PC4 is highly expressed in DLBCL and positively correlated with c-Myc expression and poor prognosis of patients.
We began our studies by exploring the potential clinical significance of PC4, we firstly analyzed PC4 mRNA expression level in tumor tissues compared with normal tissues (Figure 1A), the mRNA expression of PC4 in tumor was apparently higher than that in normal tissues. We also analyzed GEPIA database and revealed that PC4 was positively correlated with MYC expression (P<0.001,R=0.46) in human whole blood (Supplemental Figure 1A). Moreover, GEPIA database showed that PC4 mRNA expression level was significantly higher in DLBCL patients tissues (n=47) than in normal tissues (n=337) (Supplemental Figure 1B). Then, we analyzed PC4 mRNA expression level and found that c-Myc(+) tissues had higher PC4 mRNA expression compared to c-Myc(-) tissues (Figure 1B). In addition, we analyzed PC4 expression in DLBCL specimens with or without positive expression of c-Myc protein, and found that average staining score of PC4 in c-Myc(+) tissues were significantly increased compared to c-Myc(-) tissues (Figure 1C). The data above suggested a possible positive correlation between PC4 expression levels and c-Myc expression level in DLBCL. Meanwhile, through analyzing 159 and 414 cases of DLBCL from public cancer databases (GSE4475 and GSE10846, respectively) we found that the higher PC4 expression group had poorer overall survival compared with lower PC4 expression group (Figure 1D and 1E). Although c-Myc expression demonstrated no significant change on the basis of gender, age, subtype, Ki-67 expression, it had poorly differentiated in DLBCL with a higher Ann Arbor stage and poorly event-free survival (Table1). Finally, we detected the protein level of PC4 and c-Myc in non-cancerous lymphocytic cell lines (CCRF-SD) and DLBCL cell Lines (DOHH2, OCL-LY10, HBL-1 and TMD8), our result showed that PC4 protein expression were much higher in TMD8 and HBL-1 cells compared to other cell lines (Figure 1F). The qPCR (Figure 1G) and Immunofluorescent staining (Supplemental Figure 2A) assays confirmed that the mRNA and protein level of PC4 was up-regulated in DLBCL cell lines (DOHH2, OCL-LY10, TMD8 and HBL-1 cells) compared with non-cancerous lymphocytic cell lines (CCRF-SD cells). Collectively, these results suggest that PC4 is a potential oncogene and positively correlated with c-Myc in DLBCL.
Table 1
Correlations between c-Myc expression level and clinic characteristics of patients with DLBCL.
Clinicopathological parameters | patients | c-Myc | P |
Number (%) | Negative (%) | Positive (%) | Value |
All cases | 54(100) | 27(50) | 27(50) | P=1.000 |
Gender | | | | |
Female | 27(50) | 12(22.2) | 15(27.8) | P=0.587 |
Male | 27(50) | 15(27.8) | 12(22.2) |
Age | | | | |
< 60 | 37(31.5) | 19(35.2) | 18(33.3) | P=1.000 |
≥ 60 | 17(68.5) | 8(14.8) | 9(16.7) |
Subtype | | | | |
GCB type | 29(53.7) | 17(31.5) | 12(22.2) | P=0.243 |
Non-GCB type | 22(40.7) | 8(14.8) | 14(25.9) |
Unclassified DLBCL | 3(5.6) | 2(3.7) | 1(1.9) |
Ki-67 expression | | | | |
≥ 70% | 22(40.7) | 8(14.8) | 14(25.9) | P=0.097 |
< 70 | 32(59.3) | 19(35.2) | 13(24.1) |
Ann Arbor stage | | | | |
I-II | 17(31.5) | 16(29.6) | 1(1.9) | P=0.000 |
III-IV | 37(68.5) | 11(20.4) | 26(48.1) |
Time from enrollment | | Event-free survival (standard error) | |
12 months | 66.7(6.7) | 92.6(2.1) | 77.8(4.4) | P=0.000 |
24 months | 63.0(7.3) | 92.6(2.1) | 74.1(5.1) | P=0.000 |
Corrected with continuity correction of Pearson’s χ 2 test.DLBCL, Diffuse large B-cell lymphoma; |
Knockdown of PC4 induces cell apoptosis in MYC-expressing DLBCL in vitro and in vivo.
