Philosophical Transactions of the Royal Society B: Biological Sciences 371: 20150419. https://doi.org/10.1098/rstb.2015.0419.
Ren, Qiansheng, Holly Kalani Barber, Garland L. Crawford, Zubair A. Karim, Chunxia Zhao, Wangsun Choi, Cheng-Chun Wang, Wanjin Hong, and Sidney W. Whiteheart. 2007. Endobrevin/VAMP-8 Is the Primary v-SNARE for the Platelet Release Reaction. Edited by Sean Munro. Molecular Biology of the Cell 18: 24–33. https://doi.org/10.1091/mbc.e06-09-0785.
Escobar, Gisselle, Alejandro Escobar, Gabriel Ascui, Fabián I Tempio, María C Ortiz, Claudio A Pérez, and Mercedes N López. 2018. Pure platelet-rich plasma and supernatant of calcium-activated P-PRP induce different phenotypes of human macrophages. Regenerative Medicine 13: 427–441. https://doi.org/10.2217/rme-2017-0122.
Kral, Julia Barbara, Waltraud Cornelia Schrottmaier, Manuel Salzmann, and Alice Assinger. 2016. Platelet Interaction with Innate Immune Cells. Transfusion Medicine and Hemotherapy 43: 78–88. https://doi.org/10.1159/000444807.
Lam, Fong W., K. Vinod Vijayan, and Rolando E. Rumbaut. 2015. Platelets and Their Interactions with Other Immune Cells. In Comprehensive Physiology, 5:1265–1280. Wiley. https://doi.org/10.1002/cphy.c140074.
Malange, Kaue Franco, Juliana M. Navia-Pelaez, Elayne Vieira Dias, Julia Borges Paes Lemes, Soo-Ho Choi, Gilson Goncalves Dos Santos, Tony L. Yaksh, and Maripat Corr. 2022. Macrophages and glial cells: Innate immune drivers of inflammatory arthritic pain perception from peripheral joints to the central nervous system. Frontiers in Pain Research 3. https://doi.org/10.3389/fpain.2022.1018800.
Sun, Yulong, Zhuo Zuo, and Yuanyuan Kuang. 2020. An Emerging Target in the Battle against Osteoarthritis: Macrophage Polarization. International Journal of Molecular Sciences 21: 8513. https://doi.org/10.3390/ijms21228513.
Geraghty, Terese, Deborah R. Winter, Richard J. Miller, Rachel E. Miller, and Anne-Marie Malfait. 2021. Neuroimmune interactions and osteoarthritis pain: focus on macrophages. PAIN Reports 6. Ovid Technologies (Wolters Kluwer Health): e892. https://doi.org/10.1097/pr9.0000000000000892.
Andia, Isabel, and Nicola Maffulli. 2013. Platelet-rich plasma for managing pain and inflammation in osteoarthritis. Nature Reviews Rheumatology 9. Nature Publishing Group: 721–730. https://doi.org/10.1038/nrrheum.2013.141.
Chen, Yufei, Haoxuan Zhong, Yikai Zhao, Xinping Luo, and Wen Gao. 2020. Role of platelet biomarkers in inflammatory response. Biomarker Research 8. Biomarker Research: 28. https://doi.org/10.1186/s40364-020-00207-2.
Yuan, Zimu, Decheng Jiang, Mengzhu Yang, Jie Tao, Xin Hu, Xiao Yang, and Yi Zeng. 2024. Emerging Roles of Macrophage Polarization in Osteoarthritis: Mechanisms and Therapeutic Strategies. Orthopaedic Surgery 16: 532–550. https://doi.org/10.1111/os.13993.
Wang, Weiyun, Yaru Chu, Pengyuan Zhang, Zhuo Liang, Zhenlin Fan, Xueqiang Guo, Guangdong Zhou, and Wenjie Ren. 2023. Targeting macrophage polarization as a promising therapeutic strategy for the treatment of osteoarthritis. International Immunopharmacology 116: 109790. https://doi.org/10.1016/j.intimp.2023.109790.
Lana, José Fábio, Stephany Cares Huber, Joseph Purita, Claudia H. Tambeli, Gabriel Silva Santos, Christian Paulus, and Joyce M. Annichino-Bizzacchi. 2019. Leukocyte-rich PRP versus leukocyte-poor PRP - The role of monocyte/macrophage function in the healing cascade. Journal of Clinical Orthopaedics and Trauma 10: S7–S12. https://doi.org/10.1016/j.jcot.2019.05.008.
