Development of simultaneous detection method of six viruses infecting grapevine by a multiplex RT-PCR assay

doi:10.21203/rs.3.rs-4615014/v1

Download PDF

Research Article

Development of simultaneous detection method of six viruses infecting grapevine by a multiplex RT-PCR assay

https://doi.org/10.21203/rs.3.rs-4615014/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

A multiplex RT-PCR is quick and economical method because of the simultaneous detection for two or more targets. Here, we developed multiplex RT-PCR for six grapevine viruses. Primers were newly designed for each viral isolate based on complete sequence data obtained from the NCBI database. As the result of comparing the detection sensitivities of our multiplex RT-PCR assay with those of previously reported conventional singleplex RT-PCR assays, that of our assay exhibit equivalent or even 1–10,000 times greater than their assays without non-specific reactions, respectively. Our assay is useful in selecting healthy nurseries and are useful for plant quarantine inspections.

Multiplex RT-PCR

Detection

RNA virus

Specific primer

Grapevine

Grapevines are known to be infected with the most variety of viruses of all cultivated plant crops (Xiao et al. 2018). Single-viral infections and co-infections with multiple viruses are responsible for considerable and ongoing economic losses to the grape and wine industries worldwide (Komar et al. 2010; Xiao et al. 2018). Viruses like carnation ringspot virus (CRSV), peach rosette mosaic virus (PRMV), raspberry ringspot virus (RpRSV), strawberry latent ringspot virus (SLRSV), sowbane mosaic virus, and tomato ringspot virus (ToRSV) have variety hosts, including grapevines. PRMV, RpRSV, SLRSV, and ToRSV belong to the family Secoviridae and cause fan leaf-like diseases in grapevines (Martelli 2014). Although reports of SoMV and CRSV symptoms in grapevines are rare, these viruses have diverse host plants and can be mechanically transmitted (CABI 2023). Additionally, CRSV, PRMV, RpRSV and SLRSV have not ever occurred in Japan, and these six viruses are important quarantine viruses in Japan.

The foremost strategy for controlling viral diseases in grapevines lies in prevention, which revolves around establishing virus-free nurseries. (Reverse transcripted (RT)-) polymerase chain reaction (PCR) has emerged as a pivotal laboratory diagnostic tool (Gambino and Gribaudo 2006; Ling et al. 2001). Particularly, multiplex (RT-) PCR allows for the simultaneous detection of multiple targets in a single assay by employing different primer sets for two or more targets within the same reaction, thereby reducing costs, labor, and time (Pallás et al. 2018).

The extensive genetic diversity of some plant viruses is well-documented (Schneider and Roossinck 2001). Given the genetic diversity of viruses, it is possible to miss viral variants if the PCR assay is ineffective for some variants present in nature (Diaz-Lara et al. 2020). Therefore, we aimed to develop reliable multiplex RT-PCR assay for the simultaneous detection and identification of theabove six viruses based on in silico design of species-specific primers and exhaustive comparison with the sequences of known variants of each target virus.

Viruses and plants

The five viruses (CRSV, RpRSV, SLRSV, SoMV, and ToRSV) examined in this study were sourced from DSMZ (each DSMZ Nos. PV-0097, PV-0429, PV-0247, PV-0398, and PV-0381), and PRMV was sourced from ATCC (ATCC No. PV-398). These viruses were mechanically inoculated into 3–4 weeks-old quinoa (Chenopodium quinoa). The infection with each virus was subsequently confirmed through RT-PCR using specific primer sets as previously reported (Fuchs et al. 2010; Lebas and Ward 2012, Ochoa-Corona et al. 2006; Postman et al. 2004; Raikhy et al. 2006rémé et al. 2008). Subsequent tests were conducted using samples in which infection with each virus had been positively confirmed.

Healthy grapevine and quinoa plants were used as negative controls for each test. To assess the influence like as non-specific reactions on RT-PCR reactions among cultivars for the grapevine, the following healthy cultivars were selected; “cv. Baco22A” (V. vinifera x labrusca x riparia), “cv. CabernetFranc” (V. vinifera), "cv. Kober5BB" (V. berlandieri x riparia), "cv. LN33" (V. complex hybrid) and "cv. 110R" (V. rupestris x berlandieri). The absence of all target viruses in the negative controls was confirmed using RT-PCR, as described above. For each sample, 50 mg of plant tissue was prepared, transferred into a microtube with two stainless steel beads for ground. These samples were subsequently stored at -80°C until the nucleic acid extraction process was carried out.

