Animals and drugs
Male albino CD-1 mice (ENVIGO, Barcelona, Spain), wild-type (WT) mice, σ2R-/- (allele name Tmem97tm1.1(KOMP)Vlcg) and σ1R-/- mice were used in the study. The genetically modified σ2R-/- mice were on the C57BL/6NTac background and were originally purchased from UC Davis KOMP Repository (MMRRC Stock #: 050148-UCD, Davis, CA, USA). σ1R-/- mice were backcrossed (N10 generation) onto a CD1 albino genetic background were obtained from (ENVIGO, Milano, Italy). The mice used in these experiments were produced from heterozygous breeding pairs and assigned randomly to be used for the different experiments. The σ2R-/- mice exhibited no noticeable differences from their WT littermates with respect to appearance, body size, or morphologic parameters. The genotypes of the WT and σ2R-/- mice were confirmed by PCR. Each DNA sample was amplified using two sets of primers and a PCR thermocycler (Eppendorf Iberica SLU, Madrid, Spain). One set of primers consisted of Reg-Tmem97-wtF (AGAGTAAAGGGCTAGCCAGGAAACC) and Reg-Tmem97-wtR (GGTGTCACACACCTTTAATCCCAGC). This set was responsible for amplifying the WT sequence (320 bp). The second set consisted of Reg-LacF (ACTTGCTTTAAAAAACCTCCCACA) and Reg-Tmem97-R (TCCTTCCCTGTAACCCATTTCTGGC). This set of PCR primers was responsible for amplifying the deleted sequence (722 bp). Each DNA sample was run with both sets of primers (Sigma‐Aldrich, Madrid, Spain) to determine whether the mice were WT, σ2R-/- or heterozygous. The PCR thermal cycling protocol included two steps. The first step was as follows: denaturation at 94°C for 15 s followed by 65°C for 30 s and then 72°C for 40 s. This series was repeated for 10 cycles, with the second temperature decreasing by 1°C each cycle. Directly following the first step, the second step was performed as follows: denaturation at 94°C for 15 s followed by 55°C for 30 s and 72°C for 40 s. The second step was repeated for 30 cycles, and a final elongation at 72°C for 5 min was performed.
All mouse housing, breeding and experimental protocols were performed in strict accordance with the guidelines of the European Community for the Care and Use of Laboratory Animals (Council Directive 2010/63/EU) and Spanish law (RD53/2013) regulating animal research. The use of drugs, experimental design and sample size determination were approved by the Ethical Committee for Research of the CSIC (SAF2015–65420 & CAM PROEX 225/14). The mice were maintained at 22 °C on a diurnal 12-h light/dark cycle and provided free access to food and water. Male mice were specifically selected to avoid the potentially confounding variable of the female estrus cycle. To reduce the risk of social stress, mice from the same litter were grouped together and remained in these groups throughout the study. The mice were also provided extra space for comfort, as well as nesting material (e.g., soft paper and cardboard refuge) and small pieces of chewable wood. The experiments were performed in different cohorts of mice to avoid any variations caused by handling stress. The mice were used when they were between the ages of 6 and 10 weeks. All attempts were made to minimize the number of mice used in each experiment.
Behavioral outcomes
Before behavioral testing began, we allowed the mice to familiarize themselves with the testing room for two consecutive days (60 min/day). On the day of testing, we transferred the mice to the testing room 30 min prior to the test session. To prevent potential changes in behavior, we performed each test on a different cohort of animals. Initial screening included body weight and contact-righting reflex measurements.
Exploratory behavior. This test was performed in a 14 × 14 inch arena with a lattice containig 16 holes in the floor (Cibertec, Madrid, Spain). The arena was fitted with photocells to count the number of hole pokes during each 10 min trial. In addition, rearing, center activity, and peripheral activity were also recorded. A variation in exploratory behavior was defined as a change in the number of hole pokes without a change in the other activities.
