Chickenpox is endemic worldwide. In China, varicella has not yet been included in the list of legal infectious diseases, nor has a unified national surveillance program been established. And the live attenuated varicella vaccine has not been included in routine immunization. In this study, we analyzed for the first time the chickenpox epidemiology in Jilin Province in the past 20 years, and the nucleotide site, amino acid site and N-glycosylation site variation of glycoprotein in varicella-zoster virus (VZV) surface 9 in the past 15 years. The results showed that the reported incidence of varicella in Jilin Province in the last 20 years was fluctuating above and below 20/10,000, especially after the epidemic of the COVID-19, and fatal cases appeared in individual years. The genotypic branching of VZV was monitored as Clade 2 in the last 15 years. 9 glycogen nucleotide sites of VZV have different degrees of variability, and the variability has specificity. therefore, it gives us the idea that in order to reduce the incidence of varicella and herpes zoster a provincial or even national surveillance program should be introduced as early as possible, and the dynamic monitoring of the variability of the nucleotide sites of VZV should be strengthened at the same time as the vaccine immunization strategy is introduced.
Article
Analysis of nucleotide site variability of nine glycoproteins on varicella-zoster virus envelope, Jilin Province, China, 2010-March 2024
https://doi.org/10.21203/rs.3.rs-4467331/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
varicella zoster virus
envelope glycoprotein
mutation site
Varicella-zoster virus (VZV) belongs to the Herpesviridae family, subfamily Herpesviridae alpha, and human herpesvirus type 3 (HHV-3) 1. VZV possesses a genome of approximately 125 kb, consisting of 71 open reading frames (ORFs) and five repeat regions (R1-R5) 2–3. It is an enveloped virus containing nine known glycoproteins in nine ORFs, namely gK (ORF5), gN (ORF9A), gC (ORF14), gB (ORF31), gH (ORF37), gM (ORF50), gL (ORF60), gI (ORF67) and gE (ORF68) 4–5. These glycoproteins fulfill a variety of roles including viral entry, efflux, cell spreading, attachment, replication and envelopment 6–18. It causes infections with two main clinical conditions: varicella and herpes zoster. Primary infection usually manifests as varicella and develops a latent phase in sensory ganglia.VZV reactivation can lead to herpes zoster, which is usually accompanied by neuralgia and postherpetic neuralgia (PHN) 19–20. Although the clinical manifestations are typical, there is still a report showing that no VZV-induced rash manifestations were found in fatal cases21, suggesting that new variants may exist. With the wide application of real-time PCR detection technology and the advancement of whole genome sequencing technology, the monitoring of VZV has become more convenient.
The World Health Organization (WHO) recommended countries to establish a comprehensive disease surveillance system in its 2014 Position Paper22. In China, we have been monitoring the incidence of varicella since 2005, and molecular biology surveillance of VZV was started in Jilin Province in 2010.
In this study, we monitored the incidence of varicella in Jilin Province in the past nearly 20 years, and at the same time, we obtained vesicular fluid samples from the diseased population in the past 15 years to identify the genotype and analyze the nucleotide site variation.
This enables it to provide reference data for vaccine development, clinical diagnosis and treatment at the molecular level. It also contributes to the establishment of a national varicella and herpes zoster surveillance program, including the inclusion of live attenuated varicella vaccine into the national routine immunization program and the promotion of the use of live attenuated herpes zoster vaccine for older persons.
Varicella Epidemiological Data
Varicella epidemiologic data on the number of reported varicella cases and annual incidence rates in Jilin Province were extracted directly from the National Notifiable Disease Reporting System (NNDRS) of the China Center for Disease Control and Prevention (China CDC) from 2005 to March 2024.
Specimen collection
Since VZV is the causative agent of both varicella and herpes zoster, clinicians collected vesicular fluid specimens from suspected varicella or herpes zoster cases from China-Japan Union Hospital of Jilin University, Changchun Infectious Disease Hospital, the Affiliated Hospital to Changchun University of Chinese Medicine and the Second Hospital of Jilin University from 2010 to March 2024. These specimens were stored at -80℃.
VZV qualitative detection
DNA extraction was performed using the qEx-DNA/RNA kit (Xi'an Tianlong Technology Co., Ltd., China) according to the manufacturer's instructions. VZV Real-time fluorescence quantitative polymerase chain reaction （Real-time quantitative PCR）kit (Beijing Kinghawk Pharmaceutical Co.,Ltd.) was used for detecting all collected specimens according to the manufacturer's instructions.
