Experimental Animals and Ethical Approval
Sprague-Dawley rats (male, 7-8 weeks old, 200-250 g) were purchased (Samtako Inc. Seoul, Korea, RRID:RGD:737903) and maintained in ventilated animal room with regulated temperature (22-23°C), 60% humidity under a standard 12 hour light and 12 hour dark cycle (light on from7:00 am to 7:00 pm). Animals were freely accessed to food pellets (Samyang Co., Seoul, Korea) and water. Total number of animals used for individual experiments are listed in Table 1. No experimental animals died during the experiments and any animals were not excluded in this study from analyses. Animal care and all experimental procedures were in accordance with the NIH Guide for the Care and Use of Laboratory Animals and also approved by the Committee on Use of Live Animals for Teaching and Research at Daejeon University (approval number: DJUARB2019-029, Daejeon, Korea). The authors complied with the ethical principles as outlined in Grundy (2015)
Drug administration
Rats were anesthetized by inhalation of isoflurane (2%; Hana Pharm Co., Ltd., Seoul, Korea) during CAP or vehicle injection. In order to minimize pain caused by CAP, 6 ml of atropine sulfate (0.5 mg/ml, Jeil Pharmaceutical Co., Daegu, Korea) was injected i.p., 20-30 min prior to CAP injection. CAP (Cayman Chemical Co., Ann Arbor, MI, USA) was dissolved in 10% ethanol, 10% Tween-80 and 0.9% NaCl and was injected i.p. with 40 mg/kg and supplemented with 80 mg/kg twice at 6 h and 24 h after the initial injection as a high-dose regimen (CAP-H) or injected initial 20 mg and supplemented 40 mg/kg twice at 6 h and 24 h later as a low-dose regimen (CAP-L) (Czaja et al. 2008). Volumes of CAP injected to individual animals were evenly adjusted as 1 ml per kg body weight. Equivalent volume of vehicle solution (VEH, 10% ethanol, 10% Tween-80 and 0.9% NaCl) was injected into the control animals. Three days later, animals were subjected to experiments of ConA and hVNS. Efficacy of CAP administration was examined by eye wiping test. CAP was injected into rats with high-dose regimen as described above, and eye wiping behavior was measured 3 days after the initial injection by counting the frequency of eye wiping for 5 min period. Concanavalin A (ConA; 7.5 mg/ml in saline, Sigma-Aldrich, St. Louis, MO, USA) was intravenously injected into the tail with a dose of 15 mg/kg.
In order to inhibit α7 nAChR in the liver, rats were anesthetized with ketamine and (80 mg kg-1; Yuhan, Seoul, Korea, Cat #8806421050707) and xylazine (5 mg kg-1; Bayer, Leverkusen, Germany, Cat. #KR02315). A combined injection induced a stable anesthetic state for about 1 hour, which is an optimal time period to perform the surgery experiment without causing animals’ pain and suffering. The use of ketamine, an antipsychotic drug, has been approved by the Korea Ministry of Food and Drug Administration (Cheongju, Korea, Approval number: DJURFDA-130). Methyllycaconitine citrate salt (MLA; 5 mg/kg in saline, i.p. M168, Sigma-Aldrich), a selective α7 nAChR antagonist was ip injected 20 min prior to hVNS (Tyagi et al., 2010). A mixture (0.5 μl) of MMDA receptor blocker DL-2-Amino-5-phosphonopentanoic acid (AP-5, 20 μg/μl, A5282 , Sigma-Aldrich) and AMPA receptor blocker 6-Cyano-7-nitroquinoxaline2,3-dione (CNQX, 1 μg/μl, C239, Sigma-Aldrich) in saline (0.9%) was bilaterally injected into the area of DMV (coordinate AP: -14 mm; L: ±0.6 mm; DV: -8.4 mm) (Paxinos and Watson, 1998) with a flow rate of 0.16 μl /min by using a micropump (Pump 11 Elite, Harvard Apparatus, Massachusetts, USA) (Ouagazzal et al., 1995; Lim et al., 2016). The injection needle remained penetrated for 3 min after drug injection to prevent inverse flow of injected drugs and also to allow injected drugs to diffuse into the surrounding area. Animals were subjected to hVNS experiment 20 min later.
