Hyaluronic acid combined with Centella asiatica extract improve skin barrier function and alleviate inflammatory damage via JAK/STAT3 signaling pathway

doi:10.21203/rs.3.rs-4266642/v1

Download PDF

Research Article

Hyaluronic acid combined with Centella asiatica extract improve skin barrier function and alleviate inflammatory damage via JAK/STAT3 signaling pathway

https://doi.org/10.21203/rs.3.rs-4266642/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

Psoriasis, as a chronic inflammatory skin disease, has complex pathogenesis, stubborn condition and high recurrence rate. Centella asiatica (L.) Urban (CA) is one of the commonly used Chinese herbal medicines in dermatology, which has multiple pharmacological activities such as promoting wound healing, anti-cell proliferation and anti-inflammation. Hyaluronic acid (HA) has become an excellent moisturizing ingredient and is widely used in skin care products. This study aims to explore the effects and mechanism of HA combined with CA on skin inflammatory injury and provide experimental basis for the future application research of HA and CA in inflammatory skin diseases.

Methods

In this study, the skin barrier repair function and the mechanisms of HA combined with CA were evaluated. The expressions of inflammatory factors and barrier related factors were detected in LPS-induced HaCaT cells. The effects on the migration and angiogenesis ability were analyzed in VEGF- induced HUVECs.

Results

HA with different molecular weights increased the contents of GSH and SOD in LPS-induced HaCaT cells, eliminated free radicals, reduced the production of ROS, and inhibited cell oxidative stress. Among them, HA with molecular weight of 6100Da was the best, followed by 1220KDa HA. It was found that the molecular weight of 1220KDa HA effectively inhibited IFN-γ mRNA level, increase the content of AQP3 and FLG in cells. Mechanism research showed that HA inhibited inflammation was related to block the transduction of NF-κB and JAK/STAT3 pathways. Meanwhile, 1220KDa HA (2 mg/mL) combined with ethyl acetate of CA (CAE, 25 µg/mL) could effectively inhibit the expression of MMP-1 in LPS-induced HaCaT cells, increase the expression of skin barrier related proteins AQP3 and FLG, and reduce the secretion of IL-17. HA combined with CAE enhanced the inhibition of NF-κB and JAK/STAT3 pathways, improving the inhibitory effects of CAE on IFN-γ and IL-6. In addition, after the intervention of HA combined with CAE, the migration and the angiogenesis abilities of VEGF-induced HUVEC cells were decreased.

Conclusion

HA combined with CAE can reduce release of inflammatory factors and improve the function of skin barrier via the inhibition of NF-κB and JAK/STAT3 pathways, alleviating psoriasis like inflammatory damage.

Psoriasis

hyaluronic acid

Centella asiatica

inflammation

skin barrier function

Psoriasis is a skin disease that is influenced by heredity, diet, environment, and other factors. Its primary pathological features include the excessive proliferation of keratinocytes, infiltration of inflammatory cells, and neovascularization ^{[1, 2]}. Janus kinase (JAK) plays a crucial role in cytokine-mediated signal transduction, facilitating the phosphorylation of signal transduction and activator of transcription (STAT). STAT is a DNA-binding protein that binds with downstream target genes to regulate cell proliferation, apoptosis, and differentiation. The STAT family consists of 7 members, with STAT3 being closely associated with psoriasis ^[3]. IL-6 primarily mediates the phosphorylation of STAT3, leading to the excessive proliferation of keratinocytes, the accumulation of T cells in the epidermis, heightened inflammation, and involvement in the onset and progression of psoriasis ^{[4, 5]}. The STAT3 pathway can be indirectly activated by Th17 cells, leading to the promotion of IL-17 expression and forming a network cycle ^{[6, 7]}. Therefore, JAK/STAT3 pathway has become one of the important targets of psoriasis treatment.

Recent research indicates that the alteration and impairment of factors associated with skin barrier function are significant pathological mechanisms in psoriasis. Filaggrin (FLG), a fundamental protein abundantly present in the epidermis, plays a crucial role in maintaining the skin's structure. Moreover, the breakdown products of silk fibroin demonstrate remarkable benefits in terms of skin hydration, moisture retention, protection against UV radiation, regulation of cytokine production, and defense against bacterial invasion ^{[8, 9]}. Aquaporin 3 (AQP3) is a crucial membrane transport protein that plays a significant role in the proliferation, differentiation, and migration of keratinocytes. It is also involved in epidermal wound healing and barrier repair ^{[10, 11]}. In patients with psoriasis, the level of AQP3 decreases in psoriatic lesions and the surrounding areas, resulting in reduced hydration ability. This decrease in AQP3 may be a crucial factor contributing to skin dehydration in psoriasis patients ^[12].

