The CGI121 gene from Saccharomyces cerevisiae demonstrates genetic linkage to increased lag time under enological conditions

doi:10.21203/rs.3.rs-46186/v1

Download PDF

Research article

The CGI121 gene from Saccharomyces cerevisiae demonstrates genetic linkage to increased lag time under enological conditions

https://doi.org/10.21203/rs.3.rs-46186/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 03 Mar, 2021

Read the published version in G3 Genes|Genomes|Genetics →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

In winemaking, it is standard practice to ferment white wines at low temperatures (10–18 ºC). However, low temperatures increase the fermentation duration and risk of problem ferments, which can lead to significant costs. The length of the lag period at fermentation initiation is one parameter that is heavily impacted by low temperatures. Therefore, the identification of Saccharomyces cerevisiae genes with an impact on fermentation kinetics, such as lag time, is of interest for winemaking.

Results

We selected a set of 28 S. cerevisiae BY4743 single deletants based on a prior list of candidate open reading frames (ORFs) mapped to quantitative trait loci (QTLs) on chromosomes VII and XIII influencing the duration of fermentative lag time by bulk segregant analysis. Five out of 28 BY4743 deletants, Δapt1, Δcgi121, Δclb6, Δrps17a, and Δvma21, differed significantly in their fermentative lag phase duration compared to BY4743 in synthetic grape medium (SGM) at 15 ºC, over 72 h. Fermentation at 12.5 ºC for 528 h, to show a greater resolution of the lag times, identified the inability of BY4743 Δapt1 to initiate fermentation and confirmed the significantly longer lag times of the BY4743 Δcgi121, Δrps17a, and Δvma21 deletants. The three candidate ORFs were deleted in S. cerevisiae RM11-1a and S288C to perform single reciprocal hemizygosity analysis (RHA). RHA hybrids and single deletants of RM11-1a and S288C were fermented at 12.5 ºC in SGM. Lag time measurements confirmed genetic linkage of CGI121 on chromosome XIII, encoding a component of the EKC/KEOPS complex, to fermentative lag phase. Nucleotide sequences of RM11-1a and S288C CGI121 alleles differed by only one synonymous nucleotide suggesting that codon bias or positional effects might be responsible for the impact of this gene on lag phase duration.

Conclusion

This research demonstrates a new role of CGI121 in fermentative lag time in S. cerevisiae during fermentation and highlights the applicability of QTL analysis for investigating complex phenotypic traits in yeast, such as fermentation kinetics.

Epigenetics & Genomics

Fermentation

Lag time

Quantitative trait loci

Reciprocal hemizygosity analysis

Wine

Yeast

The fermentation process for most white wines is performed at low temperatures (10–18 °C), as this range generally results in greater production and retention of desirable volatiles, leading to higher quality wines [1–3]. However, low temperatures also dramatically increase the time taken until fermentation completion and the risk of ferments becoming stuck or sluggish, which is potentially costly in terms of reduced winery space, product loss and decreased profits [4–8]. Low temperatures encountered during fermentation are particularly stressful to yeast and cause changes in cell membrane fluidity, nutrient uptake and utilization, production of protective compounds, and a decrease in enzymatic reactions [6, 9–11]. A greater understanding of the genetics behind the ability of the wine yeast, Saccharomyces cerevisiae, to acclimate to low temperatures and perform fermentation more efficiently in general, is therefore useful for the wine industry.

The duration of the lag period at the start of fermentation, defined as the time between inoculation and the start of CO₂ release, and representing the time necessary for a yeast strain to acclimate to a new environment [12], is greatly impacted by fermentation temperature, along with other variables encountered by yeast during fermentation. The high osmolarity of grape musts, along with the low pH, low oxygen availability, oxidative stress, and potentially high levels of sulfur dioxide (SO₂), low levels of nutrients such as nitrogen, and to a lesser and strain-specific extent, phytosterols and thiamine, all contribute to the duration of the fermentative lag [13, 14]. Different S. cerevisiae strains also exhibit large variation in their fermentative lag duration ranging from a few hours up to a few days [12, 15]. The genetic regulation controlling phenotypic variation in the fermentative lag time of different yeast strains is as complex as the variables involved and largely polygenic [12, 16]. During the first few hours after inoculation in enological conditions, yeast must respond to the new environment with a dramatic metabolic reorganization, resulting in an increase in the synthesis of transcripts and proteins involved in carbon and nitrogen metabolism, cellular stress response, ribosomal biogenesis, protein synthesis and oxidative stress [17, 18]. Within this response, there are likely to be numerous genes and QTLs that influence the duration of the lag phase before the release of CO₂. This response is more pronounced when the temperature of the must is low, lengthening the duration of the lag further [17, 19].

