Genetics risk assessment of PALB2 polymorphism (rs249954 and rs152451) with breast cancer susceptibility among the Pashtun population of Khyber Pakhtunkhwa, Pakistan

doi:10.21203/rs.3.rs-4160569/v1

Download PDF

Research Article

Genetics risk assessment of PALB2 polymorphism (rs249954 and rs152451) with breast cancer susceptibility among the Pashtun population of Khyber Pakhtunkhwa, Pakistan

https://doi.org/10.21203/rs.3.rs-4160569/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The partner and localizer of BRCA2 (PALB2) gene play an important role in DNA damage repair and control of many biological processes. The occurrence of specific genetic variations, known as single nucleotide polymorphisms (SNPs), in the PALB2 gene has been identified as a factor contributing to an increased susceptibility to breast cancer. The SNPs in PALB2 (rs249954 and rs152451) are identified and associated with breast cancer risk, however its role remains unknown in the Pashtun ethnic group, making it necessary to explore in this population. This case-controls study included 100 breast cancer patients and 100 healthy controls. The SNPs genotyping was performed using amplification-refractory mutation system-polymerase chain reaction (ARMS-PCR). The statistical analysis revealed a significant association between the risk allele of rs249954 and an elevated breast cancer risk (P = 0.0001), while rs152451 did not exhibit a significant association (P = 0.07). Heterozygous genotype of rs249954 was linked to increased breast cancer risk (P = 0.0001), whereas rs152451 did not show a significant association (P = 0.08). Mutant genotypes of both the SNPs correlated positively with breast cancer risk (P = 0.002, P = 0.042). Additionally, rs249954 exhibited significant association with Nodal status (P=0.01), Metastasis (P=0.01) and PR status (P=0.01). While PALB2 (rs142451) failed to exhibit significant association with any of the selected demographic and clinical parameters. In conclusion, the risk allele and both the heterozygous and homozygous genotypes of rs249954 were associated with an increased risk of breast cancer, whereas only homozygous mutant genotype of rs152451 exhibited significant association. However, further studies with larger datasets and comprehensive genomic analysis are necessary to validate these findings and explore associations with other relevant SNPs.

PALB2 gene

single nucleotide polymorphism

breast cancer risk

Breast cancer, a globally pervasive disease, is characterized by abnormal cell growth in the breast [1]. This complex disease manifests in various types, each with unique characteristics. The two primary categories are non-invasive, such as ductal carcinoma in situ (DCIS), and invasive, exemplified by invasive ductal carcinoma (IDC) and invasive lobular carcinoma (ILC) [2]. Recognizing the symptoms of breast cancer is crucial for early detection. These may encompass a palpable lump, changes in breast size or shape, nipple abnormalities, and skin alterations [3].

Globally, breast cancer stands as the second-leading cause of cancer-related mortality, constituting approximately 30% of all newly diagnosed cancer cases [4, 5]. Detailed statistics from GLOBOCAN in 2020 reported 2.3 million diagnosed cases, representing an additional 11.7% of all newly identified cancer cases [6, 7]. These figures underscore the significant impact of breast cancer on global health and emphasize the ongoing importance of research, prevention, and treatment efforts in addressing this prevalent and life-threatening disease [8]. The values for high-income countries in Asia, such as Japan, Singapore, South Korea, and Taiwan, have perceptibly improved in reducing this disease [9, 10]. However, in Pakistan, the breast cancer ratio is increasing, most probably in younger ages [11–13].