Hyaluronic acid (HA) is a natural, non-branched polymer composed of repeated D-glucuronic acid and N-acetyl-D-glucosamine disaccharide units. It is a polysaccharide that exists in the human body and exhibits good biocompatibility without causing any immune response. Due to these properties, HA finds extensive applications in the fields of medicine, daily necessities, food, and healthcare. Moreover, it is currently recognized as the most effective natural substance for moisturization ^{[13, 14]}. Centella asiatica (L.) Urban (CA) is a folk herb commonly used to treat various ailments such as scalp itching, tonsillitis, acute hepatitis, lupus erythematosus, and wound healing ^[15–17]. Dermatological research has explored the use of CA in skincare. Studies have evaluated the moisturizing and anti-inflammatory abilities of cosmetic formulations containing varying concentrations of CA extract, demonstrating its effectiveness in improving skin moisture ^{[18, 19]}。In a previous study, we systematically evaluated the effects of different polar extracts of CA on skin oxidative stress, inflammation, and barrier function using an LPS-induced HaCaT model ^[20]. The results demonstrated that the ethyl acetate extract of CA (CAE) exhibited strong free radical scavenging ability and effectively reduced excessive ROS production in LPS-induced HaCaTs.

Based on the literature research and experimental basis, we propose the hypothesis that HA can improve skin moisture, maintain skin moisture, and enhance skin barrier function, while CAE can improve cell oxidative stress, regulate cell inflammation and abnormal differentiation. The combination of HA and CAE is expected to have a more effective role in alleviating psoriatic skin damage. To verify this hypothesis, this project will specifically focus on the repair effect of HA and CA on psoriasis by examining the skin barrier function and STAT3-mediated cell inflammation. The findings of this study will provide a theoretical basis for further research and development of HA and CA, as well as offer new insights for the prevention and treatment of psoriasis using traditional Chinese medicine.

Cell and samples

Human keratinocyte cell (HaCaT) was purchased from HAKATA cell bank. Human umbilical vein endothelial cell (HUVEC) and the ethyl acetate extract of Centella asiatica (CAE) were provided by the Biosynthesis and Pharmaceutical Research Office of Jiangnan University. Different molecular weight HA was provided by Shandong Focusfreda Biotech Co., Ltd, the molecular weight was approximately 6100 Da, 180 kDa, 340 kDa, 1220 kDa, respectively.

Cell culture and treatment

HaCaT cells were cultured in DMEM (Dulbecco's Modified Eagle's Medium) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and in a thermostatic incubator containing 5% CO₂ at 37℃. When the cell density reached 80%, HaCaTs were induced by lipopolysaccharide (LPS, 20 µg·mL^− 1) and treated with samples for 24 h. In the same way, HUVEC cells were cultured in endothelial cell medium (ECM) (containing 5% FBS, 1% penicillin-streptomycin and 1% endothelial cell growth supplement) and stimulated by VEGF165 (200 ng·mL^− 1) and samples.

CCK-8 assay

HaCaT cells in good growth condition were seeded in 96-well plate with 1.2×10⁴ cells per well. When the density was about 80%, cells were synchronized with serum-free medium for 12 h. And then treated with HA (0.5, 1, 1.5, 2, 2.5 mg·mL^− 1) for 24 h. After treatment, each well was replaced with 10% CCK8 solution and incubated for 1.5 h. The absorbance was measured at 450 nm and the toxicity of different molecular weight HA to HaCaT cells was calculated.

Determination of ABTS free radical scavenging capacity

HaCaT cells in good growth condition were seeded in 90 mm plate with 3×10⁶ cells. After cell synchronization, HaCaTs were induced by LPS (20 µg·mL^− 1) and treated with different molecular weight HA groups (20 µg·mL^− 1 LPS + 2 mg·mL^− 1) for 24 h. The cells were collected and lysed with precooled PBS. According to the total antioxidant capacity assay kit with 2,2-azino-bis-3-ethylbenzothiazolin-6-sulfonic acid (ABTS) method (S0119, Beyotime Biotech. Inc., China), the absorbance was measured at 734 nm. The total antioxidant capacity of different molecular weight HA was calculated according to the standard curve.

