Variation in phytochemical properties and expression of key genes involved in biosynthesis of hypericin using nano-capsulated and normal hormones in Hypericum perforatum L

doi:10.21203/rs.3.rs-445326/v1

PDF

Research Article

Variation in phytochemical properties and expression of key genes involved in biosynthesis of hypericin using nano-capsulated and normal hormones in Hypericum perforatum L

https://doi.org/10.21203/rs.3.rs-445326/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 03 May, 2021

You are reading this latest preprint version

Hypericum perforatum is a valuable medicinal plant with anti-depressant activity. Hypericin is the major compound responsible for such activity. In the present study, the effect of four nano-capsulated hormones of 2,4-epibrassinolide, spermidine, salycilic acid and cycocel were investigated on the amount of hypericin based on HPLC analysis in two locations (Saman and Isfahan). For each hormone, the normal form was also compared with nano form. The expression patterns of the key genes (Hyp-1, pks1, pks2) for hypericin production was also evaluated using qRT-PCR. Moreover, GC-MS analysis was also performed for determination of the compounds in studied treatments. The major compounds were germacrene D (3.29–33.53%), β-caryophyllene (0-4.08) and α-longipinene (0-24.05%). In most cases, nano-hormones led to increase in these components. Significant changes were obtained in expression of key genes in hypericin synthesis as a result of nano-hormones treatments in Isfahan site. Overall, nano-hormones revealed higher increase in expression of all genes as compared with normal hormones in this site. The expression of Hyp-1, Pks1 and Pks2 was significantly increased using spermidine, 24-epibrassinolide and cycocel in Isfahan location in both nano-hormones and normal ones, while the expression of Hyp-1 was decreased in SA treatment in Isfahan location. Based on HPLC analysis, hypericin ranged from 0.21 in control to 0.51 mg 100 g^− 1 DW in nano-SA in Isfahan site. Finally, the expression of the key genes were mostly elevated in colder climates and nano-form formulation.

Plant Physiology and Morphology

Plant Molecular Biology and Genetics

Biotechnology and Bioengineering

Hypericum

Hypericin

St. John's Wort

nano-capsulated hormones

gene expression

HPLC

GC-MS

The secondary metabolites play an important role in human life. Many of these metabolites have been considered as key components for healing materials for pharmaceutical purposes (Bielecka et al., 2021). One of the most critical compound that is widely used as antidepressant agent is hypericin, hyperforin and their derivatives (Košutha et al., 2011). These compounds are obtained from a medicinal plant named Hpericum perforatum L. (St. John’s Wort). More than 400 species have been determined in Hypericum genus (Nürk et al., 2013). Different activities has been reported for Hypericum species including antioxidant, anti-cancer, anti-depressive and anti-viral activities (Sotak et al., 2016).

The biosynthesis of secondary metabolites can be regulated by different elicitors. The chemical ones often induce by upregulating their biosynthetic genes in related pathways (Kianersi et al., 2020). Some plant hormones can act as elicitors. Jasmonic acid (JA), salicylic acid (SA), ethylene are the most relevant ones. Nowadays, some new hormones such as epi- brasinosteroids, polyamines, have been considered as new potential chemical elicitors for changing the secondary metabolites and their related genes (Ali et al., 2008). Salicylic acid is considered as an important signal molecule in different plant species (Shahim-Ghalecheh et al., 2017).

Nowadays, the development of nanoparticulate compounds is one of the most important topics in pharmaceutical and food researches to improve their efficiency and functions (Preetz et al., 2008). The use of nanotechnology in agricultural products could play a crucial role for improving agrochemical delivery and nutrient management (Sasson et al., 2020). Among these agrochemicals, nano-hormones production is a novel subject that has not yet been fully performed. Some plant hormones are not efficient based on the treatment and experimental conditions. Furthermore, the use of nano-hormones might affect the metabolites or other health benefit compounds in plants in an efficient way. There are several reports regards the effect of normal hormones on valuable metabolites of plants including salicylic acid for thymol (Mohammadi et al., 2019), 24-epibrassinolides for lavandin in Lavandula intermedia (Aras Asci et al., 2019), cycocel in sage and peppermint (Keltawi and Croteau, 1986). The use of plant hormones and other elicitors for increasing of hypericin, hyperforin have been reported in some literatures (Shakya et al., 2019; Cirak et al., 2020). However, the use of nano-hormones have not yet reported for increasing of metabolites in plants. Besides the importance of hypericin, the essential oil components of Hypericum species were of great importance in the previous literatures (Pirbalouti et al., 2014; Seyis et al., 2020).

Nowadays, the study of the expression of key genes involved in biosynthesis of valuable compounds in medicinal plants is of great value for finding the mechanisms involved in their pathways as well as finding the way to increase such metabolites (Gharibi et al., 2019). In this regard, some valuable researches have been performed in some medicinal plants including Achillea pachycephalla (Gharibi et al., 2019), Chrysanthemum morifolium (Hodaei et al., 2018), Ocimum basilicum (Rezaei et al., 2020).

There are some key genes are responsible for producing of hypericin, hyperforin in Hypericum including hyp-1 (hypericin), pks1 (Polyketide synthase), pks2 (Polyketide synthase) (Fig. 1). Moreover, there are some reports regards the effect of plant hormones and other treatments on expression of major genes in Hypericum including gamma ray irradiation (Azeez et al., 2017), salycilic acid (Shahim-Ghalecheh et al., 2017), jasmonic acid (Amirnia et al., 2017). However, there are no reports regards the effect of nano hormones and their efficiency on hypericin production as well as the expression of the important genes (hyp-1, pks1, pks2) underlying in biosynthesis of hypericin. Moreover, besides the previous publications regards the essential oil composition of this plant, there is no report in respect to the effect of nano-hormones on essential oil components of Hypericum.

So, the goal of the present study were to assess the nano-hormones of 2,4-epibrassinolides, spermidine, salycilic acid and cycocel effects on essential oil composition based on GC-MS, hypericin amount using HPLC analysis and to evaluate the effect of these nano-hormones on expression of three major genes in hypericin production including hyp-1, pks1, pks2.

2.1. Plant materials

In this research, one genotype belonging to Hypericum perforatum L. species was cultivated in two sites in Isfahan (Goldaru company research farm, Isfahan) with the average temperature of 10°C and humidity 47% and Saman (Saedegh Abad research farm, Chaharmahal and Bakchtiari) with the average temperature of 17°C and humidity 32%. The species was determined by Dr. Hamze Shirmardi using Flora Iranica (Rechinger, 1963). The herbarium specimen number was 1966 and the sample was deposited in Charmahal and Bachtiari research center. The study was in compliance with relevant institutional, national and international guidelines and conservation policy of endangered plants. The seeds were sown into 17 ×15 cm pots on 25 February 2019. Pots contained soil with the ratio of 3:1 soil to sand. All treatments were performed in three replicates.=

2.2. Preparation of nanocapsulated hormones

Nanocapsulation was performed according to the method reported by Lagno et al. (2010) using controlled deposition of aluminum phosphate coatings. For this purpose, Xanthan (1%) were diluted in dd H₂o and 80 mg of aluminum sulfate were dissolved in distilled water (Lagno et al., 2010). The size of nano particles was determined using Zeta sizer instrument model Malvern ZEN 3600 (UK). The protocol for nano formulation in each hormone is described as follows.

2.2.1. Salycilic acid

Firstly, 47.22 µl from salycilic acid (14mM) was mixed with 1L distilled water. Then, it was shaken in a stirrer to obtain a clear solution. The resulted solution was kept in 4°C refrigerator.

2.2.2. 2, 4-Epibrassinolide (10 ^− 3 mM): Firstly, 0.48gr of 24-epibrassinolide was diluted in 1 liter of distilled water. Then, it was shaken in a stirrer to obtain a clear solution. The resulted solution was kept in 4°C refrigerator.

2.2.3. Cycocel (1.5 gr)

1.5g of cycocel hormone were mixed with 1L distilled water. Then, it was shaken in a stirrer to obtain a clear solution. The resulted solution was kept in 4°C refrigerator.

2.2.4. Spermidine (5mM)

For this purpose, 793 µl of spermidine hormone were mixed with 1L distilled water. Then, it was shaken in a stirrer to obtain a clear solution. The resulted solution was kept in 4°C refrigerator.

2.2.5. Nano hormone protocol

After preparation of each hormone in their concentrations, 15–30 ml of each hormone along with 100ml of xanthan (1%) were mixed and homogenized using an Ultraturax (model 1KA Brasile) instrument with 21000 rpm. Then, aluminum sulfate solution added gently until crosslink occurred for 5min. The nanocapsulated solutions were kept in a -70°C for 24 hours. Finally, nanocapsulated hormones were transported to freeze dryer (Model Christ X2-HLD Plus Germany) for 48h and desiccator (Model 200, Simax) for further experiments (Ghodrati and Ataie Kachouei., 2019).