Calabrese, Francesca, Andrea C. Rossetti, Giorgio Racagni, Peter Gass, Marco A. Riva, and Raffaella Molteni. 2014. Brain-derived neurotrophic factor: a bridge between inflammation and neuroplasticity. Frontiers in Cellular Neuroscience 8: 1–7. https://doi.org/10.3389/fncel.2014.00430.
Liang, Jiedong, Gui Deng, and He Huang. 2018. The activation of BDNF reduced inflammation in a spinal cord injury model by TrkB/p38 MAPK signaling. Experimental and Therapeutic Medicine: 1688–1696. https://doi.org/10.3892/etm.2018.7109.
Xu, Danfeng, Di Lian, Jing Wu, Ying Liu, Mingjie Zhu, Jiaming Sun, Dake He, and Ling Li. 2017. Brain-derived neurotrophic factor reduces inflammation and hippocampal apoptosis in experimental Streptococcus pneumoniae meningitis. Journal of Neuroinflammation 14. Journal of Neuroinflammation: 156. https://doi.org/10.1186/s12974-017-0930-6.
Asami, Toshio, Takuya Ito, Hidefumi Fukumitsu, Hiroshi Nomoto, Yoshiko Furukawa, and Shoei Furukawa. 2006. Autocrine activation of cultured macrophages by brain-derived neurotrophic factor. Biochemical and Biophysical Research Communications 344: 941–947. https://doi.org/10.1016/j.bbrc.2006.03.228.
Barouch, Rina, Elena Appel, Gila Kazimirsky, and Chaya Brodie. 2001. Macrophages express neurotrophins and neurotrophin receptors. Journal of Neuroimmunology 112: 72–77. https://doi.org/10.1016/s0165-5728(00)00408-2.
Zhang, Wang, Yuntao Zhang, Yuxian He, Xiying Wang, and Qiang Fang. 2019. Lipopolysaccharide mediates time-dependent macrophage M1/M2 polarization through the Tim-3/Galectin-9 signalling pathway. Experimental Cell Research 376. Elsevier Inc.: 124–132. https://doi.org/10.1016/j.yexcr.2019.02.007.
Jiang, Guangyao, Sihao Li, Kang Yu, Bin He, Jianqiao Hong, Tengjing Xu, Jiahong Meng, et al. 2021. A 3D-printed PRP-GelMA hydrogel promotes osteochondral regeneration through M2 macrophage polarization in a rabbit model. Acta Biomaterialia 128. Acta Materialia Inc: 150–162. https://doi.org/10.1016/j.actbio.2021.04.010.
Kargarpour, Zahra, Jila Nasirzade, Layla Panahipour, Richard J. Miron, and Reinhard Gruber. 2021. Liquid PRF Reduces the Inflammatory Response and Osteoclastogenesis in Murine Macrophages. Frontiers in Immunology 12. Frontiers Media S.A. https://doi.org/10.3389/fimmu.2021.636427.
Nasirzade, Jila, Zahra Kargarpour, Sadegh Hasannia, Franz Josef Strauss, and Reinhard Gruber. 2020. Platelet-rich fibrin elicits an anti-inflammatory response in macrophages in vitro. Journal of Periodontology 91. John Wiley and Sons Inc: 244–252. https://doi.org/10.1002/JPER.19-0216.
Iu, Elsie Chit Yu, and Chi Bun Chan. 2022. Is Brain-Derived Neurotrophic Factor a Metabolic Hormone in Peripheral Tissues? Biology 11. https://doi.org/10.3390/biology11071063.
Vun, James, Neelam Iqbal, Elena Jones, and Payal Ganguly. 2023. Anti-Aging Potential of Platelet Rich Plasma (PRP): Evidence from Osteoarthritis (OA) and Applications in Senescence and Inflammaging. Bioengineering 10: 987. https://doi.org/10.3390/bioengineering10080987.
Liang, Jiedong, Gui Deng, and He Huang. 2018. The activation of BDNF reduced inflammation in a spinal cord injury model by TrkB/p38 MAPK signaling. Experimental and Therapeutic Medicine: 1688–1696. https://doi.org/10.3892/etm.2018.7109.