Determination of intracellular GSH and SOD content

HaCaT cells were seeded in 90 mm plate with 3×10⁶ cells. After cell synchronization, HaCaTs were induced by LPS (20 µg·mL^− 1) and treated with different molecular weight HA groups (20 µg·mL^− 1 LPS + 2 mg·mL^− 1) for 24 h. For SOD content detection, the cells were collected by scraping and lysed using sonication for 1h under ice bath conditions. And in GSH content detection, cells were mixed with a protein removal reagent solution and lysed using the repeated freeze-thaw method. The supernatants were collected and used to determine the contents of SOD and GSH by following the manufacturer's instructions of kits (S0101S and S0052, Beyotime Biotech. Inc., China).

Determination of ROS production

HaCaT cells were seeded in 24-well plate with 8×10⁴ cells. After cell synchronization, HaCaTs were induced by LPS (20 µg·mL^− 1) and treated with different molecular weight HA groups (20 µg·mL^− 1 LPS + 2 mg·mL^− 1). After 24 h treatment, the cells were incubated with 10 µM DCFH-DA solution for 40 min in a CO₂ incubator. The reaction between ROS and DCFH-DA produced dichlorofluorescein (DCF), which emits green fluorescence. Fluorescence microscopy (Nikon, TS2-S-SM) was used to capture images of the different groups.

Detection of cytokine content by ELISA

HaCaT cells were seeded in 24-well plate with 8×10⁴ cells. After cell synchronization and treatment, cell supernatants were collected and centrifuged at 7500 rpm for 10 min. According to the manufacturer's instructions, the levels of psoriasis related factors IL-17 and IFN-γ were calculated using enzyme-linked immunosorbent assay (ELISA) kits (Absin, China).

RT-PCR

HaCaT cells were seeded in 90 mm plate with 3×10⁶ cells. After cell synchronization and treatment, the cells were lysed by Beyozol reagent (R0011, Beyotime Biotech. Inc., China). According to the manufacturer's instruction, the RNA was dissolved by DEPC water. The RNA quality was detected by OD260/OD280 ratio. RNA (3 µg) was reverse transcribed to cDNA and subjected to RT-PCR. The results were normalized to the level of GAPDH and calculated using the ImageJ software. The primer sequences were shown in Table 1.

Table 1

Primer sequence of PCR amplification
Primer	Sequence (5' to 3')	molecular weight/bp
TNF-α	F: TGCTCCTCACCCACACCATCAG R: TCCCAAAGTAGACCTGCCCAGAC	240
IFN-γ	F: GCTGACGGTGGACCTATT R: CAAGTCGTTCATCGGGAG	240
FLG	F: AGGCAAAAAGGTCAATCAGG R: CCAAACGCACTTGCTTTACA	373
MMP-9	F: CATCCGGCACCTCTATGGTC R: CATCGTCCACCGGACTCAAA	230
GAPDH	F: ATCAGCAATGCCTCCTGCAC R: TTCCCGTTCAGCTCAGGGAT	242

Western blot

HaCaT cells were seeded in 90 mm plate with 3×10⁶ cells. After cell synchronization and treatment, the cells were collected and lysed by RIPA buffer containing phosphatase inhibitors. The protein concentration was detected by enhanced BCA protein assay kit (P0010, Beyotime Biotech. Inc., China). SDS-PAGE gel was configured for protein separation, and the protein was transfer to the PVDF membrane. The membranes were blocked with 5% bovine serum albumin for 1 h, and incubated with primary antibodies overnight at 4°C. The membranes were blocked with 5% bovine serum albumin for 1 h, and incubated with primary antibodies overnight at 4°C. Next, the membranes were washed with TBST three times and then incubated with the second antibody for 1 h at room temperature. Finally, the protein expression was visualized by the ECL system and gel imaging system. The total gray level of each band is quantified by Image J software and the results were normalized to that of GAPDH.

Evaluation of cell migration ability of HUVECs

The Culture-Inserts (2 well, Cat. No. 81176) were fixed on 24-well plate, and HUVEC cells in logarithmic growth phase were seeded into the insert at a density of 2.5×10⁵ cells/mL, with 70 µL per well. HUVECs were induced by VEGF165 (200 ng·mL^− 1) and treated with HA + CAE (2 mg·mL^− 1+25 µg·mL^− 1), resveratrol was used as the control drug group. After 8h, the cell migration was observed and analyzed by light microscope.