Spontaneous activity. The mice were tested individually using 20-cm ×20-cm × 28-cm transparent plastic automated activity monitors (Accuscan activity analyzer -Versamax 260 v2.4; Omnitech Electronics, Inc., OH, USA). Infrared beam crossings were recorded for 100 min at 10 min intervals. At the end of each session, the mice were returned to their home cages, and the boxes were wiped clean with a 10% alcohol solution.
Rota-Rod. Motor coordination was measured using an accelerated rotarod (Ugo Basile). Each animal was trained to use the rotarod at a constant acceleration over six 5-min sessions with an interval of 20 min between trials. On the following days, the mice were again tested, and the time to fall from the rod was measured with a cutoff time of 5 min.
Passive avoidance task. The acquisition and retention of passive avoidance behaviors were examined using identical illuminated and non-illuminated (20-cm3 × 10-cm3 × 15-cm3) boxes separated by a guillotine door (5-cm2 × 5-cm2) as previously described [23]. Each mice participated in two separate trials. First, in the acquisition trial, each mouse was initially placed in the light compartment, and the door between the two compartments was opened after 10 s. When the mouse entered the dark compartment, the guillotine door automatically closed, and an electrical foot shock (0.5 mA, 3 s) was delivered through the floor. The latency time to enter the dark chamber was recorded. Only mice that entered the dark chamber within 60 s were subjected to a retention trial. For the retention trial, each mouse was again placed in the light compartment, and the latency to enter the dark compartment was recorded (up to 10 min).
Nerve injury pain model
After the basal mechanical sensitivity of the mice was tested, neuropathic pain was induced by chronic sciatic nerve constriction injury (CCI) surgery under isoflurane/oxygen anesthesia [24] using the procedure described by Bennett and Xie [25] a modifications. Briefly, a 0.5-cm incision was made in the right midthigh, the biceps femoris muscle was separated, and the sciatic nerve was exposed proximal to its trifurcation. Two ligatures (5/0 braided silk suture; Lorca Marin, Murcia, Spain, 70014) were tied around this nerve approximately 1 mm apart until a short flick of the ipsilateral hind limb was observed. The incision was then closed in layers with a 4-0 Ethicon silk suture. The same procedure was used for sham surgery except that the sciatic nerve was exposed but not ligated. The tactile pain threshold of both the ipsilateral and contralateral hind paws were then assessed on days 0, 3, 7, and 12 post-surgery. The mice were individually placed in a transparent plastic cage with a wire mesh bottom that allowed full access to the paws. After a habituation period of 20 min, a mechanical stimulus was delivered to the plantar surface from below the floor of the test chamber to measure allodynia using an automatic von Frey apparatus (Ugo Basile #37450, Comerio, Italy). A steel rod (0.5 mm diameter) was pushed against the hind paw over a 10-s period as the force increased from 0 to 10 g. When the mouse withdrew its hind paw, the mechanical stimulus was automatically stopped, and the force at which withdrawal occurred was recorded. At each time point, three separate threshold measurements were obtained from each hind paw and then averaged.
Evaluation of antinociception and acute tolerance.
The response of the animals to nociceptive stimuli was determined by the warm water (52°C) tail-flick test as previously described [22,26]. In this tail-flick analgesic test, a thermal noxious stimulus is applied to promote flicking of the mouse’s tail, and opioids given intracerebroventricularly (icv) increase the time elapsed between application of the stimulus and the flick. This response involves a spinal reflex that is facilitated by the brain stem nociceptive modulating network. Baseline latencies ranged from 1.6 to 2.1 s. A cut-off time of 10 s was used to minimize the risk of tissue damage. Drugs were icv injected into the lateral ventricles in a volume of 4 μl, and antinociception was assessed at different time intervals thereafter. Saline was likewise administered as a control. Antinociception is expressed as a percentage of the maximum possible effect (MPE = 100 × [test latency-baseline latency]/[cut-off time (10 s)-baseline latency]).