2.3. Experimental conditions and treatments

In this experiment one genotypes was evaluated in two sites of Isfahan and Saman. Four hormones were used for treatments in two forms of normal and nano- hormones including spermidine (5 mM) (S.din), 2,4-epibrassinolide (10^− 3 mM) (), salicilic acid (SA) (14mM) and cycocel (1.5g)). Spray method in 25°C and 17% moisture content was applied for treatments.

2.4. Essential oil extraction

For essential oil extraction the aerial parts were harvested at the flowering stage in studied samples. The plants were dried in shade and 25°C for six days. The dried samples subjected to hydro-distillation in Clevenger apparatus for five hours based the methods used by Tohidi et al. (2017).

2.5. GC-MS analysis

GC-MS analysis was done for detection of oil components. For this purpose, the aerial part of Hypericum samples was subjected to a Hewlett-Packard 6890 gas chromatograph (Agilent Technologies, Palo Alto, CA, USA) equipped with HP-5MS 5% phenyl methyl siloxane capillary column (30 m length, 0.25 mm diameter; film thickness 0.25 µm) as well as an Agilent 5975 (Agilent Technologies, Palo Alto, CA, USA) as GC–MS/FID detection coupled with 70 eV electron impact ionization over a mass range of 39–400 m/z. Helium was applied as a carrier gas source in the column at a constant flow rate of 2 mL min^− 1 in split mode 1:20 employing the following cycles: 60°C for 3 min; raising at rate of 3.0°C min^− 1 to 120°C; and enhancing at rate of 15°C min^− 1 to 300°C and held for 5 min. The oven temperature was initially maintained at 60°C for 4 min and subsequently, elevated to 260°C at the rate of 4°C /min. Retention indices (RI) were determined with C5–C26 alkane standards as reference. Finally, they were confirmed by a comparison of their mass spectra with those recorded in the NIST 08 (National Institute of Standards and Technology), Willey275.L (ChemStation data system), and those reported in the literature (Adams, 2007).

2.6. HPLC analysis for hypericin

2.6.1. Extract preparation

The aerial parts of treated samples with nano-hormones were harvested at flowering stage. The harvested parts were shade dried at 25°C, and the plant materials were ground and prepared for extraction. Methanol was extracted using 20 gr of the dried samples. The extract was shaken using 500 mL of methanol with 150 rpm at 25º C for 72h. Then, the extracts were filtered through 0.45 µm membrane (Millipore, Merck, Germany). Finally, the extracts were evaporated at room temperature (25˚C) and dried in desiccators. After filtration, the samples were kept at 4°C for HPLC analysis.

2.6.2. HPLC analysis

The Hypericum extracts were analyzed using HPLC system (model Agilent 1090). The HPLC elution method has been used previously by Sarfaraz et al. (2021). Hypericin (Sigma-Aldrich 56690) was used as reference compound. A 0.22 µm nylon acro-disk filter and 20 µL of the extract were used for injection. The stationary phase had a 250 mm × 4.6 mm (5 µm) symmetry C18 column (Waters Crop., Milford, MA, USA) (10 mm × 4 mm I.D.), and the mobile one included 0.1% formic acid in acetonitrile (flow rate of 0.8 mL min^− 1) with the wavelength between 200–400 nm. The gradient conditions were also performed as follows: a linear step from 10–26% solvent B (v/v) for 40 min, 65% solvent B for 70 min, and finally to 100% solvent B for 75 min. The hypericin concentration was calculated based on the peak areas and their retention times. Finally, the amount were calculated based on mg /100 g of the sample dry weight.

All reagents were analytical grade (Sigma–Aldrich, USA) and the solvents used for HPLC were from Merck (Germany).

2.7. Gene expression analysis

2.7.1. Extraction of total RNA

The extraction of total RNA was performed using RNA isolation kit (Dena Zist Asia Co., Iran). The quantity of RNA was measure by a Pico200 (Picodrop, UK) spectrophotometer. Putative DNA contamination was removed using DNaseI (Promega, USA), and then a cDNA synthesis kit was used to reverse transcription (Vivantis Technologies Co., Malaysia). Conserved sequences of three major genes for hypericin production viz. -hyp-1, pks1, pks2 were identified in the GenBank database and online ExPASy software. The primer design was performed using Oligo ver. 5 software. The primer sequences are illustrated in Table 1.

Table 1

Primer sequences of the hypericin biosynthesis genes and the housekeeping gene (actin) used for qRT-PCR.
Target genes	Primers F/R	Product size (bp)	Annealing temperature
primer name	Sequence (5'->3')
Hyp-1-F	TGAAGGTGATGTGTTGCGTG	111	58
Hyp-1-R	GGCTTGGGATGATAGGAGACTG	111	58
PKS1-F	TGTACGTCTCATCCAGTGAGC	121	61
PKS1-R	ACACCACCGTAACAGCCTAAG	121	61
PKS2-F	TACACAAGGAGACACCCAAGC	218	61
PKS2-R	GGAACTGGCAACATAGCATCC	218	61
18s-F	AAACGGCTACCACATCCAAG	247	58
18s-R	CAACCCAAAGTCCAACTACG	247	58

2.7.2. cDNA synthesis and qRT-PCR

The expression of key genes in hypericin production was assessed using quantitative real-time PCR in four nano-hormones and four normal ones according to those explained in treatments part. The expression was assessed by Step One Plus™ Real-Time PCR System (Applied Biosystems). A total volume of 10 µL reaction was applied including 1 µL of cDNA, 5 µL of 2× SYBR Green Master Mix (Takara Bio Co., Germany), 0.5 µL of each primer (10 pmol). The real time PCR was 30 s at 95°C, followed by 40 cycles of 5 s at 95°C and 30 s at 60°C. The specificity of the products was confirmed by Melting curves. The expressions amounts were measured by the simple formula viz. 2^−ΔΔCt. Finally, beta-actin as the reference gene and three technical replicates was applied.

2.8. Statistical analysis

The data were subjected to analysis of variance according to the model of completely randomized design, followed by Fisher’s (protected) least significant difference (LSD, P ≤ 0.05) test, using SAS v9 software (SAS Institute). Correlation coefficients were calculated using the SPSS program (version 16; SPSS Inc., Chicago, IL., USA).

3.1. Gene expression

Significant changes were obtained in expression of key genes in hypericin synthesis as a results of nano-hormones treatments in Isfahan site (Fig. 2). As a result, Transcription of the gene Hyp-1, Pks1 and Pks2 was significantly increased using spermidine, Breassinosteroid and cycocel in Isfahan location in both nano-hormones and normal ones, while the expression of Hyp-1 was decreased in SA treatment in Isfahan location (Fig. 2). Among the hormones, cycocel led to the highest elevation in gene expression of all studied genes in Isfahan site. Overall, nano-hormones revealed the higher increase in expression of all genes as compared with normal hormones in this site.

Saman site has the colder climate in comparison of Isfahan and the results in this site showed a different trend for applied hormones. Despite to the Isfahan site, the highest expression of Hyp-1 was obtained when the SA treatment was applied, while the lowest was belonged to spermidine treatment. Similar trend was also obtained for two other genes. In all treatments, except for cycocel the nano-hormones showed higher expression in comparison with normal hormones. Among treatments, nano salicylic acid showed higher effect on expression of Pks2 in comparison with others.

3.2. Hypericin content

According to data analysis, amount of hypericin revealed high variation as a result of different treatments (Fig. 3). In Isfahan site, the increase in hypericin content was obtained as a result of all treatments in comparison with control. In most cases nano- hormones elevated hypericin content except for nano-SA (Fig.). The highest and the lowest increase was observed in cycocel and SA hormones, respectively. However, some differences were attributed to the locations used in this research. In Saman location higher increase was observed in hypericin content as it can probably due to colder climate in this site in comparison with Isfahan site.

There are some reports regards the use of elicitors or plant growth regulators for increasing the hypericin content (Yamaner and Erdag, 2013; Azeez et al., 2017). Small amount of hypericin (0.21–0.51 mg 100 g^− 1 DW) was obtained in this research, however the amount was in the range of some previous researches such as Azeez et al. (2017). The use of treatments in the seedlings of in vitro culture can lead to increase the hypericin content. In another similar research, the use of SA led to elevate the hypericin content from 0.25 to 0.80 mg 100 g^− 1 DW in two other Hypericum species viz. H. hirsutum L. and H. maculatum (Coste et al., 2011). Higher amount of hypericin in most of nano- hormones treated samples might be due to higher absorbance efficiency of nano-hormones in the leaf tissues of Hypericum plants.