Vagus nerve stimulation and hepatic vagotomy
Rats were anesthetized with ketamine and xylazine with the same dose above. The abdomen was incised, the middle, left and right lateral lobes of liver were lifted up, and the stomach was retracted to expose the common hepatic branch of the vagus nerve that is branched out from the ventral vagal trunk (Berthoud and Neuhuber, 2000). Common hepatic branch of the vagus nerve is composed of the majority of afferent and minor efferent fibers with myelinated and unmyelinated axons (Prechtl and Powley, 2000). We exposed and placed the middle portion of the common hepatic branch of the vagus nerve (~ 2 mm proximal to the location that is divided into hepatic branch proper, portal vein, and gastroduodenal branches) into a U- shape of a bipolar electrode of tungsten wire (250 μm diameter, A-M Systems Inc., Sequim, WA, USA). The electrical current (10 mA, 5 Hz, 5 ms of pulse duration, 5 min) was applied by using the isolated pulse stimulator (model 2100, A-M Systems Inc., Sequim, WA, USA). Our previous study showed that the same stimulation protocol for the acute and chronic VNS at the cervical level was effective to induce the activation of neurons in the dorsal raphe nucleus and the hippocampal neurons in rats (Shin et al. 2019). After hVNS, the abdomen was closed by 5-0 nylon suture, and animals were returned to animal room and sacrificed 1 – 3 days later. Sham treatment for hVNS was done by exposing the hepatic branch of the vagus nerve in anesthetized rats and suturing the skin without applying electrical stimulation. Animals underwent the same recovery procedure as hVNS group animals. The animals were sacrificed with an overdose of ketamine (150 mg kg-1, i.p.). Vagotomy of the hepatic vagal branch (hVNX) in rats was conducted as described previously (Izumi et al., 2018). Briefly, abdominal wall was excised and hepatic branch of the vagus nerve was exposed beneath the liver by using the same procedure as described above. Immediately after cutting around the middle portion of the hepatic vagus nerve, the distal portion of the cut nerve was carefully placed into a bipolar hook electrode of tungsten wire (250 μm diameter, A-M Systems Inc., Sequim, WA, USA). The location of electrical situation and stimulation intensity were essentially the same as described above. Abdominal wall was sutured and animal was sacrificed 24 h later.
Retrograde tracing
In order to identify vagal sensory neurons in the nodose ganglion (NG) innervating the liver tissue in rats, we performed a retrograde tracing experiment. Animals were anesthetized with ketamine (80 mg kg-1) and xylazine (5 mg kg-1), and 1,1′-Dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, 3 μl of 0.5% in DMSO, Sigma-Aldrich) was taken by using Hamilton Syringe (#80330, Reno, NV, USA) and slowly applied to the cut end of the hepatic branch of the vagus nerve for 2-3 min. After suturing incised abdomen skin tissue, animals were recovered from narcosis and maintained in animal room for 7 days until the dissection of NG for further analysis. To dissect NG ganglion, we cut the anterior surface of the neck and exposed the carotid artery. The vagus nerve was carefully exposed from the carotid artery by removing muscles and connective tissues along the rostral direction. The NG was isolated just above the location where the hypoglossal nerve crosses the vagus nerve.
Western blot analysis
Liver tissue was dissected from rats and sonicated in RIPA buffer (150 mM NaCl, 1.0% CA-630, 0.1% SDS, 50 mM Tris, pH 8.0, 0.5% sodium deoxycholate; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with protease inhibitor and phosphatase inhibitor cocktails (Roche Diagnostics, Canton, Switzerland). The lysate was centrifuged at 12,000 rpm, 15 min, and 4°C and the supernatant was collected. Extracted proteins (20 mg) were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membrane. PVDF membrane was placed in blocking solution (5% BSA, 1X TBST (0.1% tween 20 in Tris-buffered saline)) and followed by primary and secondary antibody reactions. For the quantitative analysis of ChAT protein in the NTS and DMV area, coronal brain sections (60 mm thickness) were prepared by using a cryostat (CM1850, Leica, Wetzlar, Germany). Sections were placed on the slides and the area covering NTS and DMV were scrapped off under the stereoscopic microscope by using 3 ml syringe. Preparation of cell lysates and remaining steps of western blotting experiment were essentially the same as described previously (Chang et al., 2012). Immunoblotting was performed with primary antibodies against TNF-α (ab9739, Rabbit-polyclonal, 1:2,000, Abcam, Cambridge, UK, RRID:AB_308774), IL-1β (ab9722, Rabbit-polyclonal, 1:2,000; Abcam, RRID:AB_308765), IL-6 (ab9324, Mouse-monoclonal, 1:2,000; Abcam, RRID:AB_307175), ChAT (ab181023, Rabbit-monoclonal, 1:2000, Abcam, RRID:AB_2687983), pY-STAT3 (#9145, Rabbit-polyclonal, 1:1,000; Cell Signaling Technology, Danvers, MA, USA, RRID:AB_2491009), a7 nAChR (ANC-007, Rabbit-polyclonal, 1:200, Alomone Labs, Jerusalem, Israel), and β-actin (A1978, Mouse-monoclonal, 1:50,000; Sigma-Aldrich, RRID:AB_476692). Secondary antibodies were anti-rabbit IgG HRP (#7074, 1:5,000; CST, RRID:AB_2099233) and anti-mouse IgG HRP (#7076, 1:5,000; CST, RRID:AB_330924) antibodies. Intensity of protein bands in the X-ray film was determined by densitometric measurement using the i-Solution software (http://www.imt-digital.com/English2.0/html/home.php, version 21.1, Image & Microscope Technology, Daejeon, Korea).