Reference sequences selection
The reference sequences used in this study were obtained from GenBank (https://www.ncbi.nlm.nih.gov/nuccore) under accession numbers NC001348 (Dumas), MF898328 (Baike), AB097933 (pOka), KJ767491 (YC01), DQ479957 (03-57), and DQ479957 (03-57). DQ479957 (03-500), DQ452050 (M2DR), DQ457052 (CA123), KF811485 (Pasadena, USA), JN704710 (457/2008), JN704709 (1483/2005) which were of Clade 1,2,2,2,3,4,5,6,9 and VIII, respectively23.
VZV genotype analysis
Polymerase chain reaction (PCR) was used to amplify specific fragments of 447 bp24 in ORF22 region and 347 bp in ORF38 region25. The PCR products were purified and the nucleotide sequences were determined by Sangon Biotech (Shanghai) Co. Ltd. Five SNPs (37902, 38019, 38055, 38081, and 38177) in ORF22 and one SNP (69424) in ORF38 were genotyped according to the international universal genotyping scheme26. typed. the PCR amplification kit was performed using (GoTaq®Green Master Mix)
Determination sequence of the nine glycoproteins of VZV
Nine regions of glycoprotein ORFs were amplified by polymerase chain reaction (PCR) using GoTaq® Green Master Mix (Promega, USA) and primers (see Table 1 for primer sequences). The PCR products were purified and the nucleotide sequences were determined by Sangon Biotech (Shanghai) Co. Ltd. and edited by Sangon Biotech (Shanghai) to obtain the full sequence of each glycoprotein.
Bioinformatic Analysis
Multiple sequences were aligned using MEGA 6 software version 6. Bioedit 7.0 software was utilized to identify nucleotide mutation sites after alignment.
Ethics Statement
This study received approval from the Ethics Review Committee of China-Japan Union Hospital of Jilin University during its initial session and the Ethics Review Committee of the Jilin Province Center for Disease Control and Prevention.
Varicella Epidemic Profile
Varicella Epidemiologic Profile From 2005 through 2007, the reported incidence of varicella was consistently below 20/100,000. One death was reported in 2006 and one in 2007. from 2008 through 2012, the reported incidence exceeded 20/100,000 and peaked at 30.5/100,000 in 2009. two deaths were reported in 2008. From 2013 to 2016, the reported incidence rate dropped below 20/100,000 and no deaths were reported. 2017 to 2019, the reported incidence rate exceeded 20/100,000, peaking at 33.89/100,000 in 2019. 2020 to 2023, the reported incidence rate alternated between less than and more than 20/100,000. alternating. two deaths were reported in 2020 and 2021, respectively（Fig.1）.
VZV genotyping Clade
After Real Time quantitative PCR detecting, there were 38 positive specimens which SNP site 37902,38019,38055,38081,38177 and 69424 were G,G,C,C,A and G, respectively as same as Clade 2.
Variation of 9 glycoprotein nucleotide sites, amino acid sites, and potential N-glycation sites
The site variant analysis in this study used the nucleotide site of Dumas (NC001348) as the reference site, and the start position of each ORF of the nine glycoproteins was designated as nucleotide site 1. Potential N-glycosylation sites were predicted based on the amino acid sequences Asn-X-Ser/Thr (excluding Asn-Pro-Ser/Thr). As shown in Table 2, five of the specimens had a synonymous mutation at site 59355 (T59355C), which represents a potential N-glycosylation site (aa781-783: NAF) in gB. All specimens showed identical nucleotide variants in the following glycoproteins: gB (sites 57223 and 57396), gH (sites 66646, 66879 and 68172), gM (site 87841), gL (site 101331), gI (site 115041), gE (site 115926) and gC (sites 19719, 20656 and 20684). 87864), gL (site 101245 and 101290), gI (site 114587, 114734, 114955, and 115271), gE (site 115830 and 117676), and gC (site 19612, 19632, 19713, 197500, 20096, 20703, 21059, and 21062). 21062). Table 3 lists all the mutation sites. In gC, there is a repetitive region named R2, which consists of a 42-bp tandem sequence, repeats of all specimens were 5 to 12 (Table 4).
In this study, the incidence of varicella and multiple mutation sites in nine glycoproteins of VZV provide essential reference data for future evaluation of the safety, efficacy, and immunogenicity of existing vaccines. It is important for the development of VZV vaccines, clinical diagnosis, treatment, and the establishment of a national surveillance program for varicella and herpes zoster.