Treatment with biotic or abiotic elicitors has been considered as an efficient strategy to increase the secondary metabolites (Coste et al., 2011). Among these elicitors, plant growth regulators (PGR_S) play a crucial role for enhancing the metabolites (Walker et al., 2002). The mechanism of PGR_s and other elicitors is affecting the expression of secondary metabolic pathways as a defense strategy (Qian et al. 2006; Coste et al., 2011).

As illustrated in Fig. 1, PKS, Polyketide synthase; Hyp-1, phenolic oxidative coupling protein are two major key enzymes for production of Hypericin. In the present research, the related genes were applied for study of gene expression. Elicitation is considered as a major strategy for elevation of hypericin by increasing in expression of these genes. Different elicitors have been used for improvement of hpericin including jasmonic acid (Walker et al., 2002), Chitosan (Valleta et al., 2016) and Salicilic acid (Gadzovska et al., 2013), however in the present research, four nano- hormones were applied for studding the hypericin content along with the key genes expression manner. The comparison of expression patterns and hypericin content in site 1 showed similar trends in most cases. As a result, hypericin and expression of hyp-1 gene elevated by nano-hormones application except for nano-cycocel. The second location showed a different trend for some treatments (Fig. 2,3). The differences of two locations regards the expression and hypericin content might be attributed to the temperature of studied locations. Yao et al. (2019) revealed that the lower temperatures (15°C) can lead to increase in both pks and hyp-1 genes expression that is in line with the results of this research in most cases. Previous reports also highlighted the cold stress as an effective factor for changing the secondary metabolites in plants (Yao et al., 2019). The interesting result in the present study was the very high degrees of up regulation of hyp-1 gene in nano-cycocel treatment. Another hypothesis regards higher accumulation of hypericin in nano-hormone treatments is higher absorbance efficiency of nano-forms in plant tissues in comparison with normal ones (Miranda-Villagómez et al., 2019). So, the application of nano elicitors can provide new insides for production of valuable metabolites with high efficiency.

3.3. Essential oil composition

The effect of nano-hormones and normal ones were compared on essential oil composition of H. perforatum aerial parts. The GC-MS analysis revealed high range of compounds in two hormone types (Table 2). As a result, the major compound was Germacrene D and ranged from 3.29% in Saman with nano-brassinostreoid (B-10^− 3-N) treatment to 33.53% in Isfahan and S.din-5-N treatment. Most of samples revealed the elevation in this compound as compared with control. Overall, in most cases Isfahan showed higher amount of germacrene D in comparison with Saman. Moreover, in most cases Nano-hormones in most cases led to increase in germacrene D content (Table). Another major component in this research was alpha-amorphene that was ranged from 0% in some samples to 24.05% in B-10^− 3-N of Saman. Alpha-longipinene as another major component varied from 0–10.4% in C-1.5-N. Moreover, beta-selinene ranged from 0–9.62% in B-10^− 3-N of Isfahan. Delta-cadinene ranged from 1.4% in SA-14 of Isfahan to 4.52% in S.din-5-N of Saman. Trans-caryophyllene also ranged from 0–4.08% in B-10^− 3 of Saman. The changes in other compounds are illustrated in Table 2.