Evaluation of HUVEC cell lumen formation ability

On the day before the cell experiment, the Matrigel (BD-356231) was melted overnight at 4°C. The 96 well plate and pipette tips were precooled in advance. 50 µL per well Matrix adhesive was added to the precooled 96 well plate (operated on ice). The 96 well plate was fixed in the incubator containing 5% CO₂ at 37℃ for 30 min. HUVEC cells were seeded at a density of 1×10⁴ cells per well in 96 well plate covered with matrix adhesive. After 8h treatment, HUVEC cell lumen formation was observed, and the length of the tube and the number of junctions were analyzed by Image J software.

Statistical analysis

The data were expressed as the mean ± standard deviation. The data were analysed using GraphPad Prism 8.0 (GraphPad, California, USA). Comparisons between the two groups were performed by One-way ANOVA, with p < 0.05 considered as statistically significant.

Antioxidant capacity of different molecular weight HA

The cytotoxicity test results of different molecular weight HA on normal HaCaT cells were shown in Fig. 1A. In the concentration range of 0.5–2.5 mg/mL, HA did not exhibit any significant cytotoxicity on HaCaT cells. However, at a concentration of 2.5 mg·mL^− 1, HA had a slight impact on cell viability. Therefore, for subsequent cell experiments, a concentration of 2 mg/mL will be used. As shown in Fig. 1B, compared to the normal group, the free radical scavenging capacity of ABTS was decreased by 34.1% in LPS (20 µg·mL^− 1) induced HaCaTs. Meanwhile, the intracellular SOD and GSH contents significantly decreased (p < 0.01). As expected, the cell antioxidant capacity increased with the intervention of 6100Da and 1220KDa HA, with 6100Da HA being the most effective. 6100Da HA could increase the content of SOD by nearly 2 times. And both 6100Da and 1220KDa HA enhanced the GSH content to the normal level.

Effect of HA on ROS production in LPS-induced HaCaT cells

The excessive accumulation of ROS surpasses the body's ability to generate antioxidants, leading to the production of inflammatory factors and the induction of oxidative stress in cells. Results from ROS fluorescence photography (Fig. 1E) demonstrated a significant increase in green fluorescence of cells in the model group compared to the normal group, indicating that LPS (20 µg·mL^− 1) increased the level of oxidative stress in HaCaT cells. Following treatment with different molecular weight HA, the fluorescence intensity decreased to varying degrees, and the effects of 6100Da and 1220KDa HA were better.

Effects of HA on the mRNA levels of inflammation and skin barrier related factors in LPS-induced HaCaT cells

Locally produced TNF-α and IFN-γ in psoriasis patients amplifies and maintains the inflammatory process by stimulating the release of various psoriasis-related factors. As shown in Fig. 2A, after LPS induction, the mRNA levels of TNF-α and IFN-γ were increased to varying degrees, especially the expression of TNF-α mRNA was significantly increased. Compared to the model group, high molecular weight HA could slightly regulate TNF-α mRNA expression. Meanwhile, as the molecular weight of HA increased, the effect of HA on IFN-γ mRNA exhibited significant inhibitory effects (p < 0.001).

A large number of free radicals will further induce the production of Matrix metalloproteinase (MMPs), thus promoting the degradation of collagen, which will lead to the damage of skin barrier. At the same time, the decrease in FLG expression can affect the formation of natural moisturizing factors, which is an important reason for the decrease in skin moisture content and increase in transdermal dehydration in psoriasis patients. As shown in Fig. 2B, LPS induction significantly increase the level of MMP-9 mRNA and inhibit FLG expression in HaCaT. Following treatment different HAs, the above situation improved. Compared to the model group, HA with molecular weights of 6100Da and 180KDa significantly inhibited MMP-9 mRNA expression. And 6100Da and 1220KDa HA had the significant impact on FLG expression and could effectively increase FLG mRNA levels.

Effects of HA on the expression of skin barrier related protein in LPS-induced HaCaT cells

To comprehensively analyze the regulatory effects of different molecular weight HA on skin barrier function, we examined the effects of HA on barrier related protein expression. Similar to the result of Fig. 2B, HA could improve LPS induced MMP-1 and FLG protein expression abnormalities. AQP3 is mainly expressed in Keratinocyte and skin fibroblasts, participates in skin hydration and barrier functions, and plays an important role in skin damage, repair and healing, which is an important guarantee for the maintenance of normal skin morphology and function. As shown in Fig. 3A, after LPS induction, the expression of AQP3 protein in HaCaT significantly decreased. After HA intervention with different molecular weights, except 180 KDa HA, the other three molecular weights of HA could effectively improve the level of AQP3 protein, of which 1220 KDa HA is the best.