The statistics on varicella incidence show a gradual increase from a low incidence in 2005 to a first peak in 2009, which lasted for 2–3 years and then gradually declined to a moderate level of incidence in 2013 and lasted until 2016, and then increased again from 2017 and reached a second peak in 2019, but this peak did not last for 2–3 years, but rather declined rapidly to moderate incidence levels the following year and then took the form of a fluctuating yearly decline. Overall, there seems to be a characteristic of alternating fluctuations every 4–5 years, but perhaps due to the influence of the COVID-19 epidemic, this form of slow fluctuation was broken after 2019, and there was a characteristic of alternating high and low incidence decreases from year to year. In addition to this, deaths were reported in 2006, 2007 and 2008, as well as in 2020 and 2021, highlighting the sensitivity of the surveillance system. In China, where NNDRS clinicians are responsible for the initial diagnosis of varicella cases and the entry of case information, the introduction of the disease by healthcare workers and advice on vaccination, as well as home isolation measures during the new crown outbreaks, may have been the main reason for the decline in incidence. Therefore, it is also recommended that clinicians take the initiative to collect cyst fluid samples to provide basic data for studying the pathogenesis of breakthrough cases and VZV prevention and control at the molecular level 27–30.
VZV is an enveloped virus, and nine glycoproteins (gK, gN, gC, gB, gH, gM, gL, gI, and gE) are known to play roles in viral entry, egress, cell spread, attachment, replication, and envelopment. In this study, we collected cystic fluid from 38 patients with varicella or herpes zoster, extracted viral nucleic acids, and analyzed the nucleotide site variation of these nine glycoproteins.
gK, which plays an important role in viral replication, is hydrophobic and has multiple transmembrane structural domains6. Four sites exhibited synonymous mutations in gK from seven specimens, consistent with previous report indicating gK stability. gN is essential for the maturation of gM and promotes viral proliferation, syncytium formation, and cell-to-cell transmission when it forms a complex with gM. gN inactivation decreases viral titer and affects syncytium formation7. Mutations at two nucleotide sites were found in the gN of only one of the 38 samples, but they were synonymous and did not cause amino acid changes, suggesting that the gN in Jilin VZV viruses was relatively stable from 2010 to March 2024.
gB is responsible for the initial infection of viral particles upon entry into cells, plays an important role in viral adsorption and penetration 9, and is the second most abundant glycoprotein of VZV. It has been shown that gB of Singapore subgroup 2 strain (S2) is dominated by mutations at site 294 and 390, and Bangkok subgroup has no mutations31. While the reference strains pOka, YC01, Baike and Pasadena.USA showed mutations at three site: A217C, A294C and G390T. All the samples in the present study shared common nucleotide variants: A217C, A294C, G390T, which were the same as the reference strains pOka, YC01, Baike and Pasadena.USA, and similar to Singapore subgroup 2 strains, so there was no obvious attribution of this variant in terms of geographical distribution. Meanwhile, since all the samples in this study had these three identical variants, continuous monitoring is still needed to determine whether it is a strain-specific manifestation of the Jilin strain.
gH is the third most abundant glycoprotein in VZV, which induces the production of neutralizing antibodies in the organism and also mediates virus transmission between cells 10–12. In this study, G573T was present in all specimens and reference strains pOka, YC01, Baike and Pasadena.USA in Jilin province, a situation identical to that of the gB proteins A217C, A294C and G390T. In addition, C806T and G2099A appeared in all specimens from Jilin Province, which is different from the results of a previous study in China 32. C806T mutation site did not appear in one specimen from Guangdong Province, which is located on the southern coast of China, in 2009. Regardless of whether this result is related to geographic location, there is a need to expand the sample size for continuous monitoring, and it is recommended that more provinces participate in VZV studies, share sequences, and work together to monitor whether there is a consistent trend of variation at these mutant sites.
gM plays a role in virus transmission between cells 13–15. We also detected some gM variants in this study. First, the same C1267T site variant as the other nine reference strains pOka, YC01, Baike,03-500, M2DR, CA123, Pasadena.USA,457–2008,1483–2005 was found in all samples. This is in contrast to the absence of the 1267 site variant previously found in some specimens from four other provinces in China 33. Therefore, this is the first time that the C1267T site variant has been found in China. Secondly, the same mutation G112A, at site 112, occurred in three of the surveillance samples, and the time span of these three samples was eight years, and the same mutation at this site also appeared in the specimen from Shanghai in 2007 33. It is suggested that this mutation is not a de novo mutation and has a certain distribution in China.