Numerous risk factors contribute to the development of breast cancer, including age, gender, family history, genetic mutations and other different non-genetics factors [14]. Genetic mutations in breast cancer involve several genes, including BRCA1, BRCA2, HER1, HER2, CHEK2, PALB2, RAD51 and TP53. PALB2, the partner and localizing protein of BRCA2, is particularly noteworthy [15]. PALB2 is an 1186 amino acid protein located on chromosome 16p12 and with a molecular weight of approximately 130 kilo Daltons, consisting of 12 intron and 13 exons [16]. PALB2 contains several proteins including N-terminal coiled-coil domain that interacts with BRCA1 at its C terminus and the WD40 domain that interacts with BRCA2 at the Chromatin organization Motif to promote chromatin organization [17–19]. PALB2 provides an association between BRCA1 and BRCA2 in the DNA damage repair [20]. The PALB2 protein completes homologous recombination repair (HRR) of DNA double-strand breaks (DSBs) while binding the BRCA1 and BRCA2 proteins. The combined BRCA1-PALB2-BRCA2 actively then recruits RAD51 and promote RAD51-mediated HR, ultimately affecting the resolution of DSBs10 repair [21]. In addition to playing an important role in HR regulation, PALB2 also play a role in the regulation of biological processes, including control of cell-cycle at the S-phase, cellular redox, homeostasis regulation, protection of actively transcribed genes, and recovery of stalled DNA replication forks [22].

The genetic variant rs249954 C > T exhibits functional effects, including altered enhancer histone marks, changed motifs, and significant associations with phenotypes as observed in NHGRI/EBI GWAS hits and GRASP QTL hits [23]. Moreover, the rs152451 A > G single nucleotide polymorphism (SNP) in the PALB2 gene is positioned proximal to the exon 4 splice donor site. Although not residing within a recognized protein domain, computational analyses, including the Human Splicing Finder (v3), suggest a potential influence on an exonic splicing enhancer motif. This proximity to a splice site raises the hypothesis that rs152451 could alter the splicing pattern of PALB2 mRNA, introducing a mechanism through which this genetic variant may impact PALB2 function. It is noteworthy that while various algorithms predict a benign effect on protein function, confirmation through RNA-based assays is essential for a comprehensive understanding of the SNP's functional implications in the context of breast cancer susceptibility [24].

Numerous studies have identified the association of PALB2 (rs249954 and rs152451) with the risk of breast cancer [25–28]. However, in Pakistan, especially in Khyber Pakhtunkhwa (KP) Population, the associations of these polymorphisms to breast cancer risk are largely unknown. Therefore, this case–controls study aimed to assess the susceptibility of selected SNPs in PALB2 with breast cancer risk in KP population.

Inclusion, exclusion criteria and ethical approval

A case-controls study was carried out in the Institute of Biotechnology and Genetic Engineering (IBGE) with a total of 200 participants, which include clinically, confirmed 100 breast cancer patients over a period of (2023–2024) from Institute of Radiotherapy and nuclear medicine (IRNUM) hospital Peshawar (under the license No- IBGE/2023/003). All the procedures from data collection to disposal were conducted under strict departmental guidelines. A gender (women only) and age matched 100 healthy controls were also recruited. Patients primarily diagnosed with breast cancer were enrolled while patients with other chronic diseases were excluded from the study. The research study was approved by the ethical committee of IBGE and IRNUM hospital Peshawar.

Blood sampling and DNA extraction

Approval (written consent) from all the enrolled subjects was taken after clearly describe the aim and objectives of the study in local language. A total of 3mL blood was collected in ethylene diamine tetra acetic acid (EDTA) tube and DNA isolation was carried out using salting out method already adopted at our lab and stored at -20°C for further analysis. Concentration and purity of DNA was confirmed using Nano-drop spectrophotometry machine. Demographic and comprehensive clinical data were collected using structured proforma.

SNPs genotyping and gel electrophoresis

Genotyping of PALB2 polymorphisms (rs152451 and rs249954) were carried out using specifically designed primers (Table 1). In each PCR reaction, 25 ng of extracted DNA was added to 10 µL reaction comprising of 5 µL Master Mix (2X), 0.5 µL each of forward and reverse primers, and 3 µL of RNase-free ddH2O water. Genotyping was done using ARMS-PCR followed by Gel Electrophoresis.