Table 2

Essential oil composition of Hypericum samples under normal and nano horomones.
Treatments		control		B-10-3**		B-10-3-N		C-1.5		C-1.5-N		S.din-5		S.din-5-N		SA-14		SA-14-N
Compounds	RI*	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman
α-Thujene	924	-	-	0.16	-	0.14	-	0.1	-	-	-	0.14	0.14	-	-	0.3	-	0.04	-
α-Pinene	932	8.77	-	12.57	-	4.88	-	8.28	-	3.44	-	18.89	16.74	4.28	0.17	18.11	-	2.36	-
camphene	948		-	-	-	-	-	-	-	-	-	0.08	0.08	-	-	-	-	-	-
Ethyl 3-hydroxybutanoate	949	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.12	-
3-Methylnonane	965	1.14	-	1.53	-	0.50	0.09	1.27	0.1	0.68	0.22	2.34	2.34	0.73	-	3.5	-	0.64	0.12
Sabinene	972	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.11	-	-	-
β-Pinene	976	4.35	-	4.92	-	2.10	-	3.8	-	1.52	-	7.99	6.48	2.5	-	9.11	-	1.21	-
β-Myrcene	989	0.47	-	0.49	-	0.25	-	0.42	-	0.2	-	0.85	0.85	-	-	0.93	0.56	0.17	-
α-Phellandrene	1008	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.06	-
α-Terpiene	1016	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.06	-
para-Cymene	1024	-	-	-	-	0.14	-	-	-	-	-	-	-	-	-	-	-	-	-
Limonene	1028	0.4	-	0.33	-	0.18	-	0.31	-	-	-	0.62	0.62	-	-	0.59	-	0.14	-
(Z)-βeta-Ocimene	1035	0.44	-	0.77	-	0.60	-	0.74	-	0.49	-	0.65	0.65	1.38	-	1.27	-	0.53	-
Benzeneacetaldehyde	1045	0.87	-	2.2	-	1.51	-	2.16	-	1.34	-	1.29	1.29	3.74	-	3.4	-	1.29	-
(E)-β-Ocimene	1048	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.13	-
gama-Terpinene	1024	0.11	-	-	-	0.16	-	0.11	-	-	-	0.16	0.16	-	-	0.18	-	0.08	-
2-Methyldecane	1060	1.22	-	1.84	-	0.76	-	1.9	0.12	1.12	0.26	1.62	1.62	0.79	0.2	3.61	-	1.13	0.13
β-Thujone	1084	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.5	-	-
Terpinolene	1088	-	-	-	-	-	-	-	-	-	-	0.1	0.1	-	-	-	-	0.18	-
Undecane	1098	1.8	-	3.82	0.92	1.60	0.56	3.87	0.54	2.77	0.84	2.26	2.26	1.81	0.7	6.64	-	2.96	0.49
Camphor	1128	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.88	-	-
2-Methyl-1-Octanol	1130	0.12	-	-	-	-	-	0.13	-	-	-	0.17	0.17	-	-	0.15	-	-	-
trans-p-ment-2-en-1-ol	1138	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.05	-
(E)-2-Nonen-1-ol	1168	0.14	-	-	-	0.33	-	0.2	-	0.15	-	0.15	0.15	-	-	0.21	-	0.3	0.08
Menthol	1173	-	-		0.23	-	-	-	0.19		-	-	-	-	-	-	-	-	-
α-Terpineole	1191	-	-		-	-	-	-	0.2		-	0.16	0.16	-	-	-	-	-	-
Decanal	1205	-	-	-	-	0.16	-	-	-	-	-	-	-	-	-	-	-	0.13	0.11
Z-Citral	1241	-	-	-	-	0.16	-	-	0.36	-	-	-	-	-	-	-	-	-	-
3-Methyldodecane	1261	0.28	-	0.37	-	0.23	-	0.49	-	0.31	-	0.28	0.28	-	-	0.66	-	0.28	-
Geranial	1270	-	-	-	-	0.19	0.13	-	0.46	-	-	-	-	-	-	-	-	-	0.11
Thymol	1292	-	-	0.45	0.41	1.48	0.09	0.33	0.46	0.29	-	-	-	-	-	-	-	0.56	-
Tridecane	1297	0.16	-	0.31	-	0.19	-	0.4	-	0.26	-	0.18	0.18	-	-	0.49	-	0.23	-
α-Cunenene	1347	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.66	-	-
Ylangene	1369	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.47	-	-
α -Ylangene	1372	0.5	-	0.41	0.5	0.43	0.57	0.39	0.39	0.5	0.47	0.35	0.35	-	0.64	0.29	1.13	0.48	0.56
α -Copaene	1377	1.06	-	0.76	1.15	0.96	1.02	0.78	0.56	0.99	0.92	0.77	0.77	0.49	1.39	0.58	-	0.99	1.11
α -Cedrene	1382	-	-	-	-	-	-	-	0.25	-	-	-	-	-	-	-	-	-	-
Geranyl acetate	1383	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.63	-	-
β-Bourbonene	1386	0.99	-	0.62	0.94	0.72	0.87	0.69	0.46	0.98	0.69	0.88	0.88	-	1.04	0.46	-	0.89	0.86
β-Cubebene	1391	-	-	-	-	-	-	-	-	-	-	0.18	0.18	-	-		0.7	-	-
Decyl acetate	1392	0.25	-	0.93	0.94	1.23	0.16	1.07	-	1.29	-	0.4	0.4	1.25	0.97	0.55	-	1.14	0.21
β -Elemene	1393	0.51	-	-	-	-	0.37	-	0.53	-	0.65	-	-	-	-	-	-	-	0.58
Dodecanal	1401	0.12	-	-	-	-	0.08	-	-	-	-	-	-	-	-	-	-	0.09	0.12
Isolongifolene	1407	-	-	-	-	-	-	-	0.16	-	-	-	-	-	-	-	-	-	-
gama-Muurolen	1412	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	1.13	-	1.36
β -Funebrene	1414	1.1	-	1.24	1.48	1.36	1.08	1.35	0.77	1.62	1.28	0.81	0.81	0.54	1.58	0.75	-	1.14	-
β -Cedrene	1418	0.21	-	-	-	-	-	-	-	-	-	0.14	0.14	-	-	-	3.07	-	-
Trans-Caryophyllene	1421	2.73	-	2.74	4.08	3.67	3.06	2.9	1.88	3.26	3.75	2.03	2.03	2.17	4.05	1.7	-	3.25	4.07
Humulene	1428	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.67	-	-
β -Copaene	1430	0.71	-	0.34	0.81	0.52	0.5	0.41	0.24	0.54	0.66	0.55	0.55	-	0.84	0.27	-	0.5	0.71
para-Cymenene	1438	-	-	-	-	-	0.13	-	0.14	-	-	-	-	-	-	-	-	0.11	0.17
Aromadendrene	1441	0.28	-	-	0.34	0.19	0.26	0.19	0.24	0.23	0.34	0.23	0.23	-	0.41	-	-	0.21	0.33
β -Patchoulene	1446	0.39	-	-	-	0.23	0.3	-	0.28	0.37	0.4	-	0.3	-	0.56	-	1.49	0.09	0.45
cis-Muurola-3,5-diene	1447	-	-	-	0.44	-	1.26	-	1.27	-	1.78	0.3	-	-	-	-	-	0.24	1.31
Geranyl acetone	1451	1.06	-	0.62	1.79	0.59	0.31	0.61	0.13	0.77	-	-	-	-	1.78	0.44	0.83	0.86	-
α-Humulene	1456	0.65	-	-	1.49	1.04	0.91	-	0.36	-	0.67	-	-	0.7	1.07	-	0.55	0.99	0.99
(E)- β -Farnesene	1457	0.93	-	1.67	-	1.34	0.1	1.94	0.38	2.35	0.65	1.19	1.19	0.9	0.88	1.23	-	1.16	0.59
Neoalloocimene	1463	0.19	-	-	-	0.34	0.23	0.33	-	0.34	-	-	-	-	0.46	-	-	0.34	-
β -Cubebene	1465	0.33	-	-	-	0.27	-	0.22	-	-	-	-	-	-	-	-	0.52	0.26	0.38
β -Acoradiene	1468	0.5	-	0.4	0.58	0.54	0.47	0.44	0.37	0.6	0.52	0.34	0.34	-	0.67	0.23	-	0.49	0.55
α-Muurolene	1479	7.78	-	2.69	20.59	8.38	-	8.02	-	11.76	22.25	6.54	5.48	-	-	-	5.29	12.15	-
cis- β -Guaiene	1478	-	3.27	-	4.97	-	-	-	24.82	-	4.68	-	-	2.25	25.94	-	-	-	18.2
alpha-Amorphene	1481	3.81	-	-	-	2.35	24.05	2.57	-	3.2	-	2.99	3.14	0.67	4.93	1.65	4.94	3.03	2.81
Germacrene D	1484	8.09	3.5	12.68	8.39	22.35	3.29	14.04	4.39	18.61	6.89	6.1	7.94	33.53	10.68	8.28	4.76	17.89	8.04
Diepi-α-cedren	1485	-	4.8	-	-	-	-	-	-	-	-	-	-	12.21	-	-	-	-	-
α-Longipinene	1486	4.58	-	7.8	5.59	-	3.93	7.37	2.12	10.4	4.75	3.43	3.47	-	6.27	4.83	1.55	8.69	4.97
β-Selinene	1489	2.45	-	2.19	1.74	9.62	1.41	2.81	1.32	2.07	1.67	2.19	2.19	-	2.2	1.82	-	-	1.36
cis-Cadina-1,4-diene	1495	1.38	-	1.54	1.05	1.92	-	1.74	-	2.07	1.15	0.87	0.87	2.49	1.78	-	3.02	1.92	1.33
α-Selinene	1497	3.44	-	3.8	3.04	4.27	2.23	4.57	2.77	4.23	2.78	2.99	2.99	6.02	3.64	3.56	-	1.91	-
trans- β -Guaiene	1498	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	2.07	-
β -Himachalene	1502	1.02	-	0.66	1.29	0.66	0.91	0.67	1.92	0.8	1.26	0.71	0.71	-	1.64	0.37	1.16	1.84	2.48
(E,E)-α-Farnesene	1508	1.1	-	1.72	1	2.13	0.51	1.93	0.73	2.41	0.96	0.81	0.81	3.18	1.69	0.91	-	0.92	1.11
β -Curcumene	1509	-	-	-	1.94	-	-	-	-	-	-	-	-	-	-	-	-	2.21	1.04
gama-Cadinene	1513	-	-	-	-	-	1.63	-	1.44	-	1.74	-	-	-	2.39	-	2.23	0.13	1.74
delta-Cadinene	1525	3.06	2.29	2.08	3.7	2.73	2.51	2.32	2.91	2.92	3.41	2.36	2.36	2.47	4.52	1.04	4.32	2.91	3.3
Zonarene	1529	-	-	-	-	-	0.53	-	0.34		-	-	-	-	-	-	-	-	-
epi-α-Cadinol	1528	0.14	-	-	-	-	-	-	0.2	-	-	-	-	-	0.33	-	-	0.15	0.27
Cadina-1,4-diene	1535	0.27	-	-	-	0.17	0.22	0.22	0.21	0.21	-	0.19	0.19	-	0.35	-	-	0.31	0.53
α-Cadinene	1540	0.37	-	-	0.46	0.23	0.43	0.22	0.78	0.27	0.42	0.25	0.25	-	0.59	-	0.55	0.34	0.44
α-Calacorene	1545	0.37	-	-	0.41	0.15	0.54	-	0.55	-	0.32	0.26	0.26	-	0.49	-	-	0.19	0.48
Valerenol	1551	-	-	-	-	-	0.17	-	-	-	-	-	-	-	-	-	-	-	-
cis-Z-α-Bisabolene epoxide	1556	0.36	-	-	0.52	0.20	0.85	-	0.41	-	-	0.22	0.22	-	0.5	-	0.51	0.16	0.58
Farnesol	1564	1.3	-	0.94	1.61	1.39	1.61	1.07	1.6	1.21	1.23	0.83	0.83	1.39	1.89	0.36	1.31	1.31	1.81
trans-Nerolidol	1570	0.19	-	-	0.35	0.16	1.07	0.11	1.36	-	0.24	-	-	-	0.4	-	-	0.19	-
3-Hexen-1-ol, benzoate	1573	0.19	-	-	-	0.13	0.75	0.14	0.81	-	-	-	-	-	0.31	-	-	0.27	0.53
Sapthulenol	1580	2.23	-	1.22	3.76	1.51	3.89	1.28	2.67	1.32	1.91	1.49	1.49	-	3.34	0.59	2.66	1.34	3.36
Caryophyllene oxide	1586	1.27	-	0.49	1.8	0.46	3.28	0.47	2.14	0.4	1.49	0.72	0.72	-	1.38	0.16	-	0.52	1.86
Gobulol	1591	0.3	-	-	0.49	0.27	0.79	-	0.35	-	-	-	-	-	0.46	-	0.51	0.25	-
Viridiflorol	1597	0.32	-	-	0.64	0.27	1.02	-	0.44	-	0.39	0.19	0.19	-	0.73	-	0.61	0.25	1.01
Rosifoliol	1600	-	-	-	-	0.14	-	-	-	0.23	-	-	-	-	-	-	-	0.22	0.3
Humulene epoxide	1607	0.4	-	-	0.57	0.27	0.97	0.22	0.47	0.24	0.37	0.24	0.24	-	0.59	-	-	0.29	0.78
Ledol	1612	0.28	-	-	-	-	0.47	-	0.29	-	-	0.19	0.19	-	0.25	-	-	0.14	-
1,10-di-epi-Cubenol	1615	0.68	-	-	1.23	0.42	1.44	0.5	0.66	0.45	0.53	0.44	0.44	-	0.94	-	1.32	0.38	1.21
Junenol	1621	-	-	-	-	-	0.35	-	0.33	-	-	-	-	-	0.22	-	-	0.16	0.29
1-epi-cubenol	1631	0.23	-	-	-	0.12	0.6	-	0.23	-	-	0.16	0.16	-	0.28	-	-	0.16	0.32
cis-cadin-4-en-7-ol	1636	0.18	-	-	-	-	0.42	-	0.26	-	-	-	-	-	-	-	-	0.15	0.84
epi-α-cadinol	1641	0.38	-	-	0.65	0.23	1	0.32	0.76	0.27	0.48	0.22	0.22	-	0.69	-	-	0.35	0.8
epi-α-muurolol	1644	0.59	-	-	0.69	0.48	0.62	0.49	0.82	0.5	0.49	0.43	0.43	-	0.76	-	-	0.56	-
alpha-muurolol	1649	0.37	-	-	0.56	0.21	1.05	-	0.42	-	0.24	-	-	-	-	-	0.8	0.2	0.87
β-Eudesmol	1651	0.45	-	-	0.4	0.31	0.9	0.56	0.28	0.56	-	0.22	0.22	-	0.57	-	-	0.44	-
Valencene	1653	-	-	-	-	-	-	-	-	-	-	-	-	-	0.4	-	-	-	-
α-Cadinol	1657	1.32	-	0.93	1.77	1.04	1.97	1.24	1.77	1.07	0.97	0.9	0.9	0.98	-	0.29	2.08	1.16	1.84
Cedrol	1661	-	-	-	-	-	0.53	-	-	-	-	-	-	-	-	-	-	-	-
Geranyl tiglate	1674	-	-	-	-	-	-	-	-	-	-	0.15	0.15	-	-	-	-	-	-
Cyclododecane	1676	2.79	-	0.63	7.48	0.83	8.62	1.5	9.93	1.5	8.54	1.25	1.25	-	-	-	10.9	2.17	6.49
Alloaromadendrene	1682	0.19	-	-	0.43	-	0.41	-	0.42	-	0.39	-	-	-	-	-	-	0.14	0.38
α-Bisabolol	1684	0.23	-	-	0.44	-	1.01	-	0.18	-	-	-	-	-	-	-	-	0.14	0.54
epi-α-Bisabolol	1685	-	-	-	-	0.38	-	0.27	0.24	-	-	-	-	-	-	-	-	0.14	0.27
Dehydroaromadendene	1689	0.71	-	0.45	1.64	0.51	3.67	0.6	0.95	0.69	0.85	0.45	0.45	-	-	0.38	2.69	0.83	1.86
2-Phenylacetaldehyde	1707	-	-	-	-	-	0.27	-	0.22	-	-	-	-	-	-	-	-	-	-
iso-Spathulenol	1722	-	-	-	-	-	0.22	-	-	-	-	-	-	-	-	-	-	-	0.19
α-Sinesal	1725	0.18	-	-	-	-	0.42	-	0.29	-	-	-	-	-	-	-	-	0.09	0.25
Mint sulfide	1741	-	-	-	-	-	0.41	-	0.3	-	-	-	-	-	-	-	-	0.11	0.29
β-Oplopenone	1748	-	-	-	-	-	0.19	-	0.21	-	-	-	-	-	-	-	-	-	0.35
Phytol	2112	0.49	-	-	2.96	-	-	-	-	-	-	-	-	-	-	-	-	0.13
trans-Phytol	2114	-	-	-	-	-	-	-	8.21	-	2.85	-	-	-	-	-	-	-	3.31
* RI: Retention indices of the compounds.
**S.din-5: Spermidine, B-10-3: Brassinosteroide, SA-14: Salycilic acid, C-1.5: Cycocel. S.din-5-N: Spermidine (Nano-form), B-10-3-N: Brassinosteroide (Nano-form), SA-14-N: Salycilic acid (Nano-form), C-1.5-N: Cycocel (Nano-form).

