Isolation and Molecular Identification of Foot and Mouth Disease Virus Circulating Around Central Ethiopia

doi:10.21203/rs.3.rs-436692/v1

Download PDF

Research

Isolation and Molecular Identification of Foot and Mouth Disease Virus Circulating Around Central Ethiopia

https://doi.org/10.21203/rs.3.rs-436692/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Foot and mount disease (FMD) is a highly contagious, economically and politically significant transboundary animal disease which specifically affects all cloven-hoofed animals; cattle, pig, goat, sheep and many wild artiodactyls. Five of the seven (O, A, C, SAT1, SAT2, SAT3 and Asia 1) serotypes of FMD virus (O, A, C, SAT1, SAT2) are endemic in Ethiopia; however, limited information on the current FMDV status and the circulating serotype is available in the country. Therefore, this study was conduct to isolate and molecularly identify the FMD viruses using a panel of virological detection assays. Methods: An outbreak-based cross-sectional study was conducted in Addis Ababa and Bishoftu during 2013 and 2014 to isolate and to molecularly identify the circulating serotype of FMDV. A total of 20 samples were collected from clinically infected cattle and pigs during the outbreak and virus isolation and molecular serotype identification was carried out at the National Veterinary Institute (NVI), Bishoftu Ethiopia. Cells were monitored for cytopathic effects (CPE) daily and frozen when CPE were developed. Serotyping of FMD viruses were made by applying classical PCR from cell cultures showing CPE.

Results: All tested samples showed cytopathic effect (CPE) on BHK-21 cell culture and serotype O was identified using PCR. The DNA bands were visualized to the expected sizes.

Conclusions: Based on these result, a continuous understanding of the molecular epidemiology of the disease along with the proper vaccination matching for the circulating serotype; O is critical for implementation effective control and prevention programs eventually for the eradication of the disease.

Virology

BHK-21 cell culture

FMD virus

PCR

Outbreak

Serotype

Table 1. Universal FMDV7 forward for screening and a primer used for the reverse transcription–PCR (RT-PCR) for identification of FMDV serotype O viruses: the concentration and the temperature used for this procedures.

PCR	Primers	Sequence		Reference
Classical PCR	F Primer-FMDV7universal-forward 5pm/μl	5’GCCTGGTCTTTCCAGGTCT3’		[16].
Classical PCR	R Primer-FMDV7 universal-reverse-5pm/μl	5’CCAGTCCCCTTCTCAGATC3’		[16].
RT-PCR	O-1C244F	5’ GCAGCAAAACACATGTCAAACACCTT3’
RT-PCR	EUR-2B52R.	5’ GACATGTCCTCCTGCATCTGGTTGAT 3’
		Temperature	Time	Cycle
	Initial denaturation	95^oC	2 min	1cycle
	1^st denaturation	95^oC	1 min	30 cycle
	Annealing	58 ^oC	50 seconds
	Elongation	70 ^oC	2 min
	Final elongation	72^oC	10 min	1cycle

Table 2. Serotype O FMDV was identified by using Classical PCR from cell culture positive tissue samples in bovine and swine species in and around Bishoftu and Addis Ababa during 2013/2014

Sampling areas	Species	No. of samples examined.	Tissue culture(CPE positive)	FMDV (positive) by using Classical PCR	Serotype O
Bioshoftu	Bovine	4	4	4	4
Bioshoftu	Swine	3	3	3	3
Total		7	7	7	7
Addis Ababa	Bovine	1	1	1	1
Addis Ababa	Swine	4	4	4	4
Total		5	5	5	5

Download PDF

Version 1

posted

You are reading this latest preprint version

Isolation and Molecular Identification of Foot and Mouth Disease Virus Circulating Around Central Ethiopia

Status:

Version 1

Abstract

Figures

Full Text

Tables

Status:

Version 1