The development of morphine acute tolerance was monitored when a priming dose of 10 nmol (WT mice) or 30 nmol (σ2R-/- mice) had no effect on baseline latencies. Thus, 24 h later, a test dose of morphine was injected icv and analgesia was measured at the post-injection interval of 30 min.
The compounds used were morphine sulfate (Merck, Darmstadt, Germany); β-endorphin (GenScript, USA); DAMGO (# 1171, Tocris); DPDPE (#1431, Tocris); WIN55,212-2 (#1038, Tocris); clonidine (#0690, Tocris). S1RA: 4-[2-[[5-methyl-1-(2-naphthalenyl)-1H-pyrazol-3-yl]oxy]ethyl] morpholine), was obtained from Esteve Pharmaceuticals (Barcelona, Spain). To facilitate selective and direct access to their targets, the compounds were each injected into the lateral ventricles of mice in a volume of 4-μL volume as previously described [22,26]. The animals were lightly anesthetized, and the drugs were injected icv 2 mm lateral and 2 mm caudal from bregma, and at a depth of 3 mm with a 10-μL Hamilton syringe. The drugs were infused at a rate of 1 μL every 5 s. After that, the needle was maintained for an additional 10 s. Eight to 10 mice were treated with each compound. Test drugs were dissolved in saline, and the doses and treatment intervals were selected based on previous studies and pilot assays. The motor performance of mice administered the solvents used was identical to non-injected animals.
In a series of experiments, the expression of σ2R was reduced by subchronic administration of synthetic end-capped phosphorothioate antisense oligodeoxy-nucleotides (GenScrit, USA). The ODN σ2R was 5’ A*C*GACTG GCAAGCCGGTGAT*A*G 3’ (adapted from [27]). A random ODN (ODN RD) served as a control [26,28]. The animals were injected with either the vehicle, ODN RD or antisense oligodeoxynucleotide into the right lateral ventricle over a 5-day period. On day 6, the analgesic compounds were injected icv, and the antinociceptive activity evaluated.
Reverse-transcription (RT)-PCR.
Total RNA was isolated by using TRIzol Reagent (Invitrogen, USA) and first-strand cDNA was prepared from total RNA with an oligo(dT) 18 primer and AMV reverse transcriptase (BioFlux, Japan) according to the manufacturer's instructions. The primers used for subsequent PCR were, σ2R: 5'-GCGTGCGATCGCCGGGGCCCTGGCAGCT AGGC-3' (forward) and 5'-TTGTGTTTAAACTTTTTTCTTTCTTTTCTCCTCATA CTTGT-3 (reverse); σ1R: 5´-ATTGGCGATCGCCCCGTGGGCCGCGGGACGG-3´ (forward) and 5´-ATTAGTTTAAACGGAGTCTTGGCCAAAGAGGTAG-3´(reverse); HINT1: 5´-GGCTGCGATCGCCGCTGACGAGATTGCCAAG-3´ (forward) and 5´- GTCGGTTTAAACACCAGGAGGCCAGTTCATCT-3´ (reverse); MOR: 5´-AGG AGCGATCGCCGCTGTATTTATTGTCTGCTGGACC-3´ (forward) and 5´-GCGA GTTTAAACGGGCAATGGAGCAGTTTCTGCTT-3´ (reverse); GAPDH: 5´-CATC ACCATCTTCCAGGAGC-3´ (forward) and 5´-ATCACAAACATGGGGGCATCG-3´ (reverse). The PCR products were electrophoresed on 2% agarose gel, stained with ethidium bromide, and visualized under UV illumination. The intensities of the specific bands were analyzed and quantified.
Statistical analysis
Graphs were constructed and statistical analyses were performed using Sigmaplot v.14 (SPSS Science Software). The data were analyzed using 2-way ANOVA with genotype and treatment as main factors. A significant interaction was detected for all experiments, and the follow-up analysis involved 1-way ANOVAs for each genotype and treatment followed by all pairwise Holm-Sidak multiple comparison tests, as indicated in the figure legends. Statistical significance was defined as p<0.05.