Yuan, Zimu, Decheng Jiang, Mengzhu Yang, Jie Tao, Xin Hu, Xiao Yang, and Yi Zeng. 2024. Emerging Roles of Macrophage Polarization in Osteoarthritis: Mechanisms and Therapeutic Strategies. Orthopaedic Surgery 9999: 9999. https://doi.org/10.1111/os.13993.
Arranz, Alicia, Christina Doxaki, Eleni Vergadi, Yeny Martinez De La Torre, Katerina Vaporidi, Eleni D. Lagoudaki, Eleftheria Ieronymaki, et al. 2012. Akt1 and Akt2 protein kinases differentially contribute to macrophage polarization. Proceedings of the National Academy of Sciences of the United States of America 109: 9517–9522. https://doi.org/10.1073/pnas.1119038109.
Su, Yu Wen, Xin Fu Zhou, Bruce K. Foster, Brian L. Grills, Jiake Xu, and Cory J. Xian. 2018. Roles of neurotrophins in skeletal tissue formation and healing. Journal of Cellular Physiology 233: 2133–2145. https://doi.org/10.1002/jcp.25936.
Hutchison, Michele R. 2013. Mice with a Conditional Deletion of the Neurotrophin Receptor TrkB Are Dwarfed, and Are Similar to Mice with a MAPK14 Deletion. Edited by Frank Beier. PLoS ONE 8: e66206. https://doi.org/10.1371/journal.pone.0066206.
Hutchison, Michele R., Mary H. Bassett, and Perrin C. White. 2010. SCF, BDNF, and Gas6 are regulators of growth plate chondrocyte proliferation and differentiation. Molecular Endocrinology 24: 193–203. https://doi.org/10.1210/me.2009-0228.
Rihl, M., E. Kruithof, C. Barthel, F. De Keyser, E. M. Veys, H. Zeidler, D. T.Y. Yu, J. G. Kuipers, and D. Baeten. 2005. Involvement of neurotrophins and their receptors in spondyloarthritis synovitis: Relation to inflammation and response to treatment. Annals of the Rheumatic Diseases 64: 1542–1549. https://doi.org/10.1136/ard.2004.032599.
Nishio, Hirofumi, Yoshitomo Saita, Yohei Kobayashi, Tomoiku Takaku, Shin Fukusato, Sayuri Uchino, Takanori Wakayama, Hiroshi Ikeda, and Kazuo Kaneko. 2020. Platelet-rich plasma promotes recruitment of macrophages in the process of tendon healing. Regenerative Therapy 14. Elsevier Ltd: 262–270. https://doi.org/10.1016/j.reth.2020.03.009.
Bryk, Marta, Jakub Chwastek, Jakub Mlost, Magdalena Kostrzewa, and Katarzyna Starowicz. 2021. Sodium Monoiodoacetate Dose-Dependent Changes in Matrix Metalloproteinases and Inflammatory Components as Prognostic Factors for the Progression of Osteoarthritis. Frontiers in Pharmacology 12: 1–16. https://doi.org/10.3389/fphar.2021.643605.
de Sousa Valente, João. 2019. The Pharmacology of Pain Associated With the Monoiodoacetate Model of Osteoarthritis. Frontiers in Pharmacology 10: 1–8. https://doi.org/10.3389/fphar.2019.00974.
Swearingen, C.A., M.G. Chambers, C. Lin, J. Marimuthu, C.J. Rito, Q.L. Carter, J. Dotzlaf, et al. 2010. A short-term pharmacodynamic model for monitoring aggrecanase activity: injection of monosodium iodoacetate (MIA) in rats and assessment of aggrecan neoepitope release in synovial fluid using novel ELISAs. Osteoarthritis and Cartilage 18: 1159–1166. https://doi.org/10.1016/j.joca.2010.02.019.
de Souza, Douglas Menezes, Kauê Franco Malange, Catarine Massucato Nishijima, Bruno Henrique de Melo Lima, Vinicius Cooper Capetini, Alexandre L. R. de Oliveira, Gabriel Forato Anhê, Claudia Herrera Tambeli, and Carlos Amilcar Parada. 2024. Intraarticular monomethyl fumarate as a perspective therapy for osteoarthritis by macrophage polarization. Inflammopharmacology. https://doi.org/10.1007/s10787-024-01443-w.