Extraction of total nucleic acids

Total nucleic acids (TNA) were extracted using the modification of the CTAB (cetyltrimethylammonium bromide) method reported by Takahashi et al. (2022). The concentration of TNA was measured using NanoDrop One (Thermo Fisher Scientific Inc., Waltham, MA, USA). Each TNA was diluted to 100 ng/µl with sterile ultrapure water and used in subsequent experiments.

To confirm whether non-specific reactions occurred in the samples of various grapevine varieties, a mixture of TNA from five varieties of healthy grapevines was used as a negative control.

Primers

To design the primers for the multiplex RT-PCR, we acquired the lengthy nucleotide sequences of the viruses from the National Center for Biotechnology Information website (NCBI) (https://www.ncbi.nlm.nih.gov/; accessed in July 2022). We then conducted sequence alignments using the CLUSTAL W program, as described by Thompson et al. (1994). Additionally, we considered nearly all the registered variants of each virus. We identified highly conserved regions within the viral genome and subsequently designed new primers for these regions.

A total of 12 primers described in Table 1 were used to detect the viruses. In these primers, nine primers were designed manually. Three primers (SoMV-F, RpRSV942F, and RpRSV1741R) were previously reported (Gratsia et al. 2012; Lebas and Ward 2012).

To predict PCR amplification probabilities between primer sequences of each virus and the sequence of each virus isolate, the Thermodynamic mismatch model (TMM) was used (Döring et al. 2019). The free energy at annealing (ΔG) was calculated using Two State Melting Hybridization in The UNAFold Web Server (http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php). In TMM, the cutoff value was 83.9% that selected to ensure an empirical specificity of at least 99% (Döring et al. 2019). As the resulting of TMM analysis, all primers in this study exceeded this cutoff value (Table S1).

Reverse transcription and multiplex PCR

Single-strand cDNA synthesism was performed using ReverTra Ace -α-® (TOYOBO co., Ltd., Osaka, Japan) reported by Takahashi et al. (2022). To reduce non-specific reactions in multiplex PCR and reagent costs, RT products were diluted 5-fold with sterile ultrapure water before being used as templates for multiplex PCR.

TaKaRa Ex Taq® Hot Start Version (Takara Bio Inc., Shiga, Japan) was used for multiplex PCR. The PCR mixture was prepared according to the manufacturer’s instructions. Multiplex PCRs were performed using the above primers. The final concentration of each primer is given in Table 1. PCR reaction solution (9 µl) was added with 1 µl of diluted RT product in each tube. The PCR cycles were performed under the following conditions with touchdown PCR: 94℃ for 2 min, 10 cycles of 94℃ for 30 s, (65-n) ℃ for 30 s (n equals cycle number), 72℃ for 45 s, 30 cycles of 94℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, with 72℃ for 7 min. The PCR products were analyzed by electrophoresis in 2–2.5% agarose gel, stained with GelRed™ (Biotium Inc., CA, USA) and visualized with UV light.

Detection specificity and sensitivity

The detection specificity of multiplex PCR in this study was confirmed by adding cDNA of each virus sample in PCR reaction mix, respectively.

The detection sensitivity of our multiplex RT-PCR was compared with previously published specific primer sets for each virus (Table 2). Dilution series was made using ten-fold serial dilution (10^− 1–10^− 6) TNA extracted from each virus infected quinoa leaves with TNA extracted from healthy grapevines because the infected grapevine plants of each virus were not able to be prepared.