Table 1

Allele specific primer sequences designed for SNPs genotyping
Primer	Primer	Sequence (5 − 3)
PALB2 (rs249954)	Forward Outer	TGCTTCTGATAGCATAAACCCAG
	Reverse Outer	TCAAACAGAATGCCTGTAAAGCT
	Forward Inner	CTACATATGAAAACTTTAATGAAT
	Reverse Inner	GCTATATGACTGATTCTTTTCAG
PALB2 (rs152451)	Forward Outer	GAAATCAGCCTGCCC
	Reverse Outer	GTCTCACTCTGTTCCTGGTCAG
	Forward Inner	TCAGCACGAAAAATTATTTATTCG
	Reverse Inner	CATCTTGATTTACCTTTCACTT

Statistical analysis

Statistical Package for Social Science (SPSS) version 23 was used to analyze PALB2 selected alleles in breast cancer patient and healthy controls. An association between the mutational gene and the outcome components was determined using fisher exact test, and a derived odd ratio with 95% confidence level was also employed.

Risk association of PALB2 (rs249954 and rs152451) polymorphism with breast cancer patients

Both the selected SNPs were genotyped using ARMS-PCR protocol (Fig. 1). The analysis revealed significant association of PALB2 (rs249954) risk allele T (OR = 2.67, 95% CI = 1.78 to 4.00, P = 0.001) and both heterozygous (OR = 3.77, 95% CI = 1.70 to 8.34, P = 0.001) and homozygous mutant genotypes (OR = 6.40, 95% CI = 2.37 to 17.26, P = 0.0002) with breast cancer risk. Furthermore, statistical analysis for PALB2 (rs152451) revealed non-significant association of risk allele G (OR = 0.69, 95% CI = 0.47 to 1.03, P = 0.07) and heterozygous mutant genotype (OR = 0.52, 95% CI = 0.24 to 1.10, P = 0.08) with breast cancer risk. However, homozygous mutant genotype (OR = 0.38, 95% CI = 0.15 to 0.96, P = 0.042) exhibited significant association with breast cancer risk (Table 2).

Table 2

The frequency distribution of *PALB2* (rs249954 and rs152451) polymorphism in breast cancer patients and healthy controls
PALB2 (rs249954)
Allele	Patients N = 100	Control N = 100	Odd ratio	95% CI	P- value
C(W)	82(41%)	130(65%)	Reference
T(M)	118(59%)	70(35%)	2.67	1.78 to 4.00	0.001
Genotype
CC	10(10%)	32(32%)	Reference
CT	66(66%)	56(56%)	3.77	1.70 to 8.34	0.001
TT	24(24%)	12(12%)	6.40	2.37 to 17.26	0.0002
PALB2 (rs152451)
Allele	Patients N = 100	Control N = 100	Odd ratio	95% CI	P-value
A(W)	110(55%)	92(45%)	Reference
G(M)	90(46%)	108(54%)	0.69	0.4708 to 1.033	0.07
Genotype
AA	25(25%)	14(14%)	Reference
AG	60(60%)	64(64%)	0.52	0.24 to 1.10	0.08
GG	15(15%)	22(22%)	0.38	0.15 to 0.96	0.042

Association of PALB2 (rs249954 and rs152451) variant with demographic and clinicopathological parameters of breast cancer patients

The association between different demographic and clinical parameters of breast cancer patients and genotypic distribution of selected SNPs was determined. Both the PALB2 variants exhibited non-significant association with family history (P = 0.76, P = 0.60), Nulliparity (P = 0.06, P = 0.76) and menstrual status (P = 0.10, P = 0.81). Furthermore, both variant failed to exhibit significant association with clinicopathological parameters including Luminal A (P = 0.10, P = 0.15), Luminal B (P = 0.16, P = 0.40), HER2 status (P = 0.10, P = 0.15), TNBC (P = 0.51, P = 0.17) and ER status (P = 0.10, P = 1.0). Moreover, PALB2 (rs249954) exhibited significant association with Nodal status (P = 0.01), Metastasis (P = 0.01) and PR status (P = 0.01), while PALB2 (rs152451) didn’t showed any significant association (Table 3).