Effects of HA on NF-κB pathway in LPS-induced HaCaT cells

IL-6 can promote the excessive proliferation of Keratinocyte and recruit T Cell migration to migrate to the epidermis, thus causing inflammation in the epidermis. The increase of IL-6 levels in the skin and serum can be one of the pathogenesis characteristics of psoriasis. As shown in Fig. 3B, after LPS induction, NF-κB expression significantly increased and promoted IL-6 expression. However, 6100Da and 1220KDa HA could effectively decrease NF-κB expression.

Based on the above results, we found that LPS could successfully induce the inflammatory injury model of HaCaT by activating NF-κB signaling pathway promotes the release of inflammatory factors and inhibits the expression of barrier related proteins. HA could inhibit cellular inflammation to varying degrees, with a molecular weight of 1220KDa having the best effect. Meanwhile, 1220KDa HA also increased the content of FLG and AQP3, improving skin barrier function. Therefore, a molecular weight of 1220KDa HA will be used in combination with CAE for subsequent experimental research.

HA combined with CAE improved skin barrier related protein expression

In this study, 2 mg·mL^− 1 1220KDa HA was used to prepare CAE (25 µg·mL^− 1) solution (CAE + HA). As shown in Fig. 4, HA combined with CAE could effectively inhibit the overexpression of MMP-1 in LPS induced HaCaTs. Meanwhile, compared with the monotherapy groups, the combination of HA and CAE could significantly increase the expression of skin barrier related proteins, such as AQP3 and FLG, indicating that HA combined with CAE could inhibit skin dehydration and improve skin barrier function.

HA combined with CAE inhibited NF-κB and JAK/STAT3 signaling pathways

Western blot analyzes of NF-κB and JAK/STAT3 signaling pathways revealed that HA combined with CAE inhibited the activation of NF-κB, and effectively decrease the expression of IL-6, which was similar with the effects of CAE. As expected, the regulation of JAK pathway after combined treatment showed a stronger pharmacodynamic superposition effect. HA combined with CAE enhanced the inhibitory effects on the phosphorylation of JAK1 and STAT3 protein. Based on the aforementioned results, it is hypothesized that the combination of HA and CAE administration primarily inhibits the JAK/STAT3 signaling pathway, suppresses cellular inflammation, and enhances skin barrier function (Fig. 5).

HA combined with CAE blocked the release of IL-17 and IFN-γ

As shown in Fig. 6A, the induction of LPS significantly increased the secretion of IL-17 and IFN-γ (p < 0.01), which have been confirmed to play a role in the immune pathogenesis of psoriasis and other skin diseases. However, the treatment of HA and CAE effectively blocked the releases of IL-17 and IFN-γ. Notably, HA demonstrated an enhanced effect on the inhibition of IFN-γ secretion when combined with CAE.

HA combined with CAE alleviated VEGF-induced HUVECs migration and angiogenesis

Angiogenesis plays a crucial role in the development of skin diseases such as psoriasis and skin tumors. In pathological conditions, the continuous proliferation and migration of vascular endothelial cells can worsen the infiltration of new blood vessels into the body. Figure 6B showed that the migration ability of HUVEC cells improved after VEGF induction (200 ng·mL^− 1), resulting in a decrease in the scratch area. However, when HA was combined with CAE intervention, the migration ability of HUVEC was inhibited, similar to the effect of the positive drug Resveratrol.

According to Fig. 6C, VEGF-induced HUVEC cells exhibited an improved ability to form lumens. The model group exhibited a significant increase in the number of lumen nodes and the length of the common tube (Fig. 6D). However, after the intervention of HA and CAE, the effect was comparable to that of the positive drug Resveratrol. The HA combined with CAE group showed a decrease in the number of lumen nodes and the length of the common tube, indicating an inhibition of the angiogenesis ability of HUVEC.