Moilanen, L. J., M. Hämäläinen, E. Nummenmaa, P. Ilmarinen, K. Vuolteenaho, R. M. Nieminen, L. Lehtimäki, and E. Moilanen. 2015. Monosodium iodoacetate-induced inflammation and joint pain are reduced in TRPA1 deficient mice - potential role of TRPA1 in osteoarthritis. Osteoarthritis and Cartilage 23: 2017–2026. https://doi.org/10.1016/j.joca.2015.09.008.
Korotkyi, O. H., A. A. Vovk, T. I. Galenova, T. B. Vovk, K. O. Dvorschenko, T. M. Falalyeyeva, and L. I. Ostapchenko. 2020. Cytokines profile in knee cartilage of rats during monoiodoacetateinduced osteoarthritis and administration of probiotic. Biopolymers and Cell 36: 23–35. https://doi.org/10.7124/bc.000A1E.
Kawarai, Yuya, Sumihisa Orita, Junichi Nakamura, Shuichi Miyamoto, Miyako Suzuki, Kazuhide Inage, Shigeo Hagiwara, et al. 2018. Changes in proinflammatory cytokines, neuropeptides, and microglia in an animal model of monosodium iodoacetate-induced hip osteoarthritis. Journal of Orthopaedic Research 36: 2978–2986. https://doi.org/10.1002/jor.24065.
Ogbonna, Andrea C., Anna K. Clark, and Marzia Malcangio. 2015. Development of monosodium acetate-induced osteoarthritis and inflammatory pain in ageing mice. Age 37. https://doi.org/10.1007/s11357-015-9792-y.
Sakurai, Yusuke, Masahide Fujita, Shiori Kawasaki, Takao Sanaki, Takeshi Yoshioka, Kenichi Higashino, Soichi Tofukuji, et al. 2019. Contribution of synovial macrophages to rat advanced osteoarthritis pain resistant to cyclooxygenase inhibitors. Pain 160: 895–907. https://doi.org/10.1097/j.pain.0000000000001466.
Mushenkova, Nataliya V., Nikita G. Nikiforov, Nikolay K. Shakhpazyan, Varvara A. Orekhova, Nikolay K. Sadykhov, and Alexander N. Orekhov. 2022. Phenotype Diversity of Macrophages in Osteoarthritis: Implications for Development of Macrophage Modulating Therapies. International Journal of Molecular Sciences 23: 8381. https://doi.org/10.3390/ijms23158381.
Sousa-Valente, J., L. Calvo, V. Vacca, R. Simeoli, J. C. Arévalo, and M. Malcangio. 2018. Role of TrkA signalling and mast cells in the initiation of osteoarthritis pain in the monoiodoacetate model. Osteoarthritis and Cartilage 26: 84–94. https://doi.org/10.1016/j.joca.2017.08.006.
Muley, Milind M., Eugene Krustev, Allison R. Reid, and Jason J. McDougall. 2017. Prophylactic inhibition of neutrophil elastase prevents the development of chronic neuropathic pain in osteoarthritic mice. Journal of Neuroinflammation 14. BioMed Central Ltd. https://doi.org/10.1186/s12974-017-0944-0.
Guzman, Roberto E., Mark G. Evans, Susan Bove, Brandy Morenko, and Kenneth Kilgore. 2003. Mono-Iodoacetate-Induced Histologic Changes in Subchondral Bone and Articular Cartilage of Rat Femorotibial Joints: AN Animal Model of Osteoarthritis. Toxicologic Pathology 31: 619–624. https://doi.org/10.1080/01926230390241800.
Gao, Xin, Yaqing Ma, Guijiao Zhang, Fengyan Tang, Jingjing Zhang, Jichao Cao, and Chunhui Liu. 2020. Targeted elimination of intracellular reactive oxygen species using nanoparticle-like chitosan- superoxide dismutase conjugate for treatment of monoiodoacetate-induced osteoarthritis. International Journal of Pharmaceutics 590. Elsevier B.V.: 119947. https://doi.org/10.1016/j.ijpharm.2020.119947.