Real-time PCR and RT-PCR
Total RNA was extracted from the liver and brainstem tissues by using trizol reagent (Thermo Fisher Scientific). cDNA was synthesized by incubating isolated RNA in the reaction containing 50 mM Tris-HCl, 3 mM MgCl2, 75 mM KCl, 10 mM DTT), 104 μM dNTP mixture, RNasin (30 U), random primers (16 μM, Promega, Madison, WI, USA), and MMLV reverse transcriptase (200 U, Promega) for 2 hours at 37°C. RT-PCR was performed by using Green Master Mix (Promega) as described previously (Chang et al. 2018). The primer sequences for RT-PCR are as follows; the forward primer (5’-TTCTTTGTCTTGGATGTTGTCAT-3’) and reverse primer (5’-AACATTTCAACCTCAACCTTCTGG-3’) for ChAT mRNA, the forward primer (5’-TGTAGGCCTGCTGGATCAAC-3’) and reverse primer (5’- GCAGGATATCAGCTCGGTGT-3’) for AChE mRNA, and the forward primer (5’-CACACTGTGCCCATCTATGA-3’) and the reverse primer (5’- GCAGGATATCAGCTCGGTGT) for actin mRNA. Amplified DNA was analyzed by 1% agarose gel electrophoresis. Real-time PCR was performed in a 20 μl reaction volume containing synthetic cDNA (3 μg), 1X Power SYBR Green PCR Master mix (Life technologies, Carlsbad, CA, USA), and 0.15 μM forward and reverse TNF-α primers. PCR for rat GAPDH gene was carried out by incubating synthesized cDNA (3 μg), 1X TaqMan Gene Expression Master Mix (AmpliTaq Gold DNA Polymerase, Thermo Fisher Scientific) and 1X rat GAPDH primer (Rat GAPD, Applied Biosystems, Foster City, CA, USA), endogenous control (VIC1/MGB probe primer) in a 20 μl of reaction volume. Real-time PCR reactions were performed using 96 well plate (MicroAmp Optical 96-well reaction plate, Applied Biosystems). The plate was covered with a film (MicroAmp Optical Adhesive Film, Applied Biosystems) and centrifuged briefly to spin down the sample (GS-6R Centrifuge, Beckman Coulter Life Sciences, Brea, CA, USA). Real-time PCR was carried out using an 7500 Real Time PCR System (Applied Biosystems) by activating Taq polymerase at 50°C for 2 min and at 95°C for 10 min, followed by 40 cycles with 15 sec at 95°C for denaturation and 1 min at 60°C for annealing. The RNA levels in each group were represented as fold changes in levels of target mRNAs to GADPH reference mRNA. The primer sequences for real-time PCR were as follows; the forward primer (5’-ACAAGGCTGCCCCGACTAT-3’) and the reverse primer (5’-CTCCTGGTATGAAGTGGCAAATC-3’) for TNF-α mRNA, the forward primer (5’-GGGCGGTTCAAGGCATAACAG-3’) and the reverse primer (5’-CTCCACGGGCAAGACATAGG-3’) for IL-1b mRNA, the forward primer (5’-CTGGTCTTCTGGAGTTCCGT-3’) and the reverse primer (5’-TGGTCCTTAGCCACTCCTTCT-3’) for IL-6 mRNA, and the forward primer (5’-GACCCAGAAGCTTCCAAGCCA-3’) and the reverse primer (5’-TGGGCATTGTAGTGACTCTCG-3’) for ChAT mRNA. The relative quantification (RQ) value of TNF-α, IL-1b, IL-6 and ChAT mRNA expression on GAPDH mRNA was calculated by the threshold cycle (Ct) data.