Psoriasis, a chronic inflammatory skin disease, has complex pathogenesis, stubborn condition and high recurrence rate. Research on psoriasis primarily focuses on the immune system imbalance, chronic neovascularization and excessive proliferation of epidermal cells. Hyaluronic acid (HA) is widely distributed in the intercellular substance of various animal and human tissues, offering unique viscoelastic, permeability, and biocompatibility properties. HA has emerged as an excellent moisturizing ingredient extensively utilized in skincare products. Centella asiatica (L.) Urban (CA) is a commonly used Chinese herbal medicine in dermatology, known for its various pharmacological activities such as promoting wound healing, inhibiting cell proliferation and reducing inflammation ^[15–17]. In this study, we used cell inflammatory injury model and psoriasis mice to explore the effects and mechanism of HA combined with CA on skin inflammatory injury and provide an experimental basis for the future research on the application of HA and CA in inflammatory skin diseases.

HA has been widely used in drug carrier design due to its excellent histocompatibility and biodegradability. Its special moisturizing ability enable HA to create a hydration film at the site of drug release on the skin, serving as a slow-release mechanism for drugs and enhancing the transdermal ability of topical drugs, thereby improving their efficacy. HA's unique chemical structure allows for the grafting of more drug molecules and provides more reaction sites, making it suitable for the construction of prodrugs and the transportation and delivery system of multiple drugs ^[13]. This drug delivery system helps maintain the balance of blood drug concentration, prolongs the drug's half-life, slows down drug release, reduces the required dosage, enhances drug efficacy, and minimizes toxic side effects on human cells. The cylindrical spiral structure of HA molecules promotes water adsorption, creating a hydrophilic region within the spiral column. This efficient water retention effect minimizes water loss and contributes to HA's excellent moisturizing properties. CA, a widely used plant in dermatology, has shown reparative effects on skin ulcers in diabetic rats ^[21]. The ethanol component of CA has been demonstrated to reduce mast cell infiltration in the ear tissue of mice with atopic dermatitis ^[22]. Ratz-Lyko conducted a study evaluating the moisturizing and anti-inflammatory capabilities of cosmetic formulas containing varying concentrations of CA extract. The study demonstrated that cosmetics containing 5% CA extract effectively improve skin moisture ^[18]. Additionally, Bylka et al. conducted a comprehensive review of 31 studies on CA in the context of skin diseases, highlighting its important clinical role in treatment ^[19].

In LPS-induced HaCaT cell inflammatory injury model, different molecular weights of HA could increase intracellular GSH and SOD content, and eliminate excess free radicals and ROS. Among them, HA with a molecular weight of 6100 Da has the best effect, followed by HA with a molecular weight of 1220 KDa. However, HA with molecular weights of 6100Da and 180KDa were not significantly reduce TNF-α and IFN-γ mRNA expression. As expected, HA with a molecular weight of 1220KDa effectively enhance the expression of barrier function related factors (AQP3 and FLG). Through the detection of inflammation-related pathway proteins, it was discovered that HA may inhibit cellular oxidant stress and inflammation by affecting the NF-κB and JAK/STAT3 signaling pathways. The study revealed that LPS effectively induced an inflammatory injury model in HaCaT cells, and different molecular weights of HA showed varying degrees of inhibitory effects on cellular inflammation, with 1220KDa being the most potent. This specific molecular weight of HA also increased levels of FLG and AQP3, thereby enhancing skin barrier function. Consequently, the combination of 1220KDa HA and CAE will be used for further experiments. A solution containing 2 mg·mL^− 1 of 1220KDa HA and 25 µg·mL^− 1 of CAE was used to treat HaCaT cells, leading to the effective inhibition of LPS-induced MMP-1 expression, increased levels of AQP3 and FLG, and reduced IL-17 secretion. Moreover, IFN-γ, a type 2 interferon, was found to enhance cytokine secretion by activating downstream signal transducers and transcriptional activators, thus exacerbating the inflammatory response. Psoriasis patients have shown elevated levels of IFN-γ mRNA. The combination of HA and CAE was observed to inhibit NF-κB and JAK/STAT3 signaling pathways, strengthening the inhibitory effects of CAE on IFN-γ and IL-6.