Moon, S. J., Y. J. Woo, J. H. Jeong, M. K. Park, H. J. Oh, J. S. Park, E. K. Kim, et al. 2012. Rebamipide attenuates pain severity and cartilage degeneration in a rat model of osteoarthritis by downregulating oxidative damage and catabolic activity in chondrocytes. Osteoarthritis and Cartilage 20: 1426–1438. https://doi.org/10.1016/j.joca.2012.08.002.
Woodell-May, Jennifer, Andrea Matuska, Megan Oyster, Zachary Welch, Krista O’Shaughnessey, and Jacy Hoeppner. 2011. Autologous protein solution inhibits MMP-13 production by IL-1β and TNFα-stimulated human articular chondrocytes. Journal of Orthopaedic Research 29: 1320–1326. https://doi.org/10.1002/jor.21384.
Aniss, Nadia Noble-Daoud, Asmaa Magdy Zaazaa, and Mohamed Rabie Abdall Saleh. 2019. Anti-arthritic Effects of Platelets Rich Plasma and Hyaluronic Acid on Adjuvant-induced Arthritis in Rats. International Journal of Pharmacology 16: 33–46. https://doi.org/10.3923/ijp.2020.33.46.
Kita, Keisuke, Tohru Kimura, Norimasa Nakamura, Hideki Yoshikawa, and Toru Nakano. 2008. PI3K/Akt signaling as a key regulatory pathway for chondrocyte terminal differentiation. Genes to Cells 13: 839–850. https://doi.org/10.1111/j.1365-2443.2008.01209.x.
Xue, Fan, Zhenlei Zhao, Yanpei Gu, Jianxin Han, Keqiang Ye, and Ying Zhang. 2021. 7,8-dihydroxyflavone modulates bone formation and resorption and ameliorates ovariectomy-induced osteoporosis. eLife 10. eLife Sciences Publications Ltd. https://doi.org/10.7554/eLife.64872.
Wei, ChangWei, Yi Sun, Nan Chen, Song Chen, MeiHong Xiu, and XiangYang Zhang. 2020. Interaction of oxidative stress and BDNF on executive dysfunction in patients with chronic schizophrenia. Psychoneuroendocrinology 111: 104473. https://doi.org/10.1016/j.psyneuen.2019.104473.
Su, Yu-Wen, Xin‐Fu Zhou, Bruce K. Foster, Brian L. Grills, Jiake Xu, and Cory J. Xian. 2018. Roles of neurotrophins in skeletal tissue formation and healing. Journal of Cellular Physiology 233: 2133–2145. https://doi.org/10.1002/jcp.25936.
He, Tongrong, and Zvonimir S. Katusic. 2012. Brain-derived neurotrophic factor increases expression of MnSOD in human circulating angiogenic cells. Microvascular Research 83: 366–371. https://doi.org/10.1016/j.mvr.2012.01.001.
Sheikh, Ashfaq M., Mazhar Malik, Guang Wen, Abha Chauhan, Ved Chauhan, Cheng-Xin Gong, Fei Liu, William T. Brown, and Xiaohong Li. 2010. BDNF‐Akt‐Bcl2 antiapoptotic signaling pathway is compromised in the brain of autistic subjects. Journal of Neuroscience Research 88: 2641–2647. https://doi.org/10.1002/jnr.22416.
Pérez-Navarro, Esther, Núria Gavaldà, Elena Gratacòs, and Jordi Alberch. 2005. Brain‐derived neurotrophic factor prevents changes in Bcl‐2 family members and caspase‐3 activation induced by excitotoxicity in the striatum. Journal of Neurochemistry 92: 678–691. https://doi.org/10.1111/j.1471-4159.2004.02904.x.
Zhu, Wawa, Gautam N. Bijur, Nathan A. Styles, and Xiaohua Li. 2004. Regulation of FOXO3a by brain-derived neurotrophic factor in differentiated human SH-SY5Y neuroblastoma cells. Molecular Brain Research 126: 45–56. https://doi.org/10.1016/j.molbrainres.2004.03.019.
Matsuzaki, Tokio, Oscar Alvarez-Garcia, Sho Mokuda, Keita Nagira, Merissa Olmer, Ramya Gamini, Kohei Miyata, et al. 2018. FoxO transcription factors modulate autophagy and proteoglycan 4 in cartilage homeostasis and osteoarthritis. Science Translational Medicine 10. https://doi.org/10.1126/scitranslmed.aan0746.