So far, one QTL with strong linkage to lag phase has been mapped to the SSU1 gene, encoding the SO₂ efflux pump [20]. Removal of SO₂ from the yeast cell is carried out via Ssu1p, in which there are several allelic variants and translocation events in different strains that alter Ssu1p efficiency [13, 21]. Beneficial genetic variants allow yeast to pump out SO₂ more efficiently, significantly reducing lag time. Previous work in our laboratory investigated QTLs linked to fermentation kinetics and found two regions, one of Chr. VII and one on Chr. XIII, that were significantly linked to fermentative lag [22]. Linkage analysis was performed on a set of 119/121 completely mapped (> 99% of the genome) F₁ progeny from a cross between haploid strains BY4716 and RM11-1a constructed by Brem et al. [23]. Due to the difficulty in phenotyping lag phase in experiments with grape juice, and the large number of candidate genes within the confidence intervals surrounding the high LOD score peaks on Chr. VII (10 open reading frames ((ORFs) and Chr. VIII (34 ORFs), these 44 candidate genes were not investigated further. This previous identification of chromosomal regions linked to lag phase duration provides an excellent opportunity to investigate the causative genes using a controlled and reproducible fermentation medium, such as synthetic grape medium (SGM). Since single reciprocal hemizygosity analysis (RHA) was not feasible for 44 different genes, we first aimed to test the lag duration of BY4743 single deletants of each candidate ORF identified in Deed et al. [22]. Those demonstrating variation in lag time compared to the BY4743 reference strain would be deleted in haploids RM11-1a and S288C, followed by the construction of RHA hybrids. Phenotyping of deletants and RHA hybrids would confirm genetic linkage to lag time during fermentation.

First screening of 28 BY4743 deletion mutants fermented in SGM at 15 °C identified five candidate ORFs that may influence lag time

Of the 44 S. cerevisiae genes identified within the 95% confidence intervals of the high LOD score peaks for QTLs on Chr. VII and Chr. XIII linked to fermentation lag duration in Deed et al. [22], 28 single gene deletion mutants were available from EUROSCARF (listed in Table 1). Of the 16 ORFs that were unavailable, seven were classified as essential genes and hence inviable in a null mutant according to the Saccharomyces Genome Database. The remaining nine either encoded transposable elements (six ORFs) or were classified as dubious and unlikely to encode a protein (three ORFs). Cumulative weight loss (g) of the 28 BY4743 deletants fermented in 100 mL SGM at 15 °C was measured at eight-hour intervals for 72 hours as a quick initial screen to identify whether any of the ORFs have an impact on the duration of the fermentative lag compared to the BY4743 reference (Fig. 1A-D). Since it was not feasible to perform RHA on 28 different candidate genes, this initial step was conducted to narrow down the number of candidates. Due to the large number of fermentations in triplicate, the deletants were fermented in four separate batches, each with the BY4743 reference for standardization, and an uninoculated control as a measure of evaporation and to ensure there was no contamination.

Table 1

List of 28 ORFs identified within one LOD unit either side of the LOD > 3 peak markers influencing lag phase duration in the *S. cerevisiae* genome and available as single deletions in BY4743 from EUROSCARF. Descriptions of protein function were obtained from the *Saccharomyces* Genome Database.
Chromosome	LOD score	ORF	Gene	Function
VII	2.235–2.570	YGR104C	SRB5	Subunit of the RNA polymerase II mediator complex
VII	2.642-3.000	YGR105W	VMA21	Integral membrane protein required for V-ATPase function
VII	2.642-3.000	YGR106C	VOA1	ER protein that functions in assembly of the V0 sector of V-ATPase
VII	2.642-3.000	YGR107W	NA	Dubious open reading frame
VII	2.642-3.000	YGR108W	CLB1	B-type cyclin involved in cell cycle progression
VII	2.978	YGR109C	CLB6	B-type cyclin involved in DNA replication during S phase
VII	2.979–2.030	YGR110W	CLD1	Mitochondrial cardiolipin-specific phospholipase
XIII	2.606	YML048W	GSF2	Endoplasmic reticulum localized integral membrane protein
XIII	2.606–3.175	YML047C	PRM6	Potassium transporter that mediates K⁺ influx
XIII	2.606–3.175	YML042W	CAT2	Carnitine acetyl-CoA transferase
XIII	2.606–3.175	YML041C	VPS71	Nucleosome-binding component of the SWR1 complex
XIII	3.175	YML038C	YMD8	Putative nucleotide sugar transporter
XIII	3.119–2.720	YML037C	NA	Putative protein of unknown function
XIII	2.478	YML036W	CGI121	Component of the EKC/KEOPS complex
XIII	2.547–3.681	YML035C	AMD1	AMP deaminase
XIII	2.547–3.681	YML034W	SRC1	Inner nuclear membrane protein
XIII	2.547–3.681	YML032C	RAD52	Protein that stimulates strand exchange
XIII	3.725–3.373	YML030W	RCF1	Cytochrome c oxidase subunit
XIII	3.725–3.373	YML029W	USA1	Scaffold subunit of the Hrd1p ubiquitin ligase
XIII	3.725–3.373	YML028W	TSA1	Thioredoxin peroxidase
XIII	3.725–3.373	YML027W	YOX1	Homeobox transcriptional repressor; binds to Mcm1p and early cell cycle boxes in promoters of cell cycle genes
XIII	3.725–3.373	YML026C	RPS18B	Protein component of the small (40S) ribosomal subunit
XIII	3.725–3.373	YML024W	RPS17A	Ribosomal protein 51 (rp51) of the small (40 s) subunit
XIII	3.328	YML022W	APT1	Adenine phosphoribosyltransferase
XIII	3.421–3.288	YML021C	UNG1	Uracil-DNA glycosylase
XIII	3.421–3.288	YML020W	NA	Protein of unknown function
XIII	3.421–3.288	YML019W	OST6	Subunit of the oligosaccharyltransferase complex of the ER lumen
XIII	3.288	YML018C	NA	Protein of unknown function