VZV gL is a molecular chaperone of gH. gH:gL complex is required for gH maturation and membrane expression10, and the complex promotes cell membrane fusion, as well as the formation of a large number of multinuclei in transfected cells 12,35. There is evidence that membrane fusion is induced by a multiprotein core complex composed of gB and gH/gL complexes11. In the present study, we also detected variants concerning gL. The C162T site variant was present in all samples, identical to the pOka, YC01, Baike and Pasadena.USA reference strains. Secondly, a site variant of A76G was also detected, which also appeared in samples from Beijing in 2009, but has not been reported in China since then 33. Thirdly, an extra AGT codon was found in all the samples, which was the same as that in the reference strains Oka, YC01, M2DR, Pasadena.USA and 1483/2005, and further studies are needed to determine whether this variant affects the function of the proteins differently or even causes antigenic variability. It is noteworthy that the C162T site variant in gL, the A217C, A294C and G390T site variants in gB and the G573T site variant in gH are consistent with the site variants in the reference strains pOka, YC01, Baike and Pasadena.USA, which suggests that there is functional unity among gL, gB and gH.
gI plays a role in the maturation and distribution of gE to the cell surface17. It has been reported that the ORF of gI appears to be very stable and no gI mutations have been detected in vaccine strains 4. The vaccine strain Baike selected in this study showed a degenerate base A800R (A/G) at position 800, which may result in an N→D amino acid mutation at the corresponding amino acid site. In addition, the presence of a mutation at the A92G site in gI was identified in five samples, which spanned the period from 2010 to 2023, and it is noteworthy that A92G resulted in an amino acid change aaQ31R, but the effect of this alteration on its function is still unclear. Third, an alteration in C776T (aaS259F) was seen in one sample in 2015 but not in other years and has not been reported, so it may be a transient occurrence. Fourth, analysis of gI also revealed variants at the T239C and A460C, with T239C leading to the V→A amino acid mutation. Moreover, these 2 variants appeared after the COVID-19 epidemic, so whether these 2 new site variants are related to COVID-19 infection has not been similarly reported. In conclusion, the appearance of these missense mutation sites suggests that not only vaccine strains but also wild strains should be better monitored for VZV gI stability.
gE is the most abundant glycoprotein in VZV and plays an essential role in viral replication, assembly and mediation of VZV cell-to-cell transmission17. It stimulates the production of neutralizing antibodies and cell-mediated immune responses, with major antigenic epitopes located in the 1-161 amino acid fragment. Among them, regions 11–30, 71–90, 91–110 and 106–125 elicited the strongest cellular immune responses36–37. In the present study, the C119T (aaT40I) mutation was present in all reference strains and specimens from Jilin province, except for the Dumas strain, which is consistent with previous reports 27,38–41. Unlike the missense mutation in aaD150N 42, none of the synonymous mutations in T660C appeared43. Neither the T23C (aaV8A) nor G1869A mutations that appeared were found within the epitope. This indicates that the VZV gE epitope of the samples in this study is highly conserved.
The gC is thought to be critical for VZV replication in the skin8. It contains the R2 region that is essential for virus attachment 44. Previously reported R2 structures include ABABAAx (Dumas, NC01348), AAABBBBx (MSP, AY548170), and ABBBBAAx (BC, AY548171) 42. five nucleotide sequence combinations of the R2 region yield four amino acid sequence combinations A, B, C, D, E [Table 4]. The combination of E was found only in the selected reference strain Baike due to the presence of concatenated base C1273Y (C/T) in the gC of Baike, which suggests that Baike should be subjected to continuous monitoring of nucleotide site variation and evaluation of immunization efficacy. In addition, this study identified 5 to 12 repetitive sequences in the R2 region, with cases of 5 repetitions observed in 2014, 2022, and 2023. It is noteworthy that during these years, measles outbreaks occurred in Jilin Province in 2014 and COVID-19 outbreaks occurred in 2022 and early 2023. Whether the number of sequence repeats in the R2 region was suppressed due to epidemics of other viruses needs to be further investigated.2024 One case of VZV infection with a repeat number of 12 was observed in January 2024 in a pregnant woman who had severe symptoms of cutaneous herpes and was not receiving medication. These changes described above may reflect the impact of concurrent infectious disease epidemics and human interventions on VZV replication in the skin, and clinicians are advised to consider the epidemiologic context when evaluating VZV cases.
