The aim, design and setting of the study
Data collection and analysis are important components of research. In this line, this case-control study involved 235 cases (with methamphetamine dependence (SUD) and 204 gender-matched controls (healthy individuals). In our study, SUD is recognized by the 11 criteria. The 11 criteria are divided into four categories of behavior, such as impaired control, social impairment, risky use and pharmacological indicators (tolerance and withdrawal) related to the substance use (Table 1) [25, 26].
Table 1
11 criteria for substance use disorders (SUD).
Num | Categories of behaviour | Criteria for Substance Use Disorders (SUD) |
1 | Impaired control | Used larger amounts or longer: Taking the drug in greater quantities or over prolonged periods of time. |
2 | Repeated attempts to control use and/or quit: Wanting to cut or avoid using the substance, but they haven't been successful. |
3 | Much time spent using: Spending a lot of time to get, using, or recover from substance using. |
4 | Craving: Cravings and encourages the substance to be used. |
5 | Social impairment | Activities given up to use: Not able to do what you can do at home, at work, or at school that you once liked because of substance use. |
6 | Social or interpersonal problems related to use: Continuing to use, even though it creates issues in your relationships or conflicts with others. |
7 | Neglected major roles to use: Giving up and refusing to perform significant social, occupational or recreational functions as a result of substance use. |
8 | Risky use | Hazardous use: Using substances again and again, including though you or others are in danger. |
9 | Social or interpersonal problems related to use: Continuing to use, even though you know that you have a physical or psychological condition which may have been triggered or exacerbated by the substance. |
10 | Pharmacological indicators | Tolerance: Need more substance to have the effect you like. |
11 | Withdrawal: Development of withdrawal symptoms and signs of withdrawal, which can be eased by taking more of the substance. |
The PICK1-rs713729, PICK1-rs2076369 and BDNF-rs6265 genotypes were analyzed by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) assay. Subsequently, statistical analysis was performed, using SPSS 20.0 (IBM Inc., Chicago, IL, USA), PHASE 2.1.1 program as well as SNP Analyzer 2.0.
Table 1: 11 criteria for substance use disorders (SUD).
The Characteristics Of Participants
Study population and clinical data
This study was performed in accordance with the Declaration of Helsinki (1964) and its subsequent amendments. Moreover, approval was obtained from the local Ethics committee of Mashhad University of Medical Sciences (IR.MUMS.fm.REC.1394.421), 439 blood samples were collected from 204 controls and 235 cases from Mashhad, Iran from 2015 to 2018. After explaining the study objectives, a written informed consent was obtained from all participants. A questionnaire was used to collect demographic and other essential information from all participants (Table 2). The selection procedure included confirmed urine test (addiction test) and also the availability of complete patient’s follow-up data. Moreover, healthy, individually matched on age were recruited from the Health Examination Centre, who were receiving routine medical examinations.
Table 2
Demographic and clinical characteristics of controls and methamphetamine dependence (SUD).
Variable | Controls | Methamphetamine dependence (SUD) | P-value |
Gender | Female | 38.9% | 35.7% | P < 0.001 |
Male | 68.1% | 64.3% |
Age | 31.96 (8.44 ± 0.58) | 38.91 (9.11 ± 0.68) | P = 0.423 |
Marriage status | Married | 56.7% | 43.4% | P < 0.001 |
Separated | - | 11.6% |
Widow | - | 4.2% |
Divorced | 1.1% | 20.6% |
Single | 42.1% | 20.1% |
Table 2: Demographic and clinical characteristics of controls and methamphetamine dependence (SUD).
Description Of Materials
Blood collection and DNA extraction
For DNA extraction, approximately 10 millilitres (ml) of peripheral blood was obtained from each participant and immediately subdivided into tubes containing sterile ethylene diamine tetra acetic acid (EDTA) [27]. DNA extraction from whole blood was extracted using salting-out technique. Then, the extracted DNA was quantified by the ratio of absorbance at 260 nanometres (nm) and 280 nm (A260/280) via BioTek™ Epoch™ Microplate Spectrophotometer (Winooski, VT, USA,) as well as via gel electrophoresis and finally stored at -20 °C until used.
Target Single Nucleotide Polymorphisms (snps) Determinations (marker Selection)
In this study, the SNPs were selected using available SNPs data bases and published articles. Such articles were examined intron and exon SNPs, which might alter the affinity of PICK1-rs713729, PICK1-rs2076369 and BDNF-rs6265 to methamphetamine dependence (SUD) (Table 3). Moreover, potential functional SNPs were included in order to meet the following criteria: minor allele frequency (MAF) > 0.05 (5%), heterozygosity > 0.15 (15%) and also validated SNPs in articles and databases. Furthermore, in order to inhibit redundancy in SNPs genotyping, SNPs that are not located in strong linkage disequilibrium (LD) were chosen.
Table 3
The investigated polymorphisms characteristics in this study.
Rs number | Gene | Protein | Position | Exon/ Intron | Variant length | Allele | Function | Haplotype distance (bp) |
rs713729 | PICK1 | Non-coding | 22:38059462 | Intron 3 | 1 | T > A | Intron variant | 8183 |
rs2076369 | PICK1 | Non-coding | 22:38067645 | Intron 4 | 1 | T > G | Intron variant |
rs6265 | BDNF | NP_001137277.1:p.Val66Met | 11:27658369 | Exon 4 | 1 | C > T | Missense | - |
Table 3: The investigated polymorphisms characteristics in this study.
