The aim of the present study was to investigate the persistence of HCV RNA in both serum and peripheral blood mononuclear cells at 12 and 24 weeks of treatment of Egyptian CHC patients with DAAs.
Study design: observational prospective study
This study was carried out after the approval of the Ethical Committee of Medical Research Institute. A signed informed consent was obtained from all patients enrolled in the study. This study included seventy-five CHC patients selected from the outpatient clinic of the Medical Research Institute, Alexandria University.
Criteria of patients' selection: According to the national protocol of treatment of CHC in Egypt, they were positive for HCV antibody and HCV RNA before treatment. They were treated with (Sofosbuvir 400 mg & Daclatasvir 60mg daily for 12 weeks) and had negative serum HCV RNA at week 12 (end of treatment). All patients were eligible and fulfilling the criteria for treatment with DAAs and followed up for 12 weeks of treatment & 12 weeks after treatment. Exclusion criteria included patients with Child B class liver cirrhosis, platelets < 150000/mm3, uncontrolled diabetes mellitus (HbA1C> 9%), renal impairment (e GFR < 60%), HCC, except 6 months after intervention aiming at cure with no evidence of activity by dynamic imaging (CT or MRI), extra hepatic malignancy except after 2 years of disease free interval, pregnancy or inability to use effective contraception and those with hepatitis B virus or human immunodeficiency virus infection.
All patients were subjected to complete history taking, thorough clinical examination, Ultrasound abdomen, laboratory investigation including; Renal function tests, fasting blood sugar, Liver enzymes, liver function test and complete blood picture were done for all patients before the start of therapy.
Serum sample samples were collected from patients and Reverse transcriptase polymerase chain reaction (RT-PCR) for HCV-RNA was done at 0, 12, and 24 weeks of the treatment. PBMCs were separated from blood samples by Ficoll and used for the detection of HCVRNA at weeks 12& 24 of therapy.
Blood was collected from the patients after overnight fasting in a 10 mL tube. 5 ml were used for serum serum separation and aliquoted to be stored at -20°C. the other 5 mls were used for the separation of PBMC and collected into heparin containing tubes. Immediately after collection, the cells were separated from whole blood by centrifugation on a Ficoll-Hypaque density gradient. Aliquots of 10 6 PBMC was pellet and stored at -80oC. [16]
A) Quantitative detection of HCV RNA by reverse transcriptase PCR (RT-PCR) from serum (At 0, 12, 24 weeks of treatment). [17]
HCV specific RNA was extracted from serum samples (140 μL) using QIAamp viral RNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Tenml of extracted HCV-RNA was amplified using HCV Qiagen kit (Artus, QS-RGQ (72) ref. 4518366 HCV PCR kit). Real time PCR was performed with the Mx3000P TM (Stratagene) real time PCR system. The procedure included; first, incubation at 50°C for 30 min to transcribe viral RNA to cDNA by RT , AmpliTaq gold activation for 95° C for 10 min, then 40 cycles of two PCR-step amplification, denaturation for 95° C for 15 sec, Lastly, annealion and extension at 50° C for 1 min and 72 ° C for 30 min respectively. The fluorescence detection was then performed.
B) Qualitative detection of HCV RNA from PBMC [18, 19]
HCV RNA extraction was performed from106 PMNC cell preparation using Gene JET RNA purification kit (Thermo Scientific) following the manufacturer’s protocol. Tenml of extracted HCV-RNA was amplified using My Taq one step RT PCR Kit which is formulated for highly reproducible first strand cDNA synthesis and subsequent PCR in a single tube. The samples were amplified by Veriti™ 96-Well Thermal Cycler.
HCV was amplified using the following primers:
P1 (KY 78) 5'CTCGCAAGCACCCTATCAGGCAGT-and
P2 (KY 80) 5'GCAGAAAGCGTCTAGCCATGGCGT amplifying a 245 base pair fragment. Reaction mixtures were subjected to the following thermal profile: Reverse Transcription step for 20 minutes at 45oC and one cycle of Polymerase activation step for 1 minutes at 95oC.followed by Forty cycles of denaturation at 95oC for 10 seconds, annealing at 60oC for 10 seconds and extension at 72oC for 30 seconds. Amplified Samples were then analyzed using 2% agarose gel electrophoresis.