In addition, our study of the gC region revealed the presence of three nucleotide mutation sites outside of the R2 region, namely A289G, T1226A, and T1254C. The common feature of these three nucleotide mutation sites is that they are present in samples of the reference strains pOka, YC01, Baike, and Pasadena.USA and in all of the Jilin province, which at least suggests that these three mutated nucleotide sites are are not unique to the Northeast Asian geographic region, but are perhaps specific to Jilin Province, which will require continuous monitoring in the future to support this conclusion. In addition to the three nucleotide mutation sites mentioned above, two nucleotide variants of CA123, C666T (aaA→T); T1629C (aaT→A), were found in two specimens from Jilin Province, respectively, in this study. Previously, VZV with both Clade1 and Clade3 characteristics was reported in Changchun City, Jilin Province40, and CA123 was Clade 5 on genetic branching, but the specimens from Jilin Province in the present study were Clade 2, which suggested that, in addition to serial testing of VZV from the perspective of molecular biology, emphasis should be placed on molecular epidemiological surveillance.
The VZV genome has an estimated mutation rate of 10^-6–10^-7/site/year and is highly conserved 45. In this study, the researchers found that four mutated nucleotide sites appeared only once before the COVID-19 epidemic, while 12 mutated nucleotide sites were found for the first time after the COVID-19 epidemic. Given that nucleotide mutations in COVID-19 continue and its spread has not ceased, the effect of COVID-19 on VZV nucleotide mutations remains to be confirmed. Healthcare professionals are encouraged to test patients for COVID-19 infection when collecting blister fluid specimens.
The mechanism of attenuation of the live attenuated varicella-zoster vaccine remains incompletely understood. In a previous study, the varicella vaccine (Oka-Merck) was approximately 85% effective in healthy children, with less than 5% developing a mild vesicular rash 46. Another study reported that the incidence of breakthrough cases (rash more than 42 days after vaccination) increased as the duration of vaccination increased 47. Unfortunately, no vaccine-associated cases or breakthrough cases were monitored in this study. Therefore, clinicians should strengthen the inquiry and registration of vaccination information when seeing patients, whether they are varicella patients or herpes zoster patients, and collect specimens in a timely manner in order to further study the attenuation mechanism of VZV envelope glycoprotein at the molecular level.
In conclusion, this study reviewed the varicella epidemics in Jilin Province from 2005 to March 2024, and analyzed the nucleotide site mutations of nine VZV envelop glycoproteins known to occur in Jilin Province from 2010 to March 2024. Considering the measles prevention and control strategy in China 48, it is believed that accelerating or facilitating the development of a national strategy for the prevention and control of VZV transmission and mobilizing the whole society will benefit more people.
Acknowledgments
The authors thank the epidemiologists for collection and integration of the epidemiological data. This work was supported by the Key Laboratory of Viruses of Jilin Provincial Health Commission(2023GW005), the Vaccination and Immunization Youth Talent Elevation Program of Chinese Preventive Medicine Association (20190206) and Horizontal joint project of Jilin University（2021YX0547）.
Author contributions
In this paper, Li Xiran and Li Xiang performed experiments and wrote the main manuscript text. Sun Hongyan, Qin Guixiang and Sun Ying collected samples. Tian Xin and Han Mengying analyzed study data. Wang Ji and Ji Shangwei designed the experiment, revised the paper, collected samples and participated in experiments. All authors reviewed the manuscript.
Competing interests
The authors declare no competing interests.
Statement
Informed consent has been obtained from all subjects and / or their legal guardians for this study.
All methods were carried out in accordance with National Guidelines for the Diagnosis and Treatment of Varicella and Global consensus on VZV genotyping (2017).
Data availability
The datasets used and analyzed during the present study are available from the corresponding author on reasonable request.
Sequence data of gK, gN, gB, gH, gM, gL, gI, gE and gC which support the findings of this study have been deposited in the Genbank with the accession Number:PQ039870 - PQ039907，PQ039908 - PQ039945,PQ039946 - PQ039983,PQ039984 - PQ040021
,PQ040022 - PQ040059,PQ040060 - PQ040097,PQ040098 - PQ040135,PQ040136 - PQ040173,PQ040174 - PQ040211,respectively.