Genotyping
To determine the genotype frequency of PICK1-rs713729, PICK1-rs2076369 and BDNF-rs6265 an ARMS-PCR method was used. Specific primers for PCR amplification were designed via web tools, such as Primer1 and also WASP (web-based allele-specific primer designing tool) [28].
PCR amplifications for PICK1-rs713729, PICK1-rs2076369 and BDNF-rs6265 were conducted in a 10–15 microliter (µl) volume per reaction, containing 3 µl Taq 2x master mix (Ampliqon, Germany), 10 µM of each primer and 100 nanogram (ng) DNA. Moreover, the specific primers used to detect PICK1-rs713729, PICK1-rs2076369 and BDNF-rs6265 SNPs are listed in Table 4. For PICK1-rs2076369, we also used Betaine (Ampliqon, Germany) as an enhancer in PCR.
Table 4
Primer sequences used for genotyping in ARMS-PCR.
SNPs | Primers | Sequences | Primer Length | PCR products |
rs6265 | FO | CTACAGTTCCACCAGGTGAGAAGAGTG | 27 | 400 |
RO | ATGGACATGTTTGCAGCATCTAGGTA | 26 |
FI© | TGGTCCTCATCCAACAGCTCTTCTATaAC | 29 | 253 |
RI(t) | TTGGCTGACACTTTCGAACcCA | 22 | 201 |
rs713729 | FO | CTTTCTAGCGGAATCCCGACTGTG | 24 | 407 |
RO | CAGTGAAAAAGCAAACCAGGACACTG | 26 |
FI(a) | CTTCTCATTCTTGAGGTCTGACCCACA | 27 | 196 |
RI(t) | AGGTGGTCAGAAAGCCCCTCAGA | 23 | 265 |
rs2076369 | FO | CATGTTGCCCAAGCTGGTCTCAAACTC | 27 | 299 |
RO | CTGGACACCCGTAACTGCTCTGACC | 35 |
FI(g) | AGGAGTCTCAGTCCAGAACAGTCTTGACG | 29 | 191 |
RI(t) | CTCCACACCCTGAGCCCCTTCTCA | 24 | 165 |
FOP: Forward outer primer; FIP: Forward inner primer; RIP: Reverse inner primer; ROP: Reverse outer primer. |
The ARMS-PCRs condition for each primer is as follows, Table 5. In general, initial denaturation at temperature 94 °C for five minutes, then 35 cycles including denaturation at 94 °C for 25 seconds, annealing at alternative °C for 25 seconds (based on each primer), an elongation at 72 °C for 30 seconds followed by 72 °C for seven minutes as the final elongation step (Table 5).
Table 5
The ARMS-PCRs condition for targeted SNPs was as follows.
| | First Denaturation | 35 cycles | Last extension |
SNPs | Primers | Tm | Min | Denaturation | Annealing | Extension | Tm | Min |
| | Tm | Min | Tm°C | Min | Tm | Min |
rs6265 | FO | 94 °C | 7 min | 94 °C | 30 s | 61.5 | 25 s | 72 °C | 45 s | 72 °C | 7 min |
RO |
FI© |
RI(t) |
rs713729 | FO | 61 | 30 s | 30 s | 5 min |
RO |
FI(a) |
RI(t) |
rs2076369 | FO | 64 | 25 s | 30 s | 5 min |
RI(t) |
FI(g) | 67 | 30 s |
RO |
FOP: Forward outer primer; FIP: Forward inner primer; RIP: Reverse inner primer; ROP: Reverse outer primer; TM: Temperature; Min: Minute; S: Seconds; °C: Centigrade; |
The DNA fragments of PCR products via the absence or presence of bands unique for mutant or wild primers were detected, using electrophoresis in 2.5-3% agarose gel by ultraviolet (UV) trans illuminator (Gel Doc; U:Genius).
Table 4: Primer sequences used for genotyping in ARMS-PCR.
Table 5: The ARMS-PCRs condition for targeted SNPs was as follows.
Statistical analysis
A Hardy–Weinberg equilibrium (HWE) method was used to evaluate the differences in data for statistical significance. HWE assumption was investigated by the Pearson χ2 distribution with 1 degree of freedom. Allele and genotype frequencies were calculated, and the differences between groups were evaluated by Chi-squared tests. Then, the association between methamphetamine, risk factors and alleles/genotypes was evaluated by binary logistic regression, estimating Odds ratios (ORs) and also 95% confidence intervals (CIs). Three logistic regression models were used to analyse the SNPs, using different genetic models (additive, dominant, and recessive). For the analysis of SNP-SNP interactions, an adjusted logistic regression model was used to estimate the multiplicative interaction effect of the SNPs, located on the same haplotype. P-value= 0 < 0.05 was considered to be statistically significant. SPSS 20.0 (Inc., Chicago, IL, USA), PHASE program as well as SNP Analyser 2 software were used for further statistical analysis [29].
Haplotype Analysis
Haplotypes were generated and assembled from the genotyped data by PHASE program, to reconstruct haplotypes, and SNP Analyzer 2 software [29, 30]. In the present study, P-values of less than 0.05 were considered to be statistically significant. Moreover, Bonferroni correction was also used to account for multiple testing; thus, a two-tailed P-value < 0.016 (=0.05/3 SNPs) was considered to be statistically significant in the present study.