Table 3

The association between demographic and clinical parameters of breast cancer patients and genotype distribution of selected SNPs
Parameters	PALB2 (rs249954)					PALB2 (rs152451)
Menstrual status	CC (%)	CG (%)	GG (%)	OR	P value	AA (%)	AG (%)	GG (%)	OR	P value
Pre-menopausal	8(14.81)	36(66.6)	10(11.49)	0.26		13(24.07)	31(57.40)	10(18.51)	1.11
Post-menopausal	2(4.34)	30(65.21)	14(30.43)	3.82	0.10	12(26.08)	29(63.04)	5(10.86)	0.89	0.81
Nulliparity
Positive	6(7.31)	56(68.29)	20(24.39)	3.61		20(24.3)	51(62.1)	11(13.4)	1.19
Negative	4(22.2)	10(55.5)	4(22.2)	0.27	0.06	5(27.7)	9(50)	4(22.2)	0.83	0.76
Nodal status
Positive	3(4.54)	44(66.6)	19(28.7)	5.54		17(25.7)	37(56.1)	12(18.8)	0.88
Negative	7(20.5)	22(64.7)	5(14.7)	0.18	0.01	8(23.5)	23(67.6)	3(8.82)	1.12	0.80
Stages
2	4(12.5)	20(62.5)	8(25.0)			6(18.7)	24(75.0)	2(6.25)
3	2(8.88)	31(70.4)	11(26.0)			11(25)	23(54.5)	10(22.7)
4	4(16.6)	15(62.5)	5(20.8)		0.98	8(33.3)	13(54.1)	3(12.5)		0.28
Metastasis
Positive	6(25)	14(58.3)	4(16.6)	0.16		8(33.3)	13(54.1)	3(12.5)	0.57
Negative	4(5.26)	52(68.4)	20(26.3)	6.0	0.01	17(22.3)	47(61.8)	12(15.7)	1.73	0.28
Family history
Positive	1(7.69)	10(76.9)	2(15.3)	0.72		4(30.7)	6(46.1)	3(23.1)	1.39
Negative	9(10.3)	56(64.3)	22(25.2)	1.38	0.76	21(24.1)	54(62.1)	12(26.4)	0.71	0.60
HER2 Status
Positive	1(2.77)	25(69.4)	10(27.7)	5.72		13(20.31)	42(65.6)	9(14.1)	1.96
Negative	9(14.1)	41(64.1)	14(21.8)	0.17	0.10	12(33.3)	18(50.0)	6(16.6)	0.50	0.15
Luminal A
Positive	6(16.6)	20(55.5)	10(27.7)	0.33		12(35.2)	18(52.9)	6(17.6)	1.96
Negative	4(6.25)	46(71.8)	14(21.8)	3.00	0.10	13(19.6)	42(63.6)	9(13.6)	0.50	0.15
Luminal B
Positive	2(25.0)	5(62.5)	1(12.5)	0.28		1(12.5)	6(75.0)	1(12.5)	2.47
Negative	8(8.69)	61(66.3)	23(25.0)	3.50	0.16	24(15.21)	54(58.6)	14(15.2)	0.40	0.40
Basal Type
Positive	6(8.69)	44(63.7)	19(27.5)	1.55		20(28.9)	38(55.1)	11(15.9)	0.47
Negative	4(12.9)	22(70.9)	5(16.1)	0.64	0.51	5(16.1)	22(70.9)	4(12.9)	2.12	0.17
PR Status
Positive	7(20.5)	21(61.7)	6(17.6)	0.18		8(23.5)	21(61.7)	5(14.7)	1.12
Negative	3(4.45)	45(68.1)	18(27.2)	2.03	0.01	17(25.7)	39(59.1)	10(15.1)	0.88	0.80
ER Status
Positive	4(6.2)	46(71.8)	14(21.8)	3.0		16(25)	37(57.8)	11(17.1)	1.0
Negative	6(16.6)	20(55.5)	10(27.7)	0.33	0.10	9(25.0)	23(63.8)	4(11.1)	1.0	1.0