- Breuer J, Grose C, Norberg P, Tipples G, Schmid DS. A proposal for a common nomenclature for viral clades that form the species varicella-zoster virus: summary of VZV Nomenclature Meeting 2008, Barts and the London School of Medicine and Dentistry, 24-25 July 2008. J. Gen. Virol. 91,821-828(2010).
- Davison AJ, Scott JE. The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67 ,1759-1816(1986).
- Takada M, Suzutani T, Yoshida I, Matoba M, Azuma M. Identification of varicella-zoster virus strains by PCR analysis of three repeat elements and a PstI-site-less region. J Clin Microbiol. 33, 658-60(1995).
- Lenac Roviš T, et al. Comprehensive analysis of varicella-zoster virus proteins using a new monoclonal antibody collection. J Virol. 87,943-954(2013).
- Storlie J, Maresova L, Jackson W, Grose C. Comparative analyses of the 9 glycoprotein genes found in wild-type and vaccine strains of varicella-zoster virus. J Infect Dis. 197, 49-53(2008).
- Mo C, Suen J, Sommer M, Arvin A. Characterization of Varicella-Zoster virus glycoprotein K (open reading frame 5) and its role in virus growth. J Virol. 73,4197-4207(1999).
- Ross J, Williams M, Cohen JI. Disruption of the varicella-zoster virus dUTPase and the adjacent ORF9A gene results in impaired growth and reduced syncytia formation in vitro. Virology. 234,186-195(1997).
- Kinchington PR, Ling P, Pensiero M, Moss B, Ruyechan WT, Hay J. The glycoprotein products of varicella-zoster virus gene 14 and their defective accumulation in a vaccine strain (Oka). J Virol. 64,4540-4548(1990).
- Moffat JF, Zerboni L, Kinchington PR, Grose C, Kaneshima H, Arvin AM. Attenuation of the vaccine Oka strain of varicella-zoster virus and role of glycoprotein C in alphaherpesvirus virulence demonstrated in the SCID-hu mouse. J Virol. 72,965-974(1998).
- Maresova L, Pasieka TJ, Grose C. Varicella-zoster Virus gB and gE coexpression, but not gB or gE alone, leads to abundant fusion and syncytium formation equivalent to those from gH and gL coexpression. J Virol. 75,9483-9492(2001).
- Forghani B, Ni L, Grose C. Neutralization epitope of the varicella-zoster virus gH:gL glycoprotein complex. Virology. 199,458-462(1994).
- Vleck SE, et al. Structure-function analysis of varicella-zoster virus glycoprotein H identifies domain-specific roles for fusion and skin tropism. Proc Natl Acad Sci USA. 108,18412-18417(2011).
- Duus KM, Grose C. Multiple regulatory effects of varicella-zoster virus (VZV) gL on trafficking patterns and fusogenic properties of VZV gH. J Virol. 70,8961-8971(1996).
- Mori Y, Sadaoka T. Varicella-zoster virus glycoprotein M. Curr Top Microbiol Immunol. 342,147-54(2010).
- Sadaoka T, Yanagi T, Yamanishi K, Mori Y. Characterization of the varicella-zoster virus ORF50 gene, which encodes glycoprotein M. J Virol. 84,3488-3502(2010).
- Yamagishi Y, et al. Varicella-zoster virus glycoprotein M homolog is glycosylated, is expressed on the viral envelope, and functions in virus cell-to-cell spread. J Virol. 82,795-804(2008).
- Olson JK, Grose C. Complex formation facilitates endocytosis of the varicella-zoster virus gE:gI Fc receptor. J Virol. 72,1542-1551(1998).
- Mo C, Lee J, Sommer M, Grose C, Arvin AM. The requirement of varicella zoster virus glycoprotein E (gE) for viral replication and effects of glycoprotein I on gE in melanoma cells. Virology. 304,176-186(2002).
- Loparev VN, et al. Global identification of three major genotypes of varicella-zoster virus: longitudinal clustering and strategies for genotyping. J Virol. 78,8349-8358(2004).
- Li J, et al. Genomic sequencing revealed recombination event between clade 1 and clade 2 occurs in circulating varicella-zoster virus in China. Braz J Microbiol.55,125-132(2023).