Germacrene D and β-caryophyllene have also been reported as the major component of H. perforatum in Turkish samples (Alan et al., 2010; Cirak et al., 2010), Italian (Maggi et al., 2010) and Tunesian samples (Hosni et al., 2011). Most of the reports showed similar ranges for these compounds in normal condition. Moreover, in the present study, beta-selinene was obtained in the range of 0-9.62% that was in the range of a previous report in Turkey (5.08–19.63%) (Cirak et al., 2010). However, the discrepancy in some results can be interpreted as the harvesting phase of the samples. In the present study, for essential oil components, the samples were harvested just at the flowering stage. High accumulation of sesquiterpenes such as germacrene D and β-caryophyllene in comparison with monoterpenes might probably be the result of early harvesting of the samples. Rahimmalek et al. (2009) and Hodaei et al. (2017) also highlighted these form of the accumulation in the genus of Achillea and Chrysanthemum, respectively. Furthermore, they also attributed these kind of accumulation to the precursor flow in young organs with higher intensive growth than old ones and the distribution of precursors between the cytoplasm (the site of sesquiterpenes synthesis) and plastids (the site of monoterpenes synthesis).

The present research for the first time assessed the effect of nano-hormones of 24-epibrassinolides, spermidine, salycilic acid and cycocel on hypericin content and related genes expression. According to the results, most of the genes were upregulated with the application of nano-encapsulated hormones. Moreover, temperature as an environmental factor was crucial in hypericin production. Among treatments, nano-cycocel showed the highest production of hypericin that can be suggested for further industrial or pharmaceutical purposes. Moreover, in the present study, the effect of these nano-hormones were compared with normal ones and interestingly the accumulation of two sesquiterpenes viz. Germacrene D and β-caryophyllene were elevated as compared with normal ones in most cases. Finally, the use of new technologies in nano related science can provide new insights and prospects for increasing of valuable metabolites in medicinal and aromatic plants.

Ali, B., Hassan, S.A., Hayat, S., Hayat, Q., Yadav, S., Fariduddin, Q., Ahmad, A., 2008a. A role for 24-epibrassinolides in the amelioration of aluminium stress through antioxidant system in mung bean (Vigna radiata L. Wilczek). Environ. Exp. Bot. 62, 153–159.

Adams, R.P., 2007. Identification of essential oil components by gas chromatography/mass spectrometry (Vol. 456). Carol Stream, IL: Allured publishing corporation.

Alan, S., Demirci, B., Iscan, G., Kose, Y.B. Baser, K.H.C., 2010. Composition and Anticandidal Activity of the Essential Oil of Hypericum perforatum L. Asian J. Chem. 22, 1315.

Amirnia, Y., Farsad-Akhtar, N., Mahna, N., Razeghi, J., Benamolaei, P., 2017. The influence of jasmonic acid on induction of HpPKS1 gene in Hypericum perforatum L. J. N. B. R. 6, 77 – 81.

Asci, Ö.A., Deveci, H., Erdeger, A., Özdemir, K.N., Demirci, T., Baydar, N.G., 2019. 24-epibrassinolides Promote Growth and Secondary Metabolite Production in Lavandin (Lavandula intermedia Emeric ex Loisel.). J. N. B. R. 22, 254-263.

Azeez, H., Ibrahim, K., Pop, R., Pamfil, D., Hârţa, M., Bobiș, O., 2017. Changes induced by gamma ray irradiation on biomass production and secondary metabolites accumulation in Hypericum triquetrifolium Turra callus cultures. Ind. Crops. Prod. 108, 183-189.

Bielecka, M., Pencakowski, B., Stafiniak, M., Jakubowski, K., Rahimmalek, M., Gharibi, S., Matkowski, A., Ślusarczyk, S., 2021. Metabolomics and DNA-based authentication of two taditional Asian medicinal and aromatic species of Salvia subg. Perovskia. cells. 10(1), 112; https://doi.org/10.3390/cells10010112.

Coste, A., Vlase, L., Halmagyi, A., Deliu, C., Coldea, G., 2011. Effects of plant growth regulators and elicitors on production of secondary metabolites in shoot cultures of Hypericum hirsutum and Hypericum maculatum. Plant Cell, Tissue Organ Cult. 106, 279-288.

Çırak, C., Bertoli, A., Pistelli, L., Seyis, F., 2010. Essential oil composition and variability of Hypericum perforatum from wild populations of northern Turkey. Pharmaceutical Biol. 48, 906-914.

Cirak, C., Radušienė, J., Kurtarc, E.S., Marksa, M., Ivanauskas, L., 2020. In vitro plant regeneration and jasmonic acid induced bioactive chemical accumulations in two Hypericum species from Turkey. S. Afr. J. Bot. 128, 312-318.

Ghasemi Pirbalouti, A., Fatahi-Vanani, M., Craker, L., Shirmardi, H., 2014. Chemical composition and bioactivity of essential oils of Hypericum helianthemoides. Hypericum perforatum and Hypericum scabrum. Pharmaceutical Biol. 52,175-181.

Gharibi, S., Tabatabaei, B.E.S., Saeidi, G., Talebi, M., Matkowski, A., 2019. The effect of drought stress on polyphenolic compounds and expression of flavonoid biosynthesis related genes in Achillea pachycephala Rech. f. Phytochemistry, 162, 90-98.