Breast cancer has emerged as the most prevalent form of cancer affecting women globally, with its incidence steadily increasing on a worldwide scale [29]. Globally, breast cancer stands as the second-leading cause of cancer-related mortality, constituting approximately 30% of all newly diagnosed cancer cases [4, 30]. According to comprehensive data from GLOBOCAN in 2020, there were 2.3 million reported cases, signifying an additional 11.7% of all recently identified cancer instances [31]. Several established risk factors are linked to the development of breast cancer, including age, family history, weight, physical activity, oral contraceptive use, and alcohol consumption [32]. Genetic mutations in breast cancer involve several genes, including BRCA1, BRCA2, HER1, HER2, CHEK2, PALB2, RAD51 and TP53. PALB2, the partner and localizing protein of BRCA2, is particularly noteworthy [15]. The PALB2 is located on chromosome 16p12.1, and has been identified as a third clinically significant medium-to-high penetrance breast cancer gene after BRCA1 and BRCA2 [33]. This gene plays a crucial role in co-localizing with BRCA2 proteins within nuclear foci. It also contributes to the stabilization of chromatin and the nuclear matrix, thereby enhancing the tumor-suppressing effects associated with BRCA2 [34]. Over the past decades, numerous studies have disclosed associations between PALB2 polymorphisms in various regions and cancer risk; however, the findings have displayed inconsistency [35–38]. In Pakistan, especially in KP Population, the associations of these polymorphisms to breast cancer risk are largely unknown. Therefore, this case–controls study aimed to assess the susceptibility of these two single nucleotide polymorphisms in PALB2 (rs249954 and rs 152451) to breast cancer risk in a KP female population.

In this study, we enrolled 100 breast cancer patients and 100 healthy controls to examine the frequencies of polymorphism rs249954 and rs152451 within the Pashtun population. DNA extraction was carried out using salting out method while genotyping was done using ARMS-PCR previously used in our lab [39, 40]. The analysis revealed significant association of PALB2 (rs249954) risk allele T (P = 0.001) and both heterozygous (P = 0.001) and homozygous mutant genotypes (P = 0.0002) with Breast cancer risk. Additionally, PALB2 (rs249954) exhibited significant association with Nodal status (P = 0.01), Metastasis (P = 0.01) and PR status (P = 0.01). Our findings align with research study conducted in two different Chinese populations, Asian and Turkey populations [25–28]. While study performed in Canadian population showed contradictory results indicating non-significant association of rs249954 with breast cancer risk [41]. Moreover, PALB2 (rs152451) risk allele G (P = 0.07) and heterozygous AG genotype (P = 0.08) indicated non-significant association with breast cancer risk. However, the homozygous mutant GG genotype was associated with an increased risk of breast cancer (P = 0.042). However, rs152451 failed to exhibit significant association with any of the selected demographic and clinical parameter. Our results align with research study conducted in South American and Turkey population [26, 42]. Furthermore a meta-analysis study also supported our result indicating non-significant association of rs152451 with breast cancer risk [43]. Moreover, family based study performed in Australian population signifies the potential role of (rs152451) in familial breast cancer [24].

In conclusion our study highlighted the role of both PALB2 selected SNPs (rs249954 and rs152451) with the risk of breast cancer in KP population. PALB2 (rs249954) indicated significant association with breast cancer risk while rs152451 failed to exhibit significant association. However, different studies have identified the role of rs152451 highly significant with breast cancer cases of highly family history positive [24, 42]. Therefore, future endeavors should consider identifying the role of PALB2 (rs152451) in separate cohort of highly positive familial breast cancer cases. Furthermore, while considering certain positive impact of study, there are certain limitations which also need to be discussed. The study was conducted with limited number of samples which may not fully cover this diverse population. Additionally, participants’ recruitment was done based on hospital settings which may introduce selection bias.

Competing interests

The authors declared no competing interests

Consent to publish

All the authors have read and approved the article for publication

Availability of data and materials

All the necessary data are included in manuscript, related data will be provided on request from corresponding author

Funding

There is no funding received to conduct the study, the authors contributed for the study

Authors' Contributions

SG did the experimental work and wrote the first draft under the supervision of NUK. HK help in data collection, analysis and write the article. NUK, MHA and IA critically review the final manuscript.