The pathogenesis of psoriasis has been extensively studied in the fields of genetics and immunity, with a particular focus on vascular hyperplasia. In psoriasis, the microv essels in the dermal papillary layer become dilated, tortuous, and more permeable, leading to an increase in the number of blood vessels. The abnormal distribution and formation of blood vessels are the first pathological changes observed in psoriasis, occurring early in the development of skin lesions even before the epidermal hyperplasia. Studies have shown that the improvement of psoriasis is accompanied by the normalization of vascular structure ^[23]. The microvessels in psoriasis exhibit angiogenesis, characterized by endothelial cell proliferation ^[24]. VEGF, a central regulatory factor in angiogenesis, is significantly increased and its expression is enhanced in psoriasis patients, not only in skin lesions but also in non-skin lesions. It has been reported that VEGF plays a crucial role in the local vascular abnormalities of psoriasis skin lesions ^[25]. Currently, it is believed that the induction of angiogenesis is mainly caused by the disruption of the barrier function of the skin epidermis and hypoxia, leading to the release of keratinocytes and the production of angiogenic growth factors. Understanding the mechanism behind vascular proliferation may contribute to the identification of new therapeutic targets for psoriasis. In the study using a VEGF-induced HUVEC cell model, it was discovered that the combination of HA and CAE effectively inhibits HUVEC cell migration and blocks angiogenesis. Further investigation into the underlying mechanisms is warranted in future research.

In summary, the combination of HA and CAE not only inhibits LPS-induced high expression of MMP-1 in HaCaT cells but also significantly increases the expression of skin barrier-related proteins AQP3 and FLG. This combination reduces IL-17 secretion, enhances the inhibitory effect of CAE on IFN-γ and IL-6, prevents skin dehydration and inflammation, and improves skin barrier function, ultimately alleviating psoriasis-like inflammatory damage.

Declaration of competing interest

The authors declare that there is no conflict of interest.

Funding

This work was supported by the National Natural Science Foundation of China (No. 82004027).

Author Contribution

S.H.Y . wrote the main manuscript text , L.Q and D.S. prepared figures 1-6, all authors reviewed the manuscript.