Figure 1A-D shows that the 28 deletants demonstrated a range of fermentation abilities at 15ºC in SGM, with strong visual indications of variation in lag phase time compared to the BY4743 reference. The lag duration of BY4743 and the 28 deletants was calculated from the weight loss curves and presented in Fig. 2A-D. The lag time for BY4743 across the four batches ranged from 40-52.8 h, with a mean of 45.7 h (n = 12). This degree of variation demonstrates the difficulty of measuring lag time due to the high level of noise at the start of fermentation. There were no significant differences between the BY4743 deletants in batch 1 compared to BY4743 (Fig. 2A). In batches 2 and 3, the lag phase times of BY4743 Δrps17a (56.6 h) (Fig. 2B) and BY4743 Δvma21 (48.7 h) (Fig. 2C) were significantly longer than BY4743 (43.6 h), while BY4743 Δclb6 (37.3 h) had a significantly shorter lag phase (Fig. 2C). In batch 4, two deletants, BY4743 Δapt1 and BY4743 Δcgi121, had two replicates each that had not yet left lag phase (Fig. 2D). For a useful comparison to be made against BY4743 (44.9 h), the lag times for these replicates were set at 70 h, giving an average duration of 63.5 h for BY4743 Δapt1 and 63.6 h for BY4743 Δcgi121, although the actual measure of lag time is likely to be longer for these deletants.

Further screening at 12.5 °C confirms that BY4743 single deletions of Δcgi121, Δrps17a, and Δvma1 significantly alter fermentative lag time

Since the five candidate genes identified above were selected across three different fermentation batches with a degree of noise, and with some strains still in fermentative lag or unable to ferment, a repeat single-batch 100-mL fermentation was performed for the five deletants and BY4743 to confirm that the lag phase differences observed were repeatable. The fermentations were also performed over a longer timeframe (528 h) than was used previously to determine whether the mutants that did not initiate fermentation were still in lag phase or were unable to ferment. A temperature of 12.5 °C was selected to provide a greater resolution in lag phase duration compared to 15 °C, whilst maintaining an enologically relevant temperature.

Figure 3 shows the weight loss curves at 12.5 °C for the five deletants and BY4743. The results from the first screening at 15 °C were conserved at 12.5 °C, with BY4743 and BY4743 Δclb1 demonstrating an earlier exit from fermentative lag compared to BY4743 Δcgi121, BY4743 Δrps17a, and BY4743 Δvma21. Surprisingly, with the extension of the fermentation timeframe, it was revealed that the performance of the Δapt1 deletant was equivalent to the uninoculated control, with no initiation of fermentation. The Δapt1 deletant was capable of growth in YPD in the fermentation precultures, suggesting that this strain may either be deficient in a specific factor required for fermentation and/or the enological environment was not permissible for the growth of this strain. The lag phase duration was calculated for the remaining strains using a modified Gompertz curve-fitting model to obtain greater accuracy compared to the intercept method used in the quick screen [24]. Overall, lag times at 12.5 °C compared to 15 °C were approximately two-fold longer, as expected when decreasing fermentation temperature [25, 26] (Fig. 4). The lag times confirm the prior observations from the weight loss curves in Fig. 3, but with no significant difference between the lag times of two fastest strains, BY4743 (64.9 h) and BY4743 Δclb1 (59.1 h) (Fig. 4). The lag times of BY4743 Δcgi121 (149.6 h), BY4743 Δrps17a (130.7 h), and BY4743 Δvma21 (119.9 h) were not significantly different from one another based on the 95% confidence intervals, but were significantly longer than the lag times of BY4743 and BY4743 Δclb6.