Gadzovska, S., Maury, S., Delaunay, A., Spasenoski, M., Hagège, D., Courtois, D., Joseph, C., 2013. The influence of salicylic acid elicitation of shoots, callus, and cell suspension cultures on production of naphtodianthrones and phenylpropanoids in Hypericum perforatum L. Plant Cell, Tissue and Organ Culture. 113, 25-39.

Ghodrati, L., Ataei Kachouei, M., 2019. The process of nanocapsulating plant hormones and growth regulators, Real Estate Registration Organization of Iran. Registration number: 97416.

Hodaei, M., Rahimmalek, M., Arzani, A., 2017. Variation in morphological characters, chemical composition, and anthocyanin content of different Chrysanthemum morifolium cultivars from Iran. Biochem. Syst. and Ecol. 74, 1-10.

Hodaei, M., Rahimmalek, M., Arzani, A., Talebi, M., 2018. The effect of water stress on phytochemical accumulation, bioactive compounds and expression of key genes involved in flavonoid biosynthesis in Chrysanthemum morifolium L. Ind. Crops Prod. 120, 295-304.

Hosni, K., Msaâda, K., taârit, M.B., Chahed, T., Marzouk, B., 2011. Volatile constituents of two Hypericum species from Tunisia. Nat. Prod. Commun. 6, p.1934578X1100601140.

Keltawi, N.E., Croteau, R., 1986. Influence of phosfon D and cycocel on growth and essential oil content of sage and peppermint. Phytochemistry. 25, 1603-1606.

Kianersi, F., Abdollahi, M.R., Mirzaie-asl, A., Dastan, D., Rasheed, F., 2020. Identification and tissue-specific expression of rutin biosynthetic pathway genes in Capparis spinosa elicited with salicylic acid and methyl jasmonate. Sci. Rep. 10, 1-15.

Košuth, J., Smelcerovic, A., Borsch, T., Zuehlke, S., Karppinen, K., Spiteller, M., Hohtola, A., Čellárová, E., 2011. The hyp-1 gene is not a limiting factor for hypericin biosynthesis in the genus Hypericum. Funct. Plant Biol. 38 35-43.

Maggi, F., Cecchini, C., Cresci, A., Coman, M.M., Tirillini, B., Sagratini, G., Papa, F., Vittori, S., 2010. Chemical composition and antimicrobial activity of the essential oils from several Hypericum taxa (Guttiferae) growing in central Italy (Appennino Umbro‐Marchigiano). Chem. Biodivers. 7, 447-466.

Mohammadi, H., Amirikia, F., Ghorbanpour, M., Fatehi, F., Hashempour, H., 2019. Salicylic acid induced changes in physiological traits and essential oil constituents in different ecotypes of Thymus kotschyanus and Thymus vulgaris under well-watered and water stress conditions. Ind. Crops and Prod. 129, 561-574.

Nürk, N.M., Madriñán, S., Carine, M.A., Chase, M.W., Blattner, F.R., 2013. Molecular phylogenetics and morphological evolution of St. John’s wort (Hypericum; Hypericaceae). Mol. Phylogenet. Evol. 66, 1-16.

Preetz, C., Rübe, A., Reiche, I., Hause, G., Mäder, K., 2008. Preparation and characterization of biocompatible oil-loaded polyelectrolyte nanocapsules. Nanomedicine. N. B. M. 4, 106-114.

Qian, Z.G., Zhao, Z.J., Xu, Y., Qian, X., Zhong, J.J., 2006. Novel chemically synthesized salicylate derivative as an effective elicitor for inducing the biosynthesis of plant secondary metabolites. Biotechnol. Prog. 22, 331-333.

Rahimmalek, M., Tabatabaei, B.E.S., Etemadi, N., Goli, S.A.H., Arzani, A., Zeinali, H., 2009. Essential oil variation among and within six Achillea species transferred from different ecological regions in Iran to the field conditions. Ind. Crops. Prod. 29, 348-355.

Rezaie, R., Mandoulakani, B.A., Fattahi, M., 2020. Cold stress changes antioxidant defense system, phenylpropanoid contents and expression of genes involved in their biosynthesis in Ocimum basilicum L. Sci. rep. 10, 1-10.

Sasson, E., Pinhasi, R.V.O., Margel, S., Klipcan, L., 2020. Engineering and use of proteinoid polymers and nanocapsules containing agrochemicals. Sci. Rep. 10, 1-13.

Shahim-Ghalecheh, M., Farsad-Akhtar, N., Mahna, N., Razeghi, J., 2017. Effect of salicylic acid on the expression of a gene involved in the biosynthesis of hyperforin in St. John’s wort (Hypericum perforatum). J. Bio. Env. Sci. 11, 63-68.

Shakya, P., Marslin, G., Siram, K., Beerhues, L., Franklin, G., 2019. Elicitation as a tool to improve the profiles of high‐value secondary metabolites and pharmacological properties of Hypericum perforatum. J. Pharm. Pharmacol. 71, 70-82.

Seyis, F., Yurteri, E., Özcan, A., Cirak, C., 2020. Altitudinal impacts on chemical content and composition of Hypericum perforatum, a prominent medicinal herb. S. Afr. J. Bot. 135, 391-403.

Sotak, M., Czerankova, O., Klein, D., Jurčacková, Z., Li, L., Čellárová, E., 2016. Comparative transcriptome reconstruction of four Hypericum species focused on hypericin biosynthesis. Front. Plant Sci. 7,1039.

Tohidi, B., Rahimmalek, M., Arzani, A., 2017. Essential oil composition, total phenolic, flavonoid contents, and antioxidant activity of Thymus species collected from different regions of Iran. Food Chem. 220, 153-161.

Valletta, A., De Angelis, G., Badiali, C., Brasili, E., Miccheli, A., Di Cocco, M.E., Pasqua, G., 2016. Acetic acid acts as an elicitor exerting a chitosan-like effect on xanthone biosynthesis in Hypericum perforatum L. root cultures. Plant cell rep. 35, 1009-1020.

Walker, T.S., Bais, H.P., Vivanco, J.M., 2002. Jasmonic acid-induced hypericin production in cell suspension cultures of Hypericum perforatum L. (St. John’s wort). Phytochemistry. 60, 289–293.

Yamaner, O., Erdag, B., 2013. Effects of sucrose and polyethylene glycol on hypericins content in Hypericum adenotrichum. EurAsian J. Biosci. 7, 101-110.

Yao, Y., Kang, T., Jin, L., Liu, Z., Zhang, Z., Xing, H., Sun, P., Li, M., 2019. Temperature-dependent growth and hypericin biosynthesis in Hypericum perforatum. Plant Physiol. Biochem. 139, 613-619.

Miranda-Villagómez, Erika., Trejo-Téllez, L, I., Gómez-Merino F, C., Sandoval-Villa, Manuel., Sánchez-García, Prometeo., Aguilar-Méndez, M, Á., 2019. Nanophosphorus Fertilizer Stimulates Growth and Photosynthetic Activity and Improves P Status in Rice. Journal of Nanomaterials. 1-11.

Table 1. Primer sequences of the hypericin biosynthesis genes and the housekeeping gene (actin) used for qRT-PCR.

Target genes	Primers F/R	Product size (bp)	Annealing temperature
primer name	Sequence (5'->3')
Hyp-1-F	TGAAGGTGATGTGTTGCGTG	111	58
Hyp-1-R	GGCTTGGGATGATAGGAGACTG	111	58
PKS1-F	TGTACGTCTCATCCAGTGAGC	121	61
PKS1-R	ACACCACCGTAACAGCCTAAG	121	61
PKS2-F	TACACAAGGAGACACCCAAGC	218	61
PKS2-R	GGAACTGGCAACATAGCATCC	218	61
18s-F	AAACGGCTACCACATCCAAG	247	58
18s-R	CAACCCAAAGTCCAACTACG	247	58

Table 2. Essential oil composition of Hypericum samples under normal and nano horomones.