Acknowledgements

Not applicable

Muñoz, J.P., et al., The Role of MicroRNAs in Breast Cancer and the Challenges of Their Clinical Application. 2023. 13(19): p. 3072.
Ali, R., et al., Non-coding RNA’s prevalence as biomarkers for prognostic, diagnostic, and clinical utility in breast cancer. 2023. 23(2): p. 195.
Glück, S., et al., TP53 genomics predict higher clinical and pathologic tumor response in operable early-stage breast cancer treated with docetaxel-capecitabine±trastuzumab. Breast cancer research and treatment, 2012. 132(3): p. 781-791.
Sözen, S. and S. Emir, Breast cancer updates. 2023: BoD–Books on Demand.
Almajed, H., Breast cancer awareness among female residents of Kuwait. 2023, University of Glasgow.
Al-Muftah, M., F.J.C.E. Al-Ejeh, Biomarkers, and Prevention, Cancer incidence and mortality estimates in Arab countries in 2018: A GLOBOCAN data analysis. 2023. 32(12): p. 1738-1746.
Workie, M.S., et al., Background: Cancer is a leading cause of death in the world, and the estimated new cancer cases were 19 million and the estimated cancer deaths were around 10 million worldwide in 2020. Proton therapy (PT) is a promising treatment for cancers; however, only few patients with cancer received PT due to limited number of PT centers worldwide, especially in low-and middle-income countries. 2023: p. 17.
Sharmin, S., et al., A hybrid dependable deep feature extraction and ensemble-based machine learning approach for breast cancer detection. 2023.
Im, S.-A., et al., Pan-Asian adapted ESMO Clinical Practice Guidelines for the diagnosis, staging and treatment of patients with metastatic breast cancer. 2023. 8(3): p. 101541.
Kumar, V. and R. Sundarraj, Global innovation and economic value. 2018: Springer.
Tufail, M., C.J.J.o.E. Wu, and G. Health, Exploring the Burden of Cancer in Pakistan: An Analysis of 2019 Data. 2023: p. 1-11.
Zeeshan, S., et al., Clinicopathological features of young versus older patients with breast cancer at a single Pakistani institution and a comparison with a national US database. 2019. 5: p. 1-6.
Mubarik, S., et al., Evaluation of Lee–Carter model to breast cancer mortality prediction in China and Pakistan. 2023. 13: p. 1101249.
Visvanathan, K., et al., The ENGAGE study: evaluation of a conversational virtual agent that provides tailored pre-test genetic education to cancer patients. 2023: p. 1-10.
Koivuluoma, S., Hereditary predisposition to breast cancer: evaluating the role of rare candidate alleles discovered by whole-exome sequencing. 2023.
Ducy, M., et al., The tumor suppressor PALB2: inside out. 2019. 44(3): p. 226-240.
Kyriukha, Y., et al., The PALB2 DNA-binding domain is an intrinsically disordered recombinase. 2023.
Zhong, A.X., Y. Chen, and P.-L.J.I.J.o.M.S. Chen, BRCA1 the Versatile Defender: Molecular to Environmental Perspectives. 2023. 24(18): p. 14276.
Maioru, O.-V., et al., Developments in Genetics: Better Management of Ovarian Cancer Patients. 2023. 24(21): p. 15987.
Voutsadakis, I.A. and A.J.A.R. Stravodimou, Homologous Recombination Defects and Mutations in DNA Damage Response (DDR) Genes Besides BRCA1 and BRCA2 as Breast Cancer Biomarkers for PARP Inhibitors and Other DDR Targeting Therapies. 2023. 43(3): p. 967-981.
Toss, A., et al., Management of PALB2‐associated breast cancer: A literature review and case report. 2023. 11(8): p. e7747.
Wu, W., et al., The dePARylase NUDT16 promotes radiation resistance of cancer cells by blocking SETD3 for degradation via reversing its ADP-ribosylation. 2024: p. 105671.