- Camacho J, et al. Mutations in Coding and Non-Coding Regions in Varicella-Zoster Virus Causing Fatal Hemorrhagic Fever Without Rash in an Immunocompetent Patient: Case Report. Infect Dis Ther. 12,2621-2630(2023).
- Varicella and herpes zoster vaccines: WHO position paper, June 2014--Recommendations. Vaccine. 34,198-199(2016).
- Guo H, et al. Metagenomic analysis of a throat swab sample collected in China on a patient infected with Varicella Zoster Virus. Sci Rep. 11,13874(2016)
- Loparev VN, et al. Global identification of three major genotypes of varicella-zoster virus: longitudinal clustering and strategies for genotyping. J Virol. 78,8349-8358(2004).
- Jin L, Xu S, Maple PAC, Xu W, Brown KE. Differentiation between wild-type and vaccines strains of varicella zoster virus (VZV) based on four single nucleotide polymorphisms. Epidemiol Infect. 145,2618-2625(2017).
- Jensen NJ, et al. Revisiting the genotyping scheme for varicella-zoster viruses based on whole-genome comparisons. J Gen Virol. 98,1434-1438(2017).
- Xu Yuyang, et al. Investigation of a varicella aggregation epidemic in the ICU caused by nursing herpes zoster patient. Preventive Medicine. 28,1047-1048+1051(2016)
- Cui Weijun. Investigation and analysis of nosocomial aggregated varicella caused by herpes zoster. Journal of Aerospace Medicine.29,351-352(2018)
- Sun Cuiqun, et al. Investigation and treatment of an outbreak of varicella caused by nursing herpes zoster patient. Chinese Journal of Infection Control.18,1150-1153(2019).
- Xing Fanfan, et al. Investigation of two incidents of nosocomial varicella of hospital staff originating from herpes zoster. Journal of Practical Shock.5,371-374(2021)
- Wagenaar TR, Chow VT, Buranathai C, Thawatsupha P, Grose C. Africa model of varicella-zoster virus evolution: single nucleotide polymorphisms and private alleles distinguish Asian clades from European/North American clades. Vaccine.21,1072-1081(2003).
- QI Mengyuan, et al. Characterization of Glycoprotein Genes of the Varicella Zoster Virus in Six Chinese Provinces. Chinese Journal of Virology. 33,156-162(2017)
- Mou Junjie, et al. Characterization analysis of gM, gL gene of varicella zoster virus in six provinces of China. Chin J Prev Med, 52,419-423(2017)
- Hu Feng-jiao, et al. Varicella cases monitoring and epidemic strains gene polymorphism analysis in Ningbo, Zhejiang. Inter J Epidemiol Infect Dis. 40,254-257(2013)
- Duus KM, Hatfield C, Grose C. Cell surface expression and fusion by the varicella-zoster virus gH:gL glycoprotein complex: analysis by laser scanning confocal microscopy. Virology. 210,429-440(1995).
- Fowler WJ, et al. Identification of immunodominant regions and linear B cell epitopes of the gE envelope protein of varicella-zoster virus. Virology. 214,531-40(1995).
- Garcia-Valcarcel M, Fowler WJ, Harper DR, Jeffries DJ, Layton GT. Induction of neutralizing antibody and T-cell responses to varicella-zoster virus (VZV) using Ty-virus-like particles carrying fragments of glycoprotein E (gE). Vaccine. 15,709-719(1997).
- Faga B, Maury W, Bruckner DA, Grose C. Identification and mapping of single nucleotide polymorphisms in the varicella-zoster virus genome. Virology. 280,1-6(2001).
- Schmidt-Chanasit J, Bleymehl K, Schäd SG, Gross G, Ulrich RG, Doerr HW. Novel varicella-zoster virus glycoprotein E gene mutations associated with genotypes A and D. J Clin Microbiol. 46,325-327(2008).
- Jiang Longfeng, et al. Sequence analysis of varicella-zoster virus gE Gene in Varicella-zoster Virus strains with different clades. Chinese Journal of Virology. 29,112-118(2013)
- Wu Qiuha, et al. Genetic Characterization of the gE Gene of 12 Case Varicella-zoster virus in six provinces of China. Chinese Journal of Virology. 34,877-883(2018)
- Grose C, et al. Complete DNA sequence analyses of the first two varicella-zoster virus glycoprotein E (D150N) mutant viruses found in North America: evolution of genotypes with an accelerated cell spread phenotype. J Virol. 78,6799-6807(2004).
