Sample Information
A total of 30 pairs of GC tissues and para-carcinoma normal tissues were obtained in this study. And GC tissue included 21 metastatic-positive and nine metastatic-free cases. Enrolled patients were pathologically diagnosed as GC.
The Online Database Gene Expression Profiling (the GEPIA web tool)
Based on The Cancer Genome Atlas (TCGA) and the Genotype-Tissue Expression (GTEx) projects, the RNA sequencing expression data related to our project was analyzed using the GEPIA web tool (http://gepia.cancerpku.cn/index. html.).
Cell culture and transfection
The gastric cancer cell lines (SGC-7901, SUN-16, MKN-45, and AGS cells) and the human gastric epithelial cell line GES-1 (American Type Culture Collection, USA) were used in this study. All cells cultured respectively in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin (Hyclone, USA) and incubated in a 5% carbon oxide (CO2) incubator at 37°C.
For cell transfection, cells in the logarithmic growth phase were transfected with corresponding constructs when the confluence was up to 80% following the instructions of Lipofectamine2000 (Invitrogen, USA). The culture medium was replaced 6 hours later. H19-small interfering RNA (si-H19), miR-194 mimic, miR-194 inhibitor, pcDNA-E2F3, and negative control (NC) were constructed by Gene Pharma (Shanghai, China).
Luciferase reporter assay
Luciferase assay was used to investigate the interaction among H19, miR-194, and the target gene E2F3 with a Dual-Luciferase Reporter Assay System (Promega, USA). The 3’UTR sequence of H19 and E2F3 were downloaded from the National Center for Biotechnology Information (NCBI, USA) for the construction of wild-type H19 (H19-WT), wild-type E2F3 (E2F3-WT) and mutant-type H19 (H19-MUT), mutant-type E2F3 (E2F3-MUT). AGS cells were co-transfected with 50 pmol/L miR-194 mimic (or NC) and 80 ng of H19 WT (or E2F3-WT) or H19 MUT (or E2F3-MUT), respectively. Luciferase activity was detected after transfection for 48 hours.
Cell counting kit-8 (CCK-8) assay
For determining the proliferative ability of GC cells, the transfected cells were incubated in 100 μl culture medium each well (6×103 cells/well) using 96-well plates. At different set time, the CCK-8 solution (Beyotime, Shanghai, China) (10 μL/well) was added to cells and then incubated at 37°C for 2 hours in the dark. The optical density (OD) value (450 nm) was evaluated by a microplate reader.
Cell migration and invasion assays
Transwell assay was used to investigate the migration and invasion of GC cells. Different group GC cells were put on the upper Matrigel-coated invasion chambers or non-coated migration chambers (BD Biosciences, USA), respectively. 500 μl of DMEM medium containing 10% FBS was put in the lower chamber, and the serum-free medium was put in the upper chamber. The non-invasive cells were wiped off by cotton swabs after 48 hours of incubation. The migrating and invading cells were fixed with 95% ethanol, stained with 0.1% crystal violet. The number of migratory and invasive cells in the lower chamber were counted under an inverted microscope (×100). The experiments were independently repeated three times.
Western blotting
The total protein of treated cells was extracted using a radioimmunoprecipitation assay (RIPA) kit (Beyotime, China). The sample of protein was separated by electrophoresis on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, USA). Followed by the blocks with skimmed milk, the membranes were incubated with primary antibodies (Cell Signaling Technology, USA) overnight at 4°C. After being washed with Tris-buffered Saline with Tween 20 (TBS-T) for three times, the membranes were incubated with secondary antibody at 24°C for 1 hour. The protein blot on the membrane was exposed by chemiluminescence.
QRT-PCR
The total RNA was extracted from the ASCs with an RNeasy Mini Kit and then transcribed reversely with a SuperScript III kit (Invitrogen, CA). QRT-PCR was performed with a polymerase chain reaction instrument (Opticon CFD-3200, MA). The primer sets included: H19: forward, GCCGAGTTCGCTAGGCAAGCA; reverse, CTCAACTGGTGTCGTGGA. miR-194: forward, ACAGCAACTCCATGTGG; reverse, GAACATGTCTGCGTATCTC. E2F3: forward, AGCGGTCATCAGTACCTCTCAG; reverse, TGGTGAGCAGACCAAGAGACGT. PCNA: forward, CAAGTAATGTCGATAAAGAGGAGG; reverse, GTGTCACCGTTGAAGAGAGTGG. Vimentin: forward, CCTCCAGAGTTTACTGCCATGAC; reverse, GTAGGATCTCCGCCACTGATTC. N-cadherin: forward, AGGCAAAGCAGGAGTCCACTGA; reverse, ATCTGGCGTTCCAGGGACTCAT. β-actin: - forward, TCAGGTCATCACTATCGGCAAT; reverse, AAAGAAAGGGTGTAAAACCA. The relative expression of amplified RNA samples was calculated using the 2−ΔΔCT method, and β-actin was used as the internal control. All experiments were done in triplicate.
Statistical analysis
All numerical data were expressed as the mean ± standard error of mean (SEM), and qualitative data were expressed as n (%). A comparison between the treatment groups of numerical data was analyzed by independent t-tests or 1-way or repeated-measures analysis of variance (ANOVA). Comparison between the treatment groups of qualitative data were analyzed by chi-square tests, and Fisher’s exact tests were used for correction if necessary. All p-values were 2-tailed, and p-values less than 0.05 were considered statistically significant. For all statistical calculations, p-values were determined using SPSS (version 18.0 for Windows; SPSS, Inc., USA).