Detection ability of multiplex RT-PCR

The simultaneous detection limit of all viruses in the multiplex PCR was confirmed using the copy number of viral nucleic acid fragments using the primer sets listed in Table 1. However, since the primers of SLRSV are degenerate, a primer set without mixed bases was designed from the average sequences (the forward primer was based on accession No. MF796998.1 (5′ TACTCACCACGTGAGATGGA 3′)), reverse primer was based on accession No. MF796978.1 (5′ AGTGGCCACCAAACTCTT 3′)). The PCR product was purified by using ExoSAP-IT™ Express PCR Product Cleanup (Thermo Fisher Scientific Inc.) and the QIAquick PCR Purification Kit (QIAGEN). The copy number was calculated from the DNA concentration was measured using a NanoDrop One. The purified viral fragments were mixed at the same copy number for each group. Ten-fold dilution series of these mixed viral fragments (2.0×10⁰–10³ copies) was used for each multiplex PCR. Furthermore, to confirm that amount of each virus in a template is not influenced by PCR amplification of the other virus, different sensitivity test was performed by varying the viral ratios among target viruses: the availability of PCR amplification was investigated when one viral fragment was varied from 2.0×10² to 10¹ copies/reaction and the other viral fragments was fixed at 10³ copies/reaction. To consider the effect of grapevine-derived components on multiplex PCR, 1 µl of diluted RT product from healthy grapevines was added to each reaction.

Simultaneous detection of all different virus combinations from grapevine plants

To confirm the detection in the cases of all different virus combinations among the target viruses, 1 µl of each viral cDNA according to the virus combination showed in Fig. 3 was applied in multiplex PCR. The viral cDNA was prepared by mixing equal amounts of cDNA from virus infected quinoa and cDNA from healthy grapevine. Additionally, this cDNA from healthy grapevine was used as the negative control.

Viruses and plants

Infection of the inoculated quinoa with each virus was confirmed by the published RT-PCR detailed in section 2.1 (data not shown). These TNAs were then utilized in the subsequent tests.

Detection specificity and sensitivity of multiplex RT-PCR

The newly developed multiplex RT-PCR assay could simultaneously detect all six viruses, as shown in Fig. 1. Each of the PCR products showed the expected positions (SLRSV, 134bp; CRSV, 250bp; ToRSV, 338bp; PRMV, 560bp; RpRSV, 800bp; SoMV, 938bp), respectively. Additionally, non-specific reactions did not occur in healthy grapevine or quinoa samples.

The detection sensitivities of our multiplex RT-PCR assay and previously published RT-PCR assays were compared using serial dilution series of each of the six viruses (Table 2). In the case of CRSV, PRMV, RpRSV, and SLRSV, the detection sensitivity of our assay was each 100, 10, 10,000, and10 times higher than the previously reported primer sets. On the other hand, those of SoMV and ToRSV were equivalent to the previously reported ones.

Detection ability of multiplex RT-PCR

The detection abilities of our multiplex PCR assay when multiple viruses were simultaneously detected were confirmed using serial dilutions of the fragments for each virus. Simultaneous PCR amplification of all viral fragments was confirmed at 2.0 × 10¹–10³ copies per reaction (Fig. 2a). No viral fragments were detected in 2.0 ×10⁰ copies per reaction.

Furthermore, when varying only the copy number of one virus fragment to determine the effect of virus mixing ratio on each detection limit, SoMV, RpRSV, PRMV, CRSV, and SLRSV were not detected at 2.0 ×10¹ copies or less except for ToRSV (Fig. 2b). However, all viruses could be detected down to 2.0 ×10² copies. The above results indicate that each virus can be detected without major effects even if a difference in concentration among target viruses.

Confirmation of simultaneous detection from grapevine plants

As the result of confirming whether each virus can be detected in all difference virus combinations among target viruses, each of the viruses were detected in whole conditions (Fig. 3). Notably, even when all of six viruses were combined with any virus combination, each virus was detected accurately and simultaneously.

Grapevines are known to be infected by over 80 distinct viral species from 17 viral families and 27 genera have been identified in grapevines, and instances of co-infection with multiple viruses are not uncommon because of the typical vegetative propagation of grapevines (Martelli, 2017; Xiao et al., 2018). Therefore, this study focused on the development of multiplex RT-PCR assay capable of simultaneously detecting various viruses that are known to cause damage to grape production, eventually to improve the efficiency of the inspection.

Most plant viruses are RNA viruses (Pumplin and Voinnet 2013) which are characterized by their numerous variants, primarily due to their high mutation rates (Elena and Sanjuán 2005). To reliably detect these variants by (RT-)PCR, in vitro testing ideally should be performed using isolates from all over the world. However, the number of available virus isolates is practically limited. Therefore, we conducted in silico testing between a wide range of variants of each virus and design primers by using TMM analysis (Döring et al. 2019). All our primers were designed to target all isolates of each virus and were confirmed high amplifiability (Table S1), and eventually reliable primers could be found (Table 1). Therefore, our multiplex RT-PCR assay would be able to detect a wide variety of variant of each virus.