- Shankar V, Fisher S, Forghani B, Vafai A. Nucleotide sequence analysis of varicella-zoster virus glycoprotein E epitope coding regions. Vaccine. 19,3830-3833(2004).
- Jensen NJ, et al. Analysis of the reiteration regions (R1 to R5) of varicella-zoster virus. Virology. 546:38-50(2020).
- Muir WB, Nichols R, Breuer J. Phylogenetic analysis of varicella-zoster virus: evidence of intercontinental spread of genotypes and recombination. J Virol. 76,1971-1979(2002).
- Zerboni L, et al. Analysis of varicella zoster virus attenuation by evaluation of chimeric parent Oka/vaccine Oka recombinant viruses in skin xenografts in the SCIDhu mouse model. Virology. 332,337-346(2005).
- Chaves SS, et al. Loss of vaccine-induced immunity to varicella over time. N Engl J Med. 356,1121-1129(2007).
- Wang H, et al. Transmission Pattern of Measles Virus Circulating in China During 1993-2021: Genotyping Evidence Supports That China Is Approaching Measles Elimination. Clin Infect Dis. 76,e1140-e1149(2023).
Table 1. Primers for 9 glycoproteins
|
VZV glycoprotein |
Primer |
Sequence(5’-3’) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
gK
gN
gC
gB
gH
gM
gL
gI
gE |
|
|
Table 2. The predict potential N-glycation sites of 9 glycoprotein. “*” means 5 specimens had synonymous mutation in this potential N-type glycosylation site.
|
|
length(bp) |
encoding amino acids |
potential site for N-linked glycation |
comment |
|
1023 |
340 |
aa55-57:NNS |
||
|
aa65-67:NHS |
||||
|
gN |
264 |
88 |
none |
|
|
gB |
2607 |
869 |
aa84 - 86:NFT |
|
|
aa194-196:NDT |
||||
|
aa372-374:NSS |
||||
|
aa440-442:NRT |
||||
|
aa557-559:NGS |
||||
|
aa623-625:NLT |
||||
|
aa781-783:NAT |
* |
|||
|
aa836-838:NKT |
||||
|
aa864-866:NVT |
||||
|
gH |
2526 |
842 |
aa18 - 20:NKS |
|
|
aa45 - 47:NMS |
||||
|
aa217-219:NST |
||||
|
aa317-319:NFS |
||||
|
aa522-524:NSS |
||||
|
aa760-762:NST |
||||
|
aa783-785:NGT |
||||
|
gM |
1308 |
436 |
aa80 - 82:NAT |
|
|
aa413-415:NDS |
||||
|
gL |
480 |
160 |
aa66 - 68:NLS |
|
|
gI |
1065 |
355 |
aa33 - 35:NSS |
|
|
aa67 - 69:NYS |
||||
|
aa116-118:NST |
||||
|
aa320-322:NAT |
||||
|
gE |
1872 |
624 |
aa266-268:NTS |
|
|
aa577-579:NQS |
||||
|
gC |
1557-1893 |
519-631 |
aa206-208:NIT |
|
|
aa325-327:NIT |
||||
|
aa344-346:NVS |
||||
|
aa432-434:NVS |
||||
|
|
|
|
aa461-463:NDS |
|
Table 3. List of nucleotide mutation sites of 9 glycoprotein.The “·”means no mutation. Data between parentheses means amino acid mutation.The”---” means base deletion(ATC)
Table 4. List of the sequence of nucleotide and amino acid in R2. “_” means final 32-bp sequence was named a, b, c, d and e.
|
named structrue |
Repeating sequence |
|
|
Nucleotide |
Amino acid |
|
|
A/a |
GCGGGATCGGGCTTTCGGGAAGCGGCCGAGGTGGGCGCGACG |
AVAPTSAASRKPDPA |
|
B/b |
GCGGGATCGGGCTTTCGGGTAGCGGCCGAGGTGGGCGCGACG |
AVAPTSAATRKPDPA |
|
C/c |
GCGGGATCGGGATTTCGGGAAGCGGCCGAGGTGGGCGCGACG |
AVAPTSAASRNPDPA |
|
D/d |
GCGGGATCGGGATTTCGGGTAGCGGCCGAGGTGGGCGCGACG |
AVAPTSAATRNPDPA |
|
E/e |
GCGGGATCGGGTTTTCGGGTAGCGGCCGAGGTGGGCGCGACG |
AVAPTSAATRKPDPA |
No competing interests reported.