Immunofluorescence staining
Rats were anesthetized with overdose of ketamine and xylazine and perfused by using 4% paraformaldehyde in 1X PBS. Tissues such as brainstem, NG, and liver were dissected and immersed overnight in 20% sucrose in PBS solution. After rapid freezing with -80oC of dimethylbutane (Sigma-Aldrich), tissues were cut using a cryostat (Leica, Wetzlar, Germany) and thaw-mounted on the slide (16 mm thickness). Immunofluorescence staining was performed as described previously (Chang et al. 2012). Briefly, sections were fixed, permeabilized, treated with blocking solution (2.5% BSA and 2.5% horse serum, 0.1% Triton X-100 in 1X PBS), and incubated with primary antibodies for 24 h at 4℃, washed three times with 1X PBST and incubated with secondary antibodies at room temperature for 2 h in a dark room. The primary antibodies used were anti-TNF-α (ab9739, Rabbit-polyclonal, 1:400; Abcam), anti-IL-1β (ab9722, Rabbit-polyclonal, 1:400; Abcam), anti-IL-6 (ab9324, Rabbit-polyclonal, 1:400; Abcam), anti-P2X2 (PA1-24624, Rabbit-polyclonal, 1:400; Thermo Fisher Scientific, Waltham, MA, USA, RRID:AB_2157912), anti-c-Fos (sc-166940, Mouse-monoclonal, 1:400; Santa Cruz Biotech, Dallas, Texas, USA, RRID:AB_10609634), anti-cleaved Caspase-3 (#9661, Rabbit-polyclonal, 1:400; CST, RRID:AB_2341188), anti-CD11b (554980, Mouse-monoclonal, 1:200; BD Biosciences, Franklin Lakes, NJ, USA, RRID:AB_2129492), anti-pY-STAT3 (#9145, Rabbit-polyclonal, 1:400; CST), anti-NF-200 (N0142, Mouse-monoclonal, 1:400; Sigma-Aldrich, RRID:AB_477257), anti-ChAT (ab181023, Rabbit-monoclonal, 1:400, Abcam), anti-VR1 (M-1714-100, Mouse-monoclonal, 1:400, Abcam, RRID:AB_2492520), anti-Albumin (NBP1-32458, Rabbit-polyclonal, 1:200, Novus Biologicals, Centennial, CO, USA, RRID:AB_10003946), normal mouse IgG (sc-2025, Mouse-monoclonal, 1:400, Santa Cruz Biotechnology, RRID:AB_737182) and normal rabbit IgG (#2729, Rabbit-polyclonal, 1:400, CST, RRID:AB_1031062) antibodies. Rhodamine-goat anti-rabbit IgG (R-6394, 1:400; Molecular Probes, Eugene, OR, USA, RRID:AB_2556551) and fluorescein-goat anti-mouse IgG (F-2761, 1:400; Molecular Probes, RRID:AB_2536524) antibodies were used as secondary antibodies. When necessary for nuclear staining, sections were incubated with Hoechst 33258 (2.5 μg/ml, bis-benzimide, Sigma) for 10 minutes before the final washing with 1X PBST. Signal intensity of immunofluorescence images were measured by using the program Image J (ImageJ, NIH, Bethesda, MA, USA, RRID:SCR_003070). Quantification was represented as either the signal intensity or the number of cells displaying effective pixel values. Fluorescence images were converted into grayscale mode and the pixel density above the threshold which had been set in the program was adapted as being effective for further quantification. Fluorescence intensity in the images was presented as the pixel density relative to that of the control images. Also, individual cells showing the pixel density above the threshold which had been set in the same way as above were counted. The number of labeled cells or the pixel density in the field of image were counted and averaged for 3-5 nonconsecutive sections. Observers were blind to the slides that were used for the analysis by fluorescence microscopy.