Treatments		control		B-10-3**		B-10-3-N		C-1.5		C-1.5-N		S.din-5		S.din-5-N		SA-14		SA-14-N
Compounds	RI*	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman	Isfahan	Saman
α-Thujene	924	-	-	0.16	-	0.14	-	0.1	-	-	-	0.14	0.14	-	-	0.3	-	0.04	-
α-Pinene	932	8.77	-	12.57	-	4.88	-	8.28	-	3.44	-	18.89	16.74	4.28	0.17	18.11	-	2.36	-
camphene	948		-	-	-	-	-	-	-	-	-	0.08	0.08	-	-	-	-	-	-
Ethyl 3-hydroxybutanoate	949	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.12	-
3-Methylnonane	965	1.14	-	1.53	-	0.50	0.09	1.27	0.1	0.68	0.22	2.34	2.34	0.73	-	3.5	-	0.64	0.12
Sabinene	972	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.11	-	-	-
β-Pinene	976	4.35	-	4.92	-	2.10	-	3.8	-	1.52	-	7.99	6.48	2.5	-	9.11	-	1.21	-
β-Myrcene	989	0.47	-	0.49	-	0.25	-	0.42	-	0.2	-	0.85	0.85	-	-	0.93	0.56	0.17	-
α-Phellandrene	1008	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.06	-
α-Terpiene	1016	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.06	-
para-Cymene	1024	-	-	-	-	0.14	-	-	-	-	-	-	-	-	-	-	-	-	-
Limonene	1028	0.4	-	0.33	-	0.18	-	0.31	-	-	-	0.62	0.62	-	-	0.59	-	0.14	-
(Z)-βeta-Ocimene	1035	0.44	-	0.77	-	0.60	-	0.74	-	0.49	-	0.65	0.65	1.38	-	1.27	-	0.53	-
Benzeneacetaldehyde	1045	0.87	-	2.2	-	1.51	-	2.16	-	1.34	-	1.29	1.29	3.74	-	3.4	-	1.29	-
(E)-β-Ocimene	1048	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.13	-
gama-Terpinene	1024	0.11	-	-	-	0.16	-	0.11	-	-	-	0.16	0.16	-	-	0.18	-	0.08	-
2-Methyldecane	1060	1.22	-	1.84	-	0.76	-	1.9	0.12	1.12	0.26	1.62	1.62	0.79	0.2	3.61	-	1.13	0.13
β-Thujone	1084	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.5	-	-
Terpinolene	1088	-	-	-	-	-	-	-	-	-	-	0.1	0.1	-	-	-	-	0.18	-
Undecane	1098	1.8	-	3.82	0.92	1.60	0.56	3.87	0.54	2.77	0.84	2.26	2.26	1.81	0.7	6.64	-	2.96	0.49
Camphor	1128	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.88	-	-
2-Methyl-1-Octanol	1130	0.12	-	-	-	-	-	0.13	-	-	-	0.17	0.17	-	-	0.15	-	-	-
trans-p-ment-2-en-1-ol	1138	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.05	-
(E)-2-Nonen-1-ol	1168	0.14	-	-	-	0.33	-	0.2	-	0.15	-	0.15	0.15	-	-	0.21	-	0.3	0.08
Menthol	1173	-	-		0.23	-	-	-	0.19		-	-	-	-	-	-	-	-	-
α-Terpineole	1191	-	-		-	-	-	-	0.2		-	0.16	0.16	-	-	-	-	-	-
Decanal	1205	-	-	-	-	0.16	-	-	-	-	-	-	-	-	-	-	-	0.13	0.11
Z-Citral	1241	-	-	-	-	0.16	-	-	0.36	-	-	-	-	-	-	-	-	-	-
3-Methyldodecane	1261	0.28	-	0.37	-	0.23	-	0.49	-	0.31	-	0.28	0.28	-	-	0.66	-	0.28	-
Geranial	1270	-	-	-	-	0.19	0.13	-	0.46	-	-	-	-	-	-	-	-	-	0.11
Thymol	1292	-	-	0.45	0.41	1.48	0.09	0.33	0.46	0.29	-	-	-	-	-	-	-	0.56	-
Tridecane	1297	0.16	-	0.31	-	0.19	-	0.4	-	0.26	-	0.18	0.18	-	-	0.49	-	0.23	-
α-Cunenene	1347	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.66	-	-
Ylangene	1369	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.47	-	-
α -Ylangene	1372	0.5	-	0.41	0.5	0.43	0.57	0.39	0.39	0.5	0.47	0.35	0.35	-	0.64	0.29	1.13	0.48	0.56
α -Copaene	1377	1.06	-	0.76	1.15	0.96	1.02	0.78	0.56	0.99	0.92	0.77	0.77	0.49	1.39	0.58	-	0.99	1.11
α -Cedrene	1382	-	-	-	-	-	-	-	0.25	-	-	-	-	-	-	-	-	-	-
Geranyl acetate	1383	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.63	-	-
β-Bourbonene	1386	0.99	-	0.62	0.94	0.72	0.87	0.69	0.46	0.98	0.69	0.88	0.88	-	1.04	0.46	-	0.89	0.86
β-Cubebene	1391	-	-	-	-	-	-	-	-	-	-	0.18	0.18	-	-		0.7	-	-
Decyl acetate	1392	0.25	-	0.93	0.94	1.23	0.16	1.07	-	1.29	-	0.4	0.4	1.25	0.97	0.55	-	1.14	0.21
β -Elemene	1393	0.51	-	-	-	-	0.37	-	0.53	-	0.65	-	-	-	-	-	-	-	0.58
Dodecanal	1401	0.12	-	-	-	-	0.08	-	-	-	-	-	-	-	-	-	-	0.09	0.12
Isolongifolene	1407	-	-	-	-	-	-	-	0.16	-	-	-	-	-	-	-	-	-	-
gama-Muurolen	1412	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	1.13	-	1.36
β -Funebrene	1414	1.1	-	1.24	1.48	1.36	1.08	1.35	0.77	1.62	1.28	0.81	0.81	0.54	1.58	0.75	-	1.14	-
β -Cedrene	1418	0.21	-	-	-	-	-	-	-	-	-	0.14	0.14	-	-	-	3.07	-	-
Trans-Caryophyllene	1421	2.73	-	2.74	4.08	3.67	3.06	2.9	1.88	3.26	3.75	2.03	2.03	2.17	4.05	1.7	-	3.25	4.07
Humulene	1428	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	0.67	-	-
β -Copaene	1430	0.71	-	0.34	0.81	0.52	0.5	0.41	0.24	0.54	0.66	0.55	0.55	-	0.84	0.27	-	0.5	0.71
para-Cymenene	1438	-	-	-	-	-	0.13	-	0.14	-	-	-	-	-	-	-	-	0.11	0.17
Aromadendrene	1441	0.28	-	-	0.34	0.19	0.26	0.19	0.24	0.23	0.34	0.23	0.23	-	0.41	-	-	0.21	0.33
β -Patchoulene	1446	0.39	-	-	-	0.23	0.3	-	0.28	0.37	0.4	-	0.3	-	0.56	-	1.49	0.09	0.45
cis-Muurola-3,5-diene	1447	-	-	-	0.44	-	1.26	-	1.27	-	1.78	0.3	-	-	-	-	-	0.24	1.31
Geranyl acetone	1451	1.06	-	0.62	1.79	0.59	0.31	0.61	0.13	0.77	-	-	-	-	1.78	0.44	0.83	0.86	-
α-Humulene	1456	0.65	-	-	1.49	1.04	0.91	-	0.36	-	0.67	-	-	0.7	1.07	-	0.55	0.99	0.99
(E)- β -Farnesene	1457	0.93	-	1.67	-	1.34	0.1	1.94	0.38	2.35	0.65	1.19	1.19	0.9	0.88	1.23	-	1.16	0.59
Neoalloocimene	1463	0.19	-	-	-	0.34	0.23	0.33	-	0.34	-	-	-	-	0.46	-	-	0.34	-
β -Cubebene	1465	0.33	-	-	-	0.27	-	0.22	-	-	-	-	-	-	-	-	0.52	0.26	0.38
β -Acoradiene	1468	0.5	-	0.4	0.58	0.54	0.47	0.44	0.37	0.6	0.52	0.34	0.34	-	0.67	0.23	-	0.49	0.55
α-Muurolene	1479	7.78	-	2.69	20.59	8.38	-	8.02	-	11.76	22.25	6.54	5.48	-	-	-	5.29	12.15	-
cis- β -Guaiene	1478	-	3.27	-	4.97	-	-	-	24.82	-	4.68	-	-	2.25	25.94	-	-	-	18.2
