2.1 Cell culture and establishment of an HR model
The current study used a rat alveolar macrophage cell line NR8383 (ATCC, CRL-2192) as an in vitro model in consideration of the important role alveolar macrophage activation plays in the development of LIRI[10]. The cells were maintained in F-12K medium (Thermo Fisher, Waltham, MA, USA) at 37℃ in a humidifed 5% CO2 atmosphere. In addition, the medium contained 10% fetal calf serum. When the cells reached 80% confluence, they were digested with 0.25% trypsin. An HR model of NR8383 cells was established for mimicking lung ischemia-reperfusion injury as described previously[11]. Briefly, the cells were cultured in a humidified incubator with 0.5% oxygen for 6 h for hypoxia treatment, The cells were subsequently moved to a normoxic incubator and cultured for another 6 h as the reoxygenation treatment. The cells normally cultured for the same time length without HR treatment were treated as a normal control (NC) group.
2.2 Knock-down of IRF8 and overexpression of PINK1 by transfection
To down-regulate IRF8 expression, cells were transfected with IRF8 short-hairpin RNA (shRNA) plasmids (sh-IRF8, BioFavor, Wuhan, China) with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) before HR treatment. Meanwhile, negative control plasmids (sh-NC, BioFavor, Wuhan, China) were applied to transfect cells. In addition, transfection of PINK1 overexpression plasmids (OE-PINK1, BioFavor, Wuhan, China) was carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to up-regulate the expression of PINK1 in macrophages before HR treatment. Cells were harvested 48 h after transfection and used for further analysis. The cells normally cultured for the same time length without transfection before HR treatment were treated as an HR group.
2.3 Immunofluorescence
For the identification of macrophages, immunofluorescence was applied. Cells were grown on glass coverslips and fixed with 4% paraformaldehyde for 15 min, washed by PBS thrice, permeabilized in 0.5% Triton X-100 (Beyotime, Shanghai, China) for 20 min, washed by PBS thrice and blocked by goat serum (Boster, Wuhan, China) for 30 min. The cells were then incubated with primary antibodies (anti-CD68, 1:100, Abcam, Cambridge, UK) overnight at 4°C followed by incubation with Cyt3-labeled secondary antibodies (Boster, Wuhan, China) for 1 h in the dark at 37 °C. DAPI (Beyotime, Shanghai, China) was then applied to stain the cell nuclei for 5 min in the dark. The stained cells were observed and photographed under an Olympus microscope (BX53, Olympus, Tokyo, Japan). Identification of macrophages by immunofluorescence was shown in Figure 1A with cells observed to expressed CD68, a surface marker of macrophages.
2.4 Cell Counting Kit-8 (CCK8) assay
Cell proliferation was determined using the CCK8 (Beyotime, Shanghai, China) assay according to the manufacturer's protocol. The cell suspension was inoculated in a 96-well plate (100 μl/well). Meanwhile, blank wells were filled with equal amount of PBS. The plate was cultured overnight in a humidified incubator with 5% CO2 in air at 37℃. Next, the CCK-8 solution was added (10 μl/well), and the plate was cultured at 37℃ for 4 h. Finally, the Multiskan MK3 microplate reader (Multiskan MK3, Thermo Fisher, Waltham, MA, USA) was employed to measure the optical density values at the wavelength of 450 nm (OD450).
2.5 Lactate dehydrogenase (LDH) assessment
LDH release, an index that reflects cell damage, was assessed by LDH assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to manufacturer’s protocol. Briefly, the cell supernatant was mixed with supplied assay buffer and absorbance readings were obtained at the wavelength of 450 nm (OD450) using the Multiskan MK3 microplate reader (Multiskan MK3, Thermo Fisher, Waltham, MA, USA). The LDH activity was presented as fold changes compared to control absorbance.
2.6 Enzyme linked immunosorbent assay (ELISA)
The cytokine levels in the supernatant were measured using commercial ELISA kits (TNF-α and IL-1β ELISA kits, USCN, Wuhan, China; IL-6 and IL-10 ELISA kits, Elabsicence, Wuhan, China) following the instructions.