To investigate the functional significance of increased PC4 expression in DLBCL, TMD8 and HBL-1 cells were used for the subsequent loss-of-function study. The stable cell lines with PC4 knockdown were established by specific shRNA (shPC4#1 and shPC4#2) (Figure 2A). The CCK-8 assays demonstrated that PC4 knockdown inhibited the proliferation (Figure 2B). Then, the expression of apoptosis protein markers, including poly ADP-ribose polymerase (PARP), cleaved caspase 3, B-cell lymphoma-2 (BCL-2) and B-cell lymphoma-2-Associated X (BAX) were detected by western blotting in the constructed cells (Figure 2C). As shown in Figure 2D, knockdown of PC4 increased apoptosis in stable PC4 Knockdown cell lines than controls, Gene Set Enrichment Analysis (GSEA) showed that the gene sets of apoptosis enrichment in PC4 low (shPC4) in TMD8 cell lines (Figure 2E), which means that PC4 silencing can induce cell apoptosis. We observe cell vacuoles and cell debris in the constructed cells through a microscope (Supplemental Figure 3A). Moreover, TEM images showed autophagic vacuole (AV) formation in the constructed cells (Figure 2F). These finding suggested that knockdown of PC4 was associated with autophagy. In addition, we established a subcutaneous xenograft model to study the biological function of PC4 in vivo. TMD8 cells with or without stable PC4-knockdown were inoculated into athymic male nude mice. During the in vivo experiments, xenograft growth in the sh-PC4#1 group was dramatically inhibited compared to the sh-NC group and control group (Figure 2H). The average tumor weight and tumors size at the experimental endpoint was reduced by PC4 knockdown (Figure 2G and 2I). Besides, knockdown of PC4 had no significant impact on mice body weight (Figure 2J). Taken together, the above data suggests that PC4 promotes DLBCL cell proliferation, and knockdown of PC4 can induce apoptosis and autophagy.
Knockdown of PC4 induces apoptosis in MYC-expressing DLBCL by inducing excessive autophagy.
Non-selective autophagy occurred due to lack of energy11. As envisioned, Silencing of PC4 could induce the expression of the LC3II and down-regulated the SQSTM1 protein in DLBCL cells (Figure 3A). The associated autophagy proteins (beclin1, ULK1)also up-regulated after silencing of PC4 (Figure 3B). In addition, TEM images showed AV formation in PC4 knockdown cells, which could be reversed by 3-methyladenine (3MA; an autophagy inhibitor) (Figure 3C). Above-mentioned data suggested that autophagy was induced by PC4-knockdown. PC4 knockdown significantly suppressed the proliferation of TMD8 and HBL-1 cells, which was partly reversed by 3MA (Figure 3D). Similarly, the cell apoptosis was also reversed by 3MA (Figure 3E). Therefore, our results confirmed that PC4 knockdown could induce autophagic cell death in TMD8 and HBL-1 cells. To assess the effect of knockdown of PC4 in c-Myc low expression cell lines (DOHH2 and OCL-LY10) and CCRF-SD were established with PC4 knockdown by specific shRNA (Supplemental Figure 4A). Interestingly, we found no effect on the level of LC3II and cleaved PARP and cell proliferation (Supplemental Figure 4B and 4C). Collectively, these results suggested that PC4 inhibition can induce autophagic cell death only in the c-Myc high expressing DLBCL cell lines. Galluzzi reported that a rapid reduction in energy charge below a critical limit is likely to trigger autophagic cell death11. This is well established that c-Myc is a key regulator in energy metabolism9, suggesting that PC4 may directly regulate c-Myc or metabolism. This indicated that PC4 is a tumor-specific oncogene and may be a novel therapeutic target for MYC-expressing DLBCL.
Knockdown of PC4 induces excessive autophagy through AMPK/mTOR signaling pathway in MYC-expressing DLBCL.
