Cell culture and co-culture system
All experiments were approved by the Ethics and Research Committee of Nanjing Medical University (Permit Number: 2018 − 190). Informed consent was obtained from all the participants. HAMSCs were obtained from discarded amniotic membrane and HBMSCs were collected from patients undergoing Sagittal Split Ramus Osteotomy (SSRO). Cells were isolated and maintained as reported(16, 17). 3–5 passages cells were used in this study. HAMSCs/HBMSCs transwell coculture system was established according to our previous research(5). After starvation in serum-free medium or LPS (1 µg/mL) for 24 h, HBMSCs were washed with PBS for subsequent experiments.
Quantitative Real-time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
RNA isolation and cDNA transcribing were performed by TRIzol reagent (Invitrogen, New York, NY, USA) and Reverse Transcription Kit (Applied Biosystems, Foster City, CA). RT-PCR was conducted as reported(18). Primer sequences used are listed in Table 1. Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference for estimation of lncRNA and mRNAs, whereas human U6 was used to normalize miRNA. Fold changes in gene expression were determined by the 2−ΔΔCt method.
Table 1
Genes | Sense primer(5’-3’) | Anti- sense primer(5’-3’) |
ALP RUNX2 OCN OSX ANRIL APC 𝛽-Catenin | AGAACCCAAAGGCTTCTTC TCTTAGAACAAATTCTGCCCTTT AGCAAAGGTGCAGCCTTTGT CCTCCTCAGCTCACCTTCTC CCCTAGCTACATCCGTCACCTGA AAAGTGAGCAGCTACCACG AGCTGACAACTTTCACACC | CTTGGCTTTTCCTTCATGGT TGCTTTGGTCTTGAAATCACA GCGCCTGGGTCTCTTCACT GTTGGGAGCCCAAATAGAAA CCACAGCTACATATGCGTTTACA CCTGGAGTGATCTGTTAGTCG AATGGGGATGTTGATCTTC |
Primers used for quantitative real-time reverse transcription polymerase chain reaction. |
Reactive oxygen species (ROS) level and superoxide dismutase (SOD) activity
Flow cytometry was used to determine LPS-induced ROS by measuring intensity of 2’,7’-dichlorofluorescin (DCF) fluorescence as reported(5). The SOD activity was detected using xanthine oxidase assay kit (Jiancheng Corp, Nanjing, China) according to the manufacturer’s instructions(19).
Cell Transfection
Recombinant lentiviruses containing full-length ANRIL, scramble control (NC), targeting ANRIL and scramble control(shNC) were obtained from GenePharma Company (Shanghai, China). Those lentiviruses were named Lenti- ANRIL, Lenti-NC, Lenti-sh ANRIL and Lenti-shNC, respectively. HBMSCs transferred with MiRNA plasmids (Ribobio, Guangzhou, China) were prepared by transfection reagent riboFECTTM CP (Ribobio, Guangzhou, China). The mutated binding sites of miR-125a in luciferase reporter vectors containing APC were constructed by site-directed mutagenesis.
Cell Proliferation Assay
HBMSCs were collected at 1,3 and 5d. Flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA) was performed to determine the cell viability as reported(20). G0, G1, S, and G2 M phases were determined using MODFIT LT 3.2 (Verity Software House, Topsham, ME, USA).
Alkaline Phosphatase (ALP) And Alizarin Red Assay
After 7 days osteogenic inducing, ALP staining and activity was detected using NBT/BCIP staining kit (CoWin Biotech, Beijing, China) and ALP assay kit (Jiancheng Corp, Nanjing, China) as reported(21, 22). Mineralized matrix formation was determined after 14 days osteogenic inducing as reported(23).
Western Blot
Western blot analysis was performed as reported(24). The primary antibodies were: anti-ALP (ab83259) (1:1000),anti-osteocalcin (OCN) (ab133612) (1:1000), anti- Osterix(OSX) (ab209484) (1:1000)( All from Abcam, Cambridge, MA, USA).RUNX2 (D1L7F) Rabbit mAb #12556(1:1000), APC Antibody #2504(1:1000), 𝛽-Catenin (D10A8) XP® Rabbit mAb #8480(1:1000),𝛽-actin (8H10D10) Mouse mAb #3700(1:1000)(All from Cell Signaling Technology ,Danvers, MA,USA).𝛽-actin served as an internal control.
In vivo bone formation assay
Approximately 10 × 104 cells (5 × 104 HAMSCs and 5 × 104 HBMSCsNC/HBMSCsANRIL/ HBMSCsshNC/HBMSCsshANRIL pretreated with LPS) were attached to each HA/TCP biomaterial (Φ5 × H2mm, Sichuan University, Chengdu, Sichuan, China). After 12 hours, the complexes were subcutaneously implanted into the rat mandibular defect area designed as reported (4 female nude rats per group, with an average weight of 280 g)(23). All animal experiments were done in compliance with the regulations and guidelines of Nanjing Medical University institutional animal care.
Micro Computed Tomography (micro-CT) Analysis
Mandibles were harvested for micro-CT analysis after 8 weeks implantation as reported(25). Bone volume ratio (BV/ TV, %) was calculated.
Histological Observation
Mandible samples were harvested and analyzed by hematoxylin and eosin (H&E), Masson trichrome and immunohistochemistry. Primary antibodies against RUNX2 (1:300 dilution) were used for immunohistochemistry as reported(23). Positive areas were observed under the microscope.
Dual-luciferase Reporter Assay
Luciferase assays were performed by Lipofectamine 2000 and Dual Luciferase Reporter Assay System as reported(26).
Immunofluorescence Staining
Primary antibody [𝛽-Catenin (D10A8) XP® Rabbit mAb #8480(1:100), Cell Signaling Technology, Danvers, MA, USA] and DAPI were used to perform immunofluorescence staining as reported(23). Images were captured under the inverted fluorescence microscope (Olympus, Japan).
Statistical analysis
The data are expressed as the mean and standard deviation (SD) of at least three independent samples. p < 0.05 was considered statistically significant using Student’s t-test or ANOVA analysis.