Since multiplex RT-PCR shows bands of multiple different sizes simultaneously, it is necessary not to misanneal to many other nucleotide sequences of other organisms, such as plant genomes. Our primers were designed to avoid false positives, because non-specific reactions against healthy plants were not confirmed (Fig. 1). Thus, the primer sets in this study exhibited high specificity.

It is important to acknowledge that the sensitivity of a multiplex RT-PCR assay is influenced by the number of targets being detected, primarily due to the increasing number of different primer sets in the PCR cocktail. It is worth noting that between 2005 and 2018, 91.4% of the reported multiplex detection assays were designed to detect five or fewer target pathogens (Pallás et al. 2018; Sánchez-Navarro et al. 2005). Our multiplex RT-PCR assay successfully detected six viruses simultaneously (Fig. 2, 3). Furthermore, this assay was able to detect six viruses even when there were differences in virus concentration among them (Fig. 2b), and to detect each virus in any combination (Fig. 3). These results indicate this multiplex PCR assay has stable detectability.

Given the high detection sensitivity and reduced occurrence of non-specific reactions in our multiplex RT-PCR assay, they hold significant promise for investigating the presence of viruses in orchards. Particularly, they can be instrumental in ensuring the health of nurseries before planting, and they offer an effective means of detecting multiple viruses during plant inspections, such as post-entry quarantine procedure.

Funding

No funding was received for conducting this study.

Competing interests

The authors have no relevant financial or non-financial interests to disclose.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