We conducted Genome-wide analysis to compare the gene expression profiles in TMD8 with or without stable PC4-knockdown to explore the potential mechanism of PC4 on cell proliferation inhibition and apoptosis in DLBCL. The heat map showed that 4 genes, including c-Myc, reduced their expression, while the expression of 36 genes were increased after PC4 knockdown (Figure 4A). PC4 affects the expression of 12669 genes in TMD8 stable PC4 knockdown cells, with 12172 genes that overlap between TMD8 stable PC4 knockdown cells and control cells (Figure 4B). Then, we used KEGG enrichment analysis in TMD8 stable PC4 knockdown cells and controls (Figure 4C), which revealed that after PC4-knockdown AMPK signaling pathway was most increased and PI3K-Akt signaling pathway was most inhibited. Moreover, we established Gene ontology analysis to understand the PC4 full function, the results demonstrated that PC4 could positive regulate the metabolic process and cellular process in DLBCL (Figure 4D). Therefore, PC4 promotes proliferation in DLBCL through regulating metabolism. According to the data from Genome-wide analysis, we established mTOR signaling pathway and downstream protein (4EBP1 and S6K1) by western blot, our result showed that the level of phosphorylation was decreased after PC4 knockdown (Figure 4E). Then we detected mTOR upstream signaling pathway including AMPK, P53, P38 and AKT, which revealed that the level of AMPK phosphorylation was comparatively more increased than the other proteins (Figure 4F). GSEA showed that the gene sets of mTORC1 were enriched in PC4high (Control) compared with PC4low (shPC4) in TMD8 cell lines (Figure 4G). A previous study showed that alteration of the above pathways was associated with energy metabolism declension19.
PC4 regulates c-Myc transcription to perform it’s oncogene function.
To further illustrate the underlying mechanisms of PC4 in DLBCL, we conducted metabolism-related experiments. We found that the 2-NBDG uptake and the production of Lactate and ATP were significantly inhibited after PC4-knockdown (Figure 5A, 5B and 5C). Furthermore, Silencing of PC4 inhibited the key enzymes of glycolysis including GLUT1, PKM2, HK2 and LDHA (Figure 5D). Previous studies showed that glycolysis metabolism was regulated by c-Myc20 and HIF-1α21. Then we performed western blotting and q-PCR on c-Myc and HIF-1α and found that the protein and mRNA level of c-Myc was dramatically decreased in stable PC4 knockdown cell lines (Figure 5E and 5F). GSEA showed that the gene sets of MYC were enriched in PC4high (Control) compared with PC4low (shPC4) in TMD8 cell lines (Figure 5G). To further demonstrate the relationship between PC4 and c-Myc, we subsequently examined the relationship between PC4 and c-Myc. Schematic presentation of PC4 and c-Myc binding sites on the c-Myc locus are shown in Figure 5H, BS: binding site, BS1: CCAACAAATGCAATGGGAGT and BS2: CAGGAGGGGCGGTATCTG. We conducted luciferase reporter assays, which revealed that PC4 regulated c-Myc transcription through two PC4 binding sites in c-Myc promoters (Figure 5I). However, EMSA confirmed PC4 as a DNA binding protein, which is associated with the c-Myc binding sequence in BS1, not in BS2 (Figure 5J). To further verify the BS1 function, we conducted BS1 mutation in TMD8 and HBL-1 cell lines, BS mutation sequence: TTGGTGGGCATGGCAAAGAC. Our result confirmed that PC4 directly activate c-Myc transcription through BS1 by EMSA (Figure 5K). In addition, the protein and mRNA level of PC4 has no significant influence after c-Myc stable knockdown (Supplemental Figure 5A and 5B). Indiation, we conducted c-Myc overexpression experiment in PC4 knockdown cell lines by the specific plasmid (Supplemental Figure 6A) to prove that c-Myc was responsible for the oncogenic functions of PC4. As expected, c-Myc overexpression rescued the apoptosis (Supplemental Figure 6B, 6D and 6E) and cell proliferation inhibition (Supplemental Figure 6C). The results of the above experiments indicated that PC4 regulated c-Myc transcription to perform its oncogenic function. The potential mechanism of PC4 in diffuse large B-cell lymphoma was shown in Figure 6