Mahil SK, Capon F, Barker JN. Update on psoriasis immunopathogenesis and targeted immunotherapy. Semin Immunopathol. 2016;38(1): 11-27.
Lin TL, Chen YJ. Successful treatment with ixekizumab in a guselkumab-resistant psoriasis patient. Dermatol Ther. 2021;34(1): e14585.
Kahn J, Deverapalli SC, Rosmarin D. JAK-STAT signaling pathway inhibition: a role for treatment of various dermatologic diseases. Semin Cutan Med Surg. 2018;37(3): 198-208.
Wang F, Wang M, Wang J, Chen M, Sun S, Yao S, et al. Maresin1 ameliorates sepsis-associated lung injury by inhibiting the activation of the JAK2/STAT3 and MAPK/ NF-κB signaling pathways. Microb Pathog. 2020;148: 104468.
Ge JR, Zhang LL, Wei W. Research status of Janus kinase - signal transducers and activators of transcription signaling pathway in psoriasis. Chin J Clin Pharmacol. 2019; 35(23): 199-203.
Lei K, Wang D, Lin L, Zeng J, Li Y, Zhang L, et al. 2'-fucosyllactose inhibits imiquimod-induced psoriasis in mice by regulating Th17 cell response via the STAT3 signaling pathway. Int Immunopharmacol. 2020;85(13): 106659.
Works MG, Yin F, Yin CC, Yiu Y, Shew K, Tran TT, et al. Inhibition of TYK2 and JAK1 ameliorates imiquimod-induced psoriasis-like dermatitis by inhibiting IL-22 and the IL-23/IL-17 axis. J Immunol. 2014;193(7): 3278-3287.
Kim Y, Lim KM. Skin barrier dysfunction and filaggrin. Arch Pharm Res. 2021;44(1): 36-48.
Stefanovic N, Irvine AD. Filaggrin and beyond: new insights into the skin barrier in atopic dermatitis and allergic diseases, from genetics to therapeutic perspectives. Ann Allergy Asthma Immunol. 2024;132(2): 187-195.
Huang SY, Tu Y, He L, Ji C, Cheng B. Research progress on the relationship between aquaporin 3 and skin barrier. Dermatol Bulletin. 2017;34(04): 383-387+2.
ollag WB, Aitkens L, White J, Hyndman KA. Aquaporin-3 in the epidermis: more than skin deep. Am J Physiol Cell Physiol. 2020;318(6): 1144-1153.
Lee Y, Je YJ, Lee SS, Li ZJ, Choi DK, Kwon YB, et al. Changes in transepidermal water loss and skin hydration according to expression of aquaporin-3 in psoriasis. Ann Dermatol. 2012;24(2): 168-174.
Tao SY, Wang M, Zhai GX. Advances in stimuli-responsive nano drug delivery system based on hyaluronic acid. Chin J New Drugs Clin Rem. 2021;40(4): 1-10.
Liu LT, Wu L, Zeng DL, Yu B. The progress in application of hyaluronic acid for injection. J Practical Dermatol. 2020;13(06): 352-355.
Shen X, Guo M, Yu H, Liu D, Lu Z, Lu Y. Propionibacterium acnes related anti-inflammation and skin hydration activities of madecassoside, a pentacyclic triterpene saponin from Centella asiatica. Biosci Biotechnol Biochem. 2019;83(3): 561-568.
Punturee K, Wild CP, Kasinrerk W, Vinitketkumnuen U. Immunomodulatory activities of Centella asiatica and Rhinacanthus nasutus extracts. Asian Pac J Cancer Prev. 2005;6(3): 396-400.
Somboonwong J, Kankaisre M, Tantisira B, Tantisira MH. Wound healing activities of different extracts of Centella asiatica in incision and burn wound models: an experimental animal study. BMC Complement Altern Med. 2012, 12(1): 92-103.
Ratz-Lyko A, Arct J, Pytkowska K. Moisturizing and anti-inflammatory properties of cosmetic formulations containing Centella asiatica extract. Indian J Pharm Sci. 2016, 78(1): 27-33.2020,13(06): 352-355.
Bylka W, Znajdek-Awiżeń P, Studzińska-Sroka E, Dańczak-Pazdrowska A, Brzezińska M. Centella asiatica in dermatology: an overview. Phytother Res. 2014, 28(8): 1117-1124.
Lin P, Shi HY, Lu YY, Lin J. Centella asiatica alleviates psoriasis through JAK/STAT3-mediated inflammation: An in vitro and in vivo study, Journal of Ethnopharmacology, 2023, 317:116746.
Zhang DD, Zhang H, Zhao JF, Shi XJ, Yang JW, Nie XQ. Treatment of chronic ulcer in diabetic rats with Asiaticosides. Chin Pharm J. 2017;52(8): 643-648.
Lee Y, Choi HK, N'deh KPU, Choi YJ, Fan M, Kim EK, et al. Inhibitory effect of Centella asiatica extract on DNCB-Induced atopic dermatitis in HaCaT cells and BALB/c mice. Nutrients. 2020;12(2): 411-425.
Luo Q, Zhao T, Zhang F, Li W, Lin L, Pan N, et al. Study on the correlation between Angiopoietin-2 and VEGF in patients with psoriasis vulgaris. J Diagn Ther Dermato-Venereol. 2015;22(5): 357-360.
Gong J, Yang H, Qi D, Tang X. The association of serum vascular endothelial growth factor levels and psoriasis vulgaris: a protocol for systematic review and meta-analysis. Medicine (Baltimore). 2020;99(33): e21565.
Feng L, Huang MX, Lei SS, Fang PX, Zhu L. Expression of angiogenesis markers in skin lesions of progressive psoriasis. Shanghai Med J. 2021;44(12): 902-906

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Hyaluronic acid combined with Centella asiatica extract improve skin barrier function and alleviate inflammatory damage via JAK/STAT3 signaling pathway

Status:

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

Introduction

Materials and methods

Cell and samples

Cell culture and treatment

CCK-8 assay

Determination of ABTS free radical scavenging capacity

Determination of intracellular GSH and SOD content

Determination of ROS production

Detection of cytokine content by ELISA

RT-PCR

Western blot

Evaluation of cell migration ability of HUVECs

Evaluation of HUVEC cell lumen formation ability

Statistical analysis

Results

Antioxidant capacity of different molecular weight HA

Effect of HA on ROS production in LPS-induced HaCaT cells

Effects of HA on the expression of skin barrier related protein in LPS-induced HaCaT cells

Effects of HA on NF-κB pathway in LPS-induced HaCaT cells

HA combined with CAE improved skin barrier related protein expression

HA combined with CAE inhibited NF-κB and JAK/STAT3 signaling pathways

HA combined with CAE blocked the release of IL-17 and IFN-γ

HA combined with CAE alleviated VEGF-induced HUVECs migration and angiogenesis

Discussion

Declarations

Declaration of competing interest

Funding

Author Contribution

References

Additional Declarations

Status:

Version 1