CABI (2023) Sowbane mosaic virus, CABI Compendium. CA B International, Wallingford, UK (Accessed 30 May 2023). https://www.cabidigitallibrary.org/doi/10.1079/cabicompendium.52164
Diaz-Lara A, Stevens K, Klaassen V, Golino D, Al Rwahnih M (2020) Comprehensive real-time RT-PCR assays for the detection of fifteen viruses infecting Prunus spp. Plants (Basel) 9:273. https://doi.org/10.3390/plants9020273
Döring M, Kreer C, Lehnen N, Klein F, Pfeifer N (2019) Modeling the amplification of immunoglobulins through machine learning on sequence-specific features. Sci Rep 9:10748. https://doi.org/10.1038/s41598-019-47173-w
Elena SF, Sanjuán R (2005) Adaptive value of high mutation rates of RNA viruses: separating causes from consequences. J Virol 79:11555–11558. https://doi.org/10.1128/JVI.79.18.11555-11558.2005
Fuchs M, Abawi GS, Marsella-Herrick P, Cox R, Cox KD, Carroll JE, Martin RR (2010) Occurrence of Tomato ringspot virus and Tobacco ringspot virus in highbush blueberry in New York State. J Plant Pathol 451–459
Gambino G, Gribaudo I (2006) Simultaneous detection of nine grapevine viruses by multiplex reverse transcription-polymerase chain reaction with coamplification of a plant RNA as internal control. Phytopathology 96:1223–1229. https://doi.org/10.1094/PHYTO-96-1223
Gratsia ME, Kyriakopoulou PE, Voloudakis AE, Fasseas C, Tzanetakis IE (2012) First report of Olive mild mosaic virus and Sowbane mosaic virus in spinach in Greece. Plant Dis 96:1230–1230. https://doi.org/10.1094/PDIS-03-12-0273-PDN
Komar V, Vigne E, Demangeat G, Lemaire O, Fuchs M (2010) Comparative performance of virus-infected Vitis vinifera cv. Savagnin Rose grafted onto three rootstocks. Am J Enol Vitic 61:68–73. https://doi.org/10.5344/ajev.2010.61.1.68
Lebas B, Ward L (2012) Vitis post-entry quarantine testing manual. Plant Health and Environment Laboratory Investigation and Diagnostic Centres and Response. http://www.biosecurity.govt.nz/files/regs/imports/plants/high-value-crops/vitis-testing-manual.pdf. Cited 1 Jan 2023
Ling KS, Zhu HY, Petrovic N, Gonsalves D (2001) Comparative effectiveness of ELISA and RT-PCR for detecting grapevine leafroll-associated closterovirus-3 in field samples. Am J Enol Vitic 52:21–27. https://doi.org/10.5344/ajev.2001.52.1.21
Martelli GP (2014) Directory of virus and virus-like diseases of the grapevine and their agents. J Plant Pathol 96(1):1–136
Martelli GP (2017) An overview on grapevine viruses, viroids, and the diseases they cause. Grapevine Viruses Mol Biol Diagn Manag 31–46. https://doi.org/10.1007/978-3-319-57706-7_2
Ochoa-Corona FM, Lebas BSM, Tang JZ, Bootten TJ, Stewart FJ, Harris R, Elliott DR, Alexander BJR (2006) RT-PCR detection and strain typing of Raspberry ringspot virus. Proceedings of the XXth International Symposium on Virus and Virus-like Diseases of Temperate Fruit Crops & XIth International Symposium on Small Fruit Virus Diseases, Antalya, Turkey, May 22–26, 2006
Pallás V, Sánchez-Navarro JA, James D (2018) Recent advances on the multiplex molecular detection of plant viruses and viroids. Front Microbiol 9:2087. https://doi.org/10.3389/fmicb.2018.02087
Postman JD, Tzanetakis IE, Martin RR (2004) First report of Strawberry latent ringspot virus in a Mentha sp. from North America. Plant Dis 88:907–907. https://doi.org/10.1094/PDIS.2004.88.8.907B
Pumplin N, Voinnet O (2013) RNA silencing suppression by plant pathogens: defence, counter-defence and counter-counter-defence. Nat Rev Microbiol 11:745–760. https://doi.org/10.1038/nrmicro3120
Raikhy G, Hallan V, Kulshrestha S, Sharma ML, Verma N, Ram R, Zaidi AA (2006) Detection of carnation ringspot and carnation vein mottle viruses in carnation cultivars in India, in: Acta Hortic. Symposium on Virus Diseases of Ornamental Plants 722 International, X.I. (Ed.) (722): (247–258). https://doi.org/10.17660/ActaHortic.2006.722.31
Sánchez-Navarro JA, Aparicio F, Herranz MC, Minafra A, Myrta A, Pallás V (2005) Simultaneous detection and identification of eight stone fruit viruses by one-step RT-PCR. Eur J Plant Pathol 111:77–84. https://doi.org/10.1007/s10658-004-1422-y
Schneider WL, Roossinck MJ (2001) Genetic diversity in RNA virus quasispecies is controlled by host–virus interactions. J Virol 75:6566–6571. https://doi.org/10.1128/JVI.75.14.6566-6571.2001
Sérémé D, Lacombe S, Konaté M, Pinel-Galzi A, Traoré VSE, Hébrard E, Traoré O, Brugidou C, Fargette D, Konaté G (2008) Biological and molecular characterization of a putative new Sobemovirus infecting Imperata cylindrica and maize in Africa. Arch Virol 153:1813–1820. https://doi.org/10.1007/s00705-008-0190-y
Takahashi T, Hashimoto S, Inoue Y (2022) Development of a Multiplex RT-PCR to Simultaneously Detect Three Grapevine Viruses and Preparation of Artificial Positive Control DNA Derived from a Plant Internal mRNA Sequence. Res Bull Pl Prot Japan 57:51–55
Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. https://doi.org/10.1093/nar/22.22.4673
Xiao H, Shabanian M, Moore C, Li C, Meng B (2018) Survey for major viruses in commercial Vitis vinifera wine grapes in Ontario. Virol J 15:127. https://doi.org/10.1186/s12985-018-1036-1

Table 1 and 2 are available in the Supplementary Files section.

Download PDF

Reviewers agreed at journal
24 Jun, 2024
Reviewers invited by journal
24 Jun, 2024
Editor assigned by journal
23 Jun, 2024
First submitted to journal
21 Jun, 2024

You are reading this latest preprint version

Development of simultaneous detection method of six viruses infecting grapevine by a multiplex RT-PCR assay

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Viruses and plants

Extraction of total nucleic acids

Primers

Reverse transcription and multiplex PCR

Detection specificity and sensitivity

Detection ability of multiplex RT-PCR

Simultaneous detection of all different virus combinations from grapevine plants

Results

Viruses and plants

Detection specificity and sensitivity of multiplex RT-PCR

Detection ability of multiplex RT-PCR

Confirmation of simultaneous detection from grapevine plants

Discussion

Declarations

References

Tables

Supplementary Files

Status:

Version 1