Isolation and culture of rTDSCs
All experiments complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No.8023, revised 1978), all experimental protocols were approved by the ethics committee of Zunyi Medical University (Zunyi, China). Six male 6-week-old Sprague-Dawley rats weighing 200-250g were provided and fed by the animal laboratory. The bilateral Achilles tendon tissues of the rat were excised and minced, digested with type I collagenase (3 mg/ml Sigma-Aldrich, St Louis, MO, USA) at 37°C for 2.5 h, and passed through a 70 µm cell filter (Becton Dickinson, Franklin Lakes, NJ, USA) to generate an rTDSC single-cell suspension. Then, the suspension was resuspended in Dulbecco's Modified Eagle's Medium containing 100U/ml penicillin, 100mg/ml streptomycin, 10% foetal bovine serum, and 2mM glutamine (HyClone, Logan City, Utah, USA). The isolated rTDSCs were diluted to an appropriate density (50 cells/cm2) and cultured at 37°C under 5% CO2 to form clones. After 2 days, the cells were washed twice with Phosphate-buffered saline (PBS) to remove nonadherent cells. After 7 days, the cells were digested with trypsin and were considered P0 cells; then, the P0 cells were passaged to P2, and P2 passage cells were used for all experiments. The identification of stem cell characteristics of rTDSCs was performed as described previously [29]. rTDSCs were seeded in 6-well plates at a density of 6×104/well and induced with 0, 0.1, or 1.0 ng/ml IL-6 (REIL P-06011, Cyagen Biosciences Inc., Santa Clara, CA, USA) for 5 or 7 days. The STAT3 inhibitor Stattic was added to cells at a concentration of 50 μM to inhibit STAT3.
Lentivirus transfection
The wnt5a-shRNA recombinant lentiviral vector was provided by BioWit Technologies Co., Lt-d (Shenzhen, China). The shRNAs were embedded in a lentiviral vector containing green fluor-escent protein (GFP) and cotransfected into 293T cells, and the lentivirus titre was 3×109 infe-ctious units per mL. Wnt5a-cDNA (BioWit Technologies Co., Ltd, Shenzhen, China) was intr-oduced into the lentiviral vector pLVX-r wnt5a-mCMV-Zs Green as the overexpression vector, and the lentivirus titre was 1×109 infectious units per mL. The pLvx-mCMV-ZsGreen vector was used as a scrambled control (cDNA control). The shRNA sequences targeting Wnt5a wereas follows: forward: 5′-CTTTTTTCTCGAGGGATCCCAATTCTAGTTATTAATAGTA-3′, reverse:5′-ATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAG-3′.The cDNA sequences targetin-g Wnt5a were as follows: forward: 5′-TAATAAAAGCTAATTCTTGGTGGTCCCTAAGTATGAATAA-3′, reverse: 5′-CCCTGTTCAGATGTCAGAAGTATACATCATAGGAGCACAG-3′. rTDSCswere seeded in 6-well plates overnight at a density of 1×105 per well. When the cells reache-d 50% confluency, lentiviruses were added. After 48 h of transfection, the medium was replace-d with normal medium, and IL-6 was added 4 days later. The lentiviral transfection efficiencywas determined by real-time PCR (RT-PCR) and Western blot.
Alkaline phosphatase staining
rTDSCs were induced with IL-6 at concentrations of 0.1 ng/ml and 1 ng/ml for 7 days. After IL-6 induction, the rTDSCs were washed twice with PBS and then fixed with 4% paraformaldehyde and NBT/BCIP (Sigma-Aldrich, St. Louis, MO, USA) solution at room temperature for 30 minutes. rTDSCs were observed and photographed under a microscope (Olympus BX51, Tokyo, Japan).
Real-time PCR
rTDSC gene expression was determined by RT-PCR. Total RNA was extracted with TRIzol Re-agent (Takara, Dalian, China) and subjected to reverse transcription PCR. RT-PCR was perfor-med using the Bio-Rad iCycler IQ system (Bio-Rad, CA, USA). GAPDH was used as an inte--rnal reference, and the relative expression levels were calculated by using the 2−Δ∆Ct method.The primer sequences (Table 1) were used.
Table1
Sequence of the primers used for quantitative RT-PCR
Accession no
|
Gene name
|
Primer sequence
|
NM_017008.4
NM_022631.1
NM_001278483.1
NM_ 013059.1
NM_ 012943.1
|
GAPDH
Wnt5a
Runx2
Alpl
Dlx5
|
Forward: 5′TGACTTCAACAGCAACTC3′
Reverse: 5′TGTAGCCATATTCATTG3′
Forward:5′AATTCGTGGACGCACG3′
Reverse:5′GCCAGCATGTCTTGAGG3′
Forward:5′GAACTCAGCACCAAGTCCTTT3′
Reverse:5′CAGTGTCATCATCTGAAATACG3′
Forward:5′GGCACCATGACTTCCCAGAA3′ Reverse:5′CACCGTCCACCACCTTGTAAA3′
Forward:5′CTTATGCGGACTACGGCTACGC3′ Reverse:5′CCTGGGTTTACGAACTTTCTTTG3′
|
Western blotting
Total protein from rTDSCs was collected with RIPA buffer. The protein concentrations were determined using a BCA protein analysis kit (Thermo Fisher Scientific Inc.). Protein samples (30 μg/lane) were separated by SDS-polyacrylamide gel electrophoresis and transferred to a polyethylene difluoride membrane. The membranes were incubated with 0.1% TBS-Tween containing 5% skimmed milk powder for 1 h at room temperature, and then the primary and secondary antibodies were added in sequence. Finally, the bands were visualized using a Li-Cor Odyssey Imager (LI-COR Biosciences, Lincoln, NE, USA). The following primary antibodies were used: anti-STAT3 (1:1000; ab68153, Abcam, Cambridge, UK), anti-STAT3 (phospho Y705; 1:1000; ab76315, Abcam, Cambridge, UK), anti-Wnt5a (1:500; ab110073, Abcam, Cambridge, UK), anti-Runx2 (1:1000; ab23981, Abcam, Cambridge, UK), GAPDH (1:1000; Pierce Biotechnology, USA), and anti-β-tubulin (1:1000; loading control; Pierce).
Statistical analysis
SPSS 17.0 statistics software was employed for statistical analysis (SPSS Inc., Chicago, IL, USA). All data are presented as the means ± SD (x±s), α=0.05. Student’s t-test was applied when only two groups were compared, and P <0.05 was considered to indicate a statistically significant difference.