Flow Cytometry
FACS analysis in liver tissue was conducted as described previously with some modifications (Saba et al., 2020). Briefly, rats were anesthetized by ketamine and xylazine and the blood was removed by cardiac puncture. The equal amount of liver tissue (0.2 g) was dissected from individual animals. The liver tissue was chopped into small pieces and treated with 3 ml of type IV collagenase (10 mg/ml reaction, Sigma) in 2% FBS and 1 mM EDTA at 37oC for 30 min. The tissue was homogenized by using gentleMACS dissociator (Miltenyi Biotech, Bergisch Gladbach, Germany) and filtrated through a 70 mm pore size nylon cell strainer (BD Falcon, Bedford, MA, USA). The filtrated cells were centrifuged at 300 x g for 10 min and the pellets were incubated for 2 min in 3 ml of ACK solution (0.15 M NH4Cl, 1 mM KHCO3, 0.1 mM EDTA) to lyse erythrocytes. After washing with FACS buffer (2% FBS in 1x PBS; Gibco-RBL, Grand Island, NY, USA) and centrifugation, pellets were resuspended in a fresh FACS buffer and transferred to FACS tube (Corning, New York, NY, USA). The aliquots were taken to measure the number of cells by using haemocytometer (DHC-N01, INCYTO Co., Ltd., Cheonan, Korea). Cells were pelleted by centrifugation at 390 x g for 5 min and resuspended in 10 μl of blocking buffer (5% BSA in 1x PBS). Cells were incubated with antibodies for 30 min at 4oC. After washing with FACS buffer and centrifugation for 5 min at 390 x g, cell pellets were suspended in 300 μl of fix buffer (4% paraformaldehyde in 1x PBS) and stored at 4oC until the analysis with two-colour flow cytometry on a BD FACSCaliburTM. The data were analyzed using CellQuest software (BD Biosciences, 209 Mountain View, CA, USA). Monoclonal antibodies used in the present study were anti-CD3-fluorescein isothiocyanate (FITC, 1:10, 557354, BD Biosciences, San Diego, CA, USA), anti-CD8-phycoerythrin-PE (PE, 1:10, 559976, BD Biosciences), anti-CD4-PE (1:10, 554836, BD Biosciences), and anti-CD161-FITC (1:10, 205608, BioLegend, San Diego, CA, USA) primary antibodies.
AST and ALT measurement in serum
Blood was collected from the cardiac puncture in rats, centrifuged at 1,157 x g for 4oC, and the serum in the upper phase was taken. The levels of AST and ALT in serum were analyzed by a protocol as provided by the manufacturer (ASAN pharmacy, Seoul, Korea). Briefly, a mixture (100 ml) of L-aspartate (22.6 mg/l) and α-ketoglutarate (292 mg/l) or DL-alanine (17.8 mg/ml) and α-ketoglutarate (292 mg/l) was preincubated for 5 min at 37oC and added serum (20 ml) and incubated 30 min at 37oC. After adding 100 ml of 2,4-dinitrophenylhydrazinbe (198 mg/l) and incubating for 20 min at 37oC, we stopped the reaction with 1 ml of NaOH (0.4 N) for 20 min at room temperature. The sample was then used for spectrophotometric measurement at 505 nm and the values of absorbance were converted into Karmen Unit (IU/L).
Experimental design and statistical analysis
For the studies examining the effects of hVNS on the production of inflammatory cytokines, rats were randomly assigned to untreated control (CTL), ConA+Sham, and ConA+hVNS. Sham or hVNS treatments were performed in ConA-injected animals. Liver and brainstem tissues were collected for RT-PCR, western blotting, flow cytometry, and immunofluorescence experiments. In the other set of experiments, ConA+hVNS animals were randomly assigned into the subgroups of CAP or sham treatment, AP-5 and CNQX injection, and hVNX surgery. Some of CAP-injected rats and untreated control rats were used to examine eye wiping test. The experimenter was blinded to the animal’s groups during experimentation and statistical analysis.
All data were presented as mean ± standard deviation (SD). The mean number data among experimental groups were compared by using Student’s t test (unpaired) or one-way ANOVA and Tukey’s multiple comparison test for multiple comparisons (GraphPad Prism 7.00, GraphPad Software Inc., San Diego, CA, USA). Statistically significant differences were set at *p<0.05, **p<0.01, ***p<0.001.