To summarize, fermentation screening successfully identified three genes resulting in a longer lag phase when deleted (Δcgi121, Δrps17a, and Δvma21). These were further investigated using single RHA.

Construction of RM11-1a and S288C single gene deletions and RHA hybrids reveals that the CGI121 gene is linked to lag phase

To determine whether any of the three candidates, CGI121 (Chr. XIII), RPS17a (Chr. XIII), or VMA21(Chr. VII), were responsible for the high LOD scores and genetic linkage to fermentative lag phase in the original 119 BY4716 × RM11-1a mapped progeny, single deletions of these three ORFs were constructed in two haploid S. cerevisiae strain backgrounds, RM11-1a (Hgm^R) and S288C. S288C was used as a substitute for BY4716, as in Deed et al. [22]. For the three candidate genes, all combinations of RM11-1a and S288C single deletants with the corresponding wild type were hybridized for RHA (Table 2). Successful hybridization was confirmed using microsatellite typing (Table 3).

Table 2

List of RM11-1a and S288C RHA crosses to investigate the impact of the *CGI121*, *RPS17a* and *VMA1* loci. The genotypes are given for each of the RM11-1a and S288C parents. The S288C parent strain in bold was required to be present in 100 × excess of the RM11-1a parent, due to the lack of selectable markers to differentiate it from RM11-1a. The F₁ hybrid selections marked with * could result in the presence of the RM11-1a parent and the F₁ hybrid. The RM11-1a x S288c cross was included as a control.
Cross	Parent #1	Parent #2	F₁ hybrid selection
RM11-1a x S288C	RM11-1a (HO::HphMX; MATa)	S288C (MATα)	*HGM^R
RM11-1a x S288C Δcgi121	RM11-1a (HO::HphMX; MATa)	S288C (CGI121::KanMX; MATα)	HGM^R; Kan^R
RM11-1a x S288C Δrps17a	RM11-1a (HO::HphMX; MATa)	S288C (RPS17a::KanMX; MATα)	HGM^R; Kan^R
RM11-1a x S288C Δvma21	RM11-1a (HO::HphMX; MATa)	S288C (VMA21::KanMX; MATα)	HGM^R; Kan^R
RM11-1a Δcgi121 x S288C	RM11-1a (HO::HphMX; CGI121::KanMX; MATa)	S288C (MATα)	*HGM^R; Kan^R
RM11-1a Δrps17a x S288C	RM11-1a (HO::HphMX; RPS17a::KanMX; MATa)	S288C (MATα)	*HGM^R; Kan^R
RM11-1a Δvma21 x S288C	RM11-1a (HO::HphMX; VMA21::KanMX; MATa)	S288C (MATα)	*HGM^R; Kan^R

Table 3

Oligonucleotide primers used for gene deletions and RHA.
Primer name	Sequence (5’ to 3’)	Purpose
3’kanI-F	GGTCGCTATACTGCTGTC	Confirm integration of KanMX constructs
CGI121intL-F	CGGAATTAGCCCACGTAGAA	Amplification of KanMX from BY4743 Δcgi121 deletant
CGI121intR-R	GGAGAACTTTTGGCAGTTCG	Amplification of KanMX from BY4743 Δcgi121 deletant
CGI121testR-R	TATCGCAATGTCACCCCTTT	Flanking test primer to confirm integration of KanMX in the CGI121 locus of transformants
RPS17aintL-F	GGCAGTGGTAGCTTGGTAGC	Amplification of KanMX from BY4743 Δrps17a deletant
RPS17aintR-R	CAGATGGCGTTTCATTTTG	Amplification of KanMX from BY4743 Δrps17a deletant
RPS17atestR-R	GGAGGAAACTGATTGGGTCA	Flanking test primer to confirm integration of KanMX in the RPS17a locus of transformants
VMA21aintL-F	AGGAACCCTCCGCTTGTTAT	Amplification of KanMX from BY4743 Δvma21 deletant
VMA21intR-R	GGTTGGGCTTTTGAAGATGA	Amplification of KanMX from BY4743 Δvma21 deletant
VMA21testR-R	TTCCAAAACTGTGCAAGCAG	Flanking test primer to