Schaible, Hans-Georg. 2007. Nociceptors of the Joint with Particular Reference to Silent Nociceptors. In, 15:18–27. https://doi.org/10.1159/000101965.
Grigg, Peter. 2001. Properties of Sensory Neurons Innervating Synovial Joints. Cells Tissues Organs 169: 218–225. https://doi.org/10.1159/000047885.
McDougall, Jason J. 2006. Arthritis and pain. Neurogenic origin of joint pain. Arthritis Research and Therapy 8: 1–10. https://doi.org/10.1186/ar2069.
Vieira, Willians Fernando, Kauê Franco Malange, Silviane Fernandes de Magalhães, Gilson Gonçalves dos Santos, Alexandre Leite Rodrigues de Oliveira, Maria Alice da Cruz-Höfling, and Carlos Amilcar Parada. 2020. Gait analysis correlates mechanical hyperalgesia in a model of streptozotocin-induced diabetic neuropathy: A CatWalk dynamic motor function study. Neuroscience Letters 736: 135253. https://doi.org/10.1016/j.neulet.2020.135253.
Shepherd, Andrew J., and Durga P. Mohapatra. 2018. Pharmacological validation of voluntary gait and mechanical sensitivity assays associated with inflammatory and neuropathic pain in mice. Neuropharmacology 130. Elsevier Ltd: 18–29. https://doi.org/10.1016/j.neuropharm.2017.11.036.
Ferland, C. E., S. Laverty, F. Beaudry, and P. Vachon. 2011. Gait analysis and pain response of two rodent models of osteoarthritis. Pharmacology Biochemistry and Behavior 97. Elsevier Inc.: 603–610. https://doi.org/10.1016/j.pbb.2010.11.003.
Çağlar, Ceyhun, Halil Kara, Okan Ateş, and Mahmut Uğurlu. 2021. Evaluation of Different Intraarticular Injection Therapies with Gait Analysis in a Rat Osteoarthritis Model. Cartilage 13. SAGE Publications Inc.: 1134S-1143S. https://doi.org/10.1177/19476035211046042.
Ferreira-Gomes, Joana, Sara Adães, and José M. Castro-Lopes. 2008. Assessment of Movement-Evoked Pain in Osteoarthritis by the Knee-Bend and CatWalk Tests: A Clinically Relevant Study. Journal of Pain 9: 945–954. https://doi.org/10.1016/j.jpain.2008.05.012.
Ferreira-Gomes, Joana, Sara Adães, Jana Sarkander, and José M. Castro-Lopes. 2010. Phenotypic alterations of neurons that innervate osteoarthritic joints in rats. Arthritis and Rheumatism 62: 3677–3685. https://doi.org/10.1002/art.27713.
Schuelert, Niklas, and Jason J. McDougall. 2009. Grading of monosodium iodoacetate-induced osteoarthritis reveals a concentration-dependent sensitization of nociceptors in the knee joint of the rat. Neuroscience Letters 465: 184–188. https://doi.org/10.1016/j.neulet.2009.08.063.
Ghilardi, Joseph R., Katie T. Freeman, Juan M. Jimenez-Andrade, Kathleen A. Coughlin, Magdalena J. Kaczmarska, Gabriela Castaneda-Corral, Aaron P. Bloom, Michael A. Kuskowski, and Patrick W. Mantyh. 2012. Neuroplasticity of sensory and sympathetic nerve fibers in a mouse model of a painful arthritic joint. Arthritis & Rheumatism 64: 2223–2232. https://doi.org/10.1002/art.34385.
Ivanavicius, Stefan P., Adrian D. Ball, Chris G. Heapy, F. Russell Westwood, Fraser Murray, and Simon J. Read. 2007. Structural pathology in a rodent model of osteoarthritis is associated with neuropathic pain: Increased expression of ATF-3 and pharmacological characterisation. Pain 128: 272–282. https://doi.org/10.1016/j.pain.2006.12.022.