2.7 Quantitative real-time PCR (qPCR)
Total RNA from NR8383 cells were prepared by using TRIzol (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions and then reversely transcribed to cDNA with the Hiscript Reverse Transcriptase (Vazyme, Nanjing, China). The resulting cDNAs were quantified by qPCR with Taq Plus DNA Polymerase (Tiangen, Beijing, China) according to the manufacturer’s instructions. Real-time PCR was performed using SYBR Green Master Mix (Vazyme, Nanjing, China) on the QuantStudio 6 RT-PCR system (QuantStudio 6, ABI, Waltham, MA, USA), and mRNA expressions were normalized to GADPH expressions and fold changes were calculated by the 2-ΔΔCq method. Sequences of primers were as follows:
Name
|
Forward(5’-3’)
|
Reverse(5’-3’)
|
Size
|
Rat GAPDH
|
ACAGCAACAGGGTGGTGGAC
|
TTTGAGGGTGCAGCGAACTT
|
253 bp
|
Rat PINK1
|
GACCGCTACCGCTTCTTCCG
|
TCTCCTCGATCAGCCCCAAC
|
148 bp
|
Rat PRKN
|
GGCTGTGGGTTCGTTTTCTG
|
GGCTTGGTGGTTTTCTTGAT
|
176 bp
|
Rat IRF8
|
GTCACGGAGATGGAGTGTGG
|
CTGGGATAAGGCTGAATGGT
|
216 bp
|
2.8 Western blot
Cell lysates were subjected to SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skim milk in TBST for 2 h and then incubated with diluted (1:1000) primary antibodies against LC3 (Affinity Biosciences, OH, USA), PINK1 (ABclonal, Wuhan, China), Parkin (Abcam, Cambridge, UK), IRF8 (Thermo Fisher, Waltham, MA, USA) and GAPDH (Goodhere, Hangzhou, China) overnight, washed with TBST, followed by being stained with anti-rabbit or anti-mouse IgG (Boster, Wuhan, China). Immunoreactivity was visualized by enhanced chemiluminescence kit (ECL kit, Applygen, Beijing, China). Band quantification was performed by densitometry analyses using Image J software (National Institutes of Health, USA).
2.9 Transmission electron microscopy
Autophagy was marked by the emergence of autophagy flux, represented by emerging autophagosomes evidenced by transmission electron microscopy (TEM). Thus, TEM was applied for observation of autophagosomes. Briefly, the cell mass were fixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer at 4°C for 2 h. After fixation and dehydration, ultrathin sections (60-80 nm) were obtained. All the sections were stained with lead citrate and uranyl acetate followed by detection under an FEI microscope (FEI Tecnai G20, FEI, Hillsboro, OR, USA).
2.10 Double immunofluorescence labeling
Mitophagy initiation was determined based on the increased co-localization of mitochondria and PINK1 proteins. Therefore, detection of mitophagy was performed by double immunofluorescence labeling method. Cells were incubated with MitoTracker® Deep Red FM (Yeasen, Shanghai, China) at 37 ˚C for 30 min for mitochondrial labeling. Cells were then grown on glass coverslips and embedded in paraffin. Specimens were incubated overnight at 4 ˚C and stained for PINK1 (anti-PINK1, ABclonal, Wuhan, China) immunofluorescence. An FITC-labeled secondary antibody (Boster, Wuhan, China) was employed as the secondary antibody for PINK1. The cell nuclei were then stained with DAPI (Beyotime, Shanghai, China) for 5 min in the dark. Sections were examined and photographed using an Olympus microscope (BX53, Olympus, Tokyo, Japan).
2.11 Statistical analyses
Statistical analyses were performed with the GraghPad Prism 7 software (GraphPad, San Diego, CA, USA). Measurement data were expressed as means ± SD. One-way analysis of variance (ANOVA) was applied for analyses of differences among multiple groups. Differences with P<0.05 were considered statistically significant.