Zou, W., et al., Study on TFF1 and PALB2 gene variants associated with gastric carcinoma risk in the Chinese Han population. 2023. 83: p. 102333.
Thompson, E.R., et al., Prevalence of PALB2 mutations in Australian familial breast cancer cases and controls. 2015. 17: p. 1-11.
Chen, P., et al., Association of common PALB2 polymorphisms with breast cancer risk: a case-control study. 2008. 14(18): p. 5931-5937.
Bilen, M.Y., et al., Investigation of effects of PALB2 genetic variations on breast cancer predisposition. 2020. 45(1): p. 186-194.
Cao, A.-Y., et al., Five common single nucleotide polymorphisms in the PALB2 gene and susceptibility to breast cancer in eastern Chinese population. 2010. 123: p. 133-138.
Dianatpour, A., S. Faramarzi, and S.J.A.P.J.o.C.P.A. Ghafouri-Fard, Meta-analysis of association between PALB2 Polymorphisms and Breast Cancer. 2018. 19(10): p. 2897.
Roheel, A., et al., Global epidemiology of breast cancer based on risk factors: a systematic review. 2023. 13.
Suresh, V., CHALLENGES AND COPING STRATEGIES AMONG CAREGIVERS OF PERSONS WITH BREAST CANCER. 2023.
Ilic, I. and M.J.H. Ilic, International patterns and trends in the brain cancer incidence and mortality: An observational study based on the global burden of disease. 2023. 9(7).
Rajaneesh, N. and S.J.A.o.B.D. Venkatesh, Lifestyle Modifications and Genetic Factors Affecting Breast Cancer. 2023. 1(1): p. 8-14.
Oosthuizen, J., Molecular screening of Coloured South African breast cancer patients for the presence of BRCA mutations using high resolution melting analysis. 2016, University of the Free State.
Zhang, J., et al., A meiosis-specific BRCA2 binding protein recruits recombinases to DNA double-strand breaks to ensure homologous recombination. 2019. 10(1): p. 722.
Antoniou, A.C., et al., Breast-cancer risk in families with mutations in PALB2. 2014. 371(6): p. 497-506.
Southey, M.C., et al., A PALB2 mutation associated with high risk of breast cancer. 2010. 12: p. 1-10.
Lee, J.E.A., et al., Molecular analysis of PALB2‐associated breast cancers. 2018. 245(1): p. 53-60.
Wu, S., et al., Molecular mechanisms of PALB2 function and its role in breast cancer management. 2020. 10: p. 301.
Khan, Y., et al., Significant association of BRCA1 (rs1799950), BRCA2 (rs144848) and TP53 (rs1042522) polymorphism with breast cancer risk in Pashtun population of Khyber Pakhtunkhwa, Pakistan. 2023: p. 1-10.
Shahzad, S., et al., Estrogen receptor alpha (ESR1) gene polymorphism (rs2234693 and rs2046210) with breast cancer risk in pashtun population of Khyber Pakhtunkhwa. 2023. 50(3): p. 2445-2451.
Guenard, F., et al., Evaluation of the contribution of the three breast cancer susceptibility genes CHEK2, STK11, and PALB2 in non-BRCA1/2 French Canadian families with high risk of breast cancer. 2010. 14(4): p. 515-526.
Leyton, Y., et al., Association of PALB2 sequence variants with the risk of familial and early-onset breast cancer in a South-American population. 2015. 15(1): p. 1-10.
Wu, Y., et al., Association between rs120963, rs152451, rs249935, rs447529, rs8053188, and rs16940342 polymorphisms in the PALB2 gene and breast cancer susceptibility: a meta-analysis. 2018. 41(12): p. 780-786.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Genetics risk assessment of PALB2 polymorphism (rs249954 and rs152451) with breast cancer susceptibility among the Pashtun population of Khyber Pakhtunkhwa, Pakistan

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Inclusion, exclusion criteria and ethical approval

Blood sampling and DNA extraction

SNPs genotyping and gel electrophoresis

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1