Ferreira-Gomes, Joana, Sara Adães, Raquel M. Sousa, Marcelo Mendonça, and José M. Castro-Lopes. 2012. Dose-dependent expression of neuronal injury markers during experimental osteoarthritis induced by monoiodoacetate in the rat. Molecular Pain 8: 1–12. https://doi.org/10.1186/1744-8069-8-50.
Tsujino, Hiroaki, Eiji Kondo, Tetsuo Fukuoka, Yi Dai, Atsushi Tokunaga, Kenji Miki, Kazuo Yonenobu, Takahiro Ochi, and Koichi Noguchi. 2000. Activating Transcription Factor 3 (ATF3) Induction by Axotomy in Sensory and Motoneurons: A Novel Neuronal Marker of Nerve Injury 182: 170–182. https://doi.org/10.1006/mcne.1999.0814.
Bráz, João M., and Allan I. Basbaum. 2010. Differential ATF3 expression in dorsal root ganglion neurons reveals the profile of primary afferents engaged by diverse noxious chemical stimuli. Pain 150: 290–301. https://doi.org/10.1016/j.pain.2010.05.005.
Sant’Anna, Morena B., Ricardo Kusuda, Tiago A. Bozzo, Gabriel S. Bassi, Jose C. Alves-Filho, Fernando Q. Cunha, Sergio H. Ferreira, Guilherme R. Souza, and Thiago M. Cunha. 2016. Medial plantar nerve ligation as a novel model of neuropathic pain in mice: Pharmacological and molecular characterization. Scientific Reports 6. Nature Publishing Group: 1–13. https://doi.org/10.1038/srep26955.
Tao, Ranyang, Bobin Mi, Yiqiang Hu, Sien Lin, Yuan Xiong, Xuan Lu, Adriana C. Panayi, Gang Li, and Guohui Liu. 2023. Hallmarks of peripheral nerve function in bone regeneration. Bone Research 11: 6. https://doi.org/10.1038/s41413-022-00240-x.
Drissi, Ichrak, William Aidan Woods, and Christopher Geoffrey Woods. 2020. Understanding the genetic basis of congenital insensitivity to pain. British Medical Bulletin 133: 65–78. https://doi.org/10.1093/bmb/ldaa003.
Minde, Jan, Olle Svensson, Monica Holmberg, Göran Solders, and Göran Toolanen. 2006. Orthopedic aspects of familial insensitivity to pain due to a novel nerve growth factor beta mutation. Acta Orthopaedica 77: 198–202. https://doi.org/10.1080/17453670610045911.
Malfait, Anne Marie, Rachel E. Miller, and Joel A. Block. 2020. Targeting neurotrophic factors: Novel approaches to musculoskeletal pain. Pharmacology and Therapeutics. Elsevier Inc. https://doi.org/10.1016/j.pharmthera.2020.107553.
Miller, Rachel E., Joel A. Block, and Anne-Marie Malfait. 2017. Nerve growth factor blockade for the management of osteoarthritis pain: what can we learn from clinical trials and preclinical models? Current Opinion in Rheumatology 29: 110–118. https://doi.org/10.1097/BOR.0000000000000354.

No competing interests reported.

PlasmaCaracterizationSupplementaryfigure1.tif

Download PDF

Editorial decision: Revision requested
25 Apr, 2024
Reviews received at journal
25 Apr, 2024
Reviewers agreed at journal
28 Mar, 2024
Reviews received at journal
27 Mar, 2024
Reviewers agreed at journal
27 Mar, 2024
Reviewers invited by journal
27 Mar, 2024
Editor assigned by journal
26 Mar, 2024
Submission checks completed at journal
26 Mar, 2024
First submitted to journal
24 Mar, 2024

You are reading this latest preprint version

The implications of Brain-derived neurotrophic factor in the biological activities of platelet-rich plasma.

Status:

Version 1

Abstract

Figures

1. INTRODUCTION

2. MATERIALS AND METHODS

3. RESULTS

DISCUSSION

CONCLUSIONS and STUDY LIMITATIONS

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1