alpha-Amorphene	1481	3.81	-	-	-	2.35	24.05	2.57	-	3.2	-	2.99	3.14	0.67	4.93	1.65	4.94	3.03	2.81
Germacrene D	1484	8.09	3.5	12.68	8.39	22.35	3.29	14.04	4.39	18.61	6.89	6.1	7.94	33.53	10.68	8.28	4.76	17.89	8.04
Diepi-α-cedren	1485	-	4.8	-	-	-	-	-	-	-	-	-	-	12.21	-	-	-	-	-
α-Longipinene	1486	4.58	-	7.8	5.59	-	3.93	7.37	2.12	10.4	4.75	3.43	3.47	-	6.27	4.83	1.55	8.69	4.97
β-Selinene	1489	2.45	-	2.19	1.74	9.62	1.41	2.81	1.32	2.07	1.67	2.19	2.19	-	2.2	1.82	-	-	1.36
cis-Cadina-1,4-diene	1495	1.38	-	1.54	1.05	1.92	-	1.74	-	2.07	1.15	0.87	0.87	2.49	1.78	-	3.02	1.92	1.33
α-Selinene	1497	3.44	-	3.8	3.04	4.27	2.23	4.57	2.77	4.23	2.78	2.99	2.99	6.02	3.64	3.56	-	1.91	-
trans- β -Guaiene	1498	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	2.07	-
β -Himachalene	1502	1.02	-	0.66	1.29	0.66	0.91	0.67	1.92	0.8	1.26	0.71	0.71	-	1.64	0.37	1.16	1.84	2.48
(E,E)-α-Farnesene	1508	1.1	-	1.72	1	2.13	0.51	1.93	0.73	2.41	0.96	0.81	0.81	3.18	1.69	0.91	-	0.92	1.11
β -Curcumene	1509	-	-	-	1.94	-	-	-	-	-	-	-	-	-	-	-	-	2.21	1.04
gama-Cadinene	1513	-	-	-	-	-	1.63	-	1.44	-	1.74	-	-	-	2.39	-	2.23	0.13	1.74
delta-Cadinene	1525	3.06	2.29	2.08	3.7	2.73	2.51	2.32	2.91	2.92	3.41	2.36	2.36	2.47	4.52	1.04	4.32	2.91	3.3
Zonarene	1529	-	-	-	-	-	0.53	-	0.34		-	-	-	-	-	-	-	-	-
epi-α-Cadinol	1528	0.14	-	-	-	-	-	-	0.2	-	-	-	-	-	0.33	-	-	0.15	0.27
Cadina-1,4-diene	1535	0.27	-	-	-	0.17	0.22	0.22	0.21	0.21	-	0.19	0.19	-	0.35	-	-	0.31	0.53
α-Cadinene	1540	0.37	-	-	0.46	0.23	0.43	0.22	0.78	0.27	0.42	0.25	0.25	-	0.59	-	0.55	0.34	0.44
α-Calacorene	1545	0.37	-	-	0.41	0.15	0.54	-	0.55	-	0.32	0.26	0.26	-	0.49	-	-	0.19	0.48
Valerenol	1551	-	-	-	-	-	0.17	-	-	-	-	-	-	-	-	-	-	-	-
cis-Z-α-Bisabolene epoxide	1556	0.36	-	-	0.52	0.20	0.85	-	0.41	-	-	0.22	0.22	-	0.5	-	0.51	0.16	0.58
Farnesol	1564	1.3	-	0.94	1.61	1.39	1.61	1.07	1.6	1.21	1.23	0.83	0.83	1.39	1.89	0.36	1.31	1.31	1.81
trans-Nerolidol	1570	0.19	-	-	0.35	0.16	1.07	0.11	1.36	-	0.24	-	-	-	0.4	-	-	0.19	-
3-Hexen-1-ol, benzoate	1573	0.19	-	-	-	0.13	0.75	0.14	0.81	-	-	-	-	-	0.31	-	-	0.27	0.53
Sapthulenol	1580	2.23	-	1.22	3.76	1.51	3.89	1.28	2.67	1.32	1.91	1.49	1.49	-	3.34	0.59	2.66	1.34	3.36
Caryophyllene oxide	1586	1.27	-	0.49	1.8	0.46	3.28	0.47	2.14	0.4	1.49	0.72	0.72	-	1.38	0.16	-	0.52	1.86
Gobulol	1591	0.3	-	-	0.49	0.27	0.79	-	0.35	-	-	-	-	-	0.46	-	0.51	0.25	-
Viridiflorol	1597	0.32	-	-	0.64	0.27	1.02	-	0.44	-	0.39	0.19	0.19	-	0.73	-	0.61	0.25	1.01
Rosifoliol	1600	-	-	-	-	0.14	-	-	-	0.23	-	-	-	-	-	-	-	0.22	0.3
Humulene epoxide	1607	0.4	-	-	0.57	0.27	0.97	0.22	0.47	0.24	0.37	0.24	0.24	-	0.59	-	-	0.29	0.78
Ledol	1612	0.28	-	-	-	-	0.47	-	0.29	-	-	0.19	0.19	-	0.25	-	-	0.14	-
1,10-di-epi-Cubenol	1615	0.68	-	-	1.23	0.42	1.44	0.5	0.66	0.45	0.53	0.44	0.44	-	0.94	-	1.32	0.38	1.21
Junenol	1621	-	-	-	-	-	0.35	-	0.33	-	-	-	-	-	0.22	-	-	0.16	0.29
1-epi-cubenol	1631	0.23	-	-	-	0.12	0.6	-	0.23	-	-	0.16	0.16	-	0.28	-	-	0.16	0.32
cis-cadin-4-en-7-ol	1636	0.18	-	-	-	-	0.42	-	0.26	-	-	-	-	-	-	-	-	0.15	0.84
epi-α-cadinol	1641	0.38	-	-	0.65	0.23	1	0.32	0.76	0.27	0.48	0.22	0.22	-	0.69	-	-	0.35	0.8
epi-α-muurolol	1644	0.59	-	-	0.69	0.48	0.62	0.49	0.82	0.5	0.49	0.43	0.43	-	0.76	-	-	0.56	-
alpha-muurolol	1649	0.37	-	-	0.56	0.21	1.05	-	0.42	-	0.24	-	-	-	-	-	0.8	0.2	0.87
β-Eudesmol	1651	0.45	-	-	0.4	0.31	0.9	0.56	0.28	0.56	-	0.22	0.22	-	0.57	-	-	0.44	-
Valencene	1653	-	-	-	-	-	-	-	-	-	-	-	-	-	0.4	-	-	-	-
α-Cadinol	1657	1.32	-	0.93	1.77	1.04	1.97	1.24	1.77	1.07	0.97	0.9	0.9	0.98	-	0.29	2.08	1.16	1.84
Cedrol	1661	-	-	-	-	-	0.53	-	-	-	-	-	-	-	-	-	-	-	-
Geranyl tiglate	1674	-	-	-	-	-	-	-	-	-	-	0.15	0.15	-	-	-	-	-	-
Cyclododecane	1676	2.79	-	0.63	7.48	0.83	8.62	1.5	9.93	1.5	8.54	1.25	1.25	-	-	-	10.9	2.17	6.49
Alloaromadendrene	1682	0.19	-	-	0.43	-	0.41	-	0.42	-	0.39	-	-	-	-	-	-	0.14	0.38
α-Bisabolol	1684	0.23	-	-	0.44	-	1.01	-	0.18	-	-	-	-	-	-	-	-	0.14	0.54
epi-α-Bisabolol	1685	-	-	-	-	0.38	-	0.27	0.24	-	-	-	-	-	-	-	-	0.14	0.27
Dehydroaromadendene	1689	0.71	-	0.45	1.64	0.51	3.67	0.6	0.95	0.69	0.85	0.45	0.45	-	-	0.38	2.69	0.83	1.86
2-Phenylacetaldehyde	1707	-	-	-	-	-	0.27	-	0.22	-	-	-	-	-	-	-	-	-	-
iso-Spathulenol	1722	-	-	-	-	-	0.22	-	-	-	-	-	-	-	-	-	-	-	0.19
α-Sinesal	1725	0.18	-	-	-	-	0.42	-	0.29	-	-	-	-	-	-	-	-	0.09	0.25
Mint sulfide	1741	-	-	-	-	-	0.41	-	0.3	-	-	-	-	-	-	-	-	0.11	0.29
β-Oplopenone	1748	-	-	-	-	-	0.19	-	0.21	-	-	-	-	-	-	-	-	-	0.35
Phytol	2112	0.49	-	-	2.96	-	-	-	-	-	-	-	-	-	-	-	-	0.13
trans-Phytol	2114	-	-	-	-	-	-	-	8.21	-	2.85	-	-	-	-	-	-	-	3.31

* RI: Retention indices of the compounds.**S.din-5: Spermidine, B-10-3: Brassinosteroide, SA-14: Salycilic acid, C-1.5: Cycocel. S.din-5-N: Spermidine (Nano-form), B-10-3-N: Brassinosteroide (Nano-form), SA-14-N: Salycilic acid (Nano-form), C-1.5-N: Cycocel (Nano-form).

No competing interests reported.

PDF

Version 1

posted 03 May, 2021

You are reading this latest preprint version

Variation in phytochemical properties and expression of key genes involved in biosynthesis of hypericin using nano-capsulated and normal hormones in Hypericum perforatum L

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Conclusion

References

Tables

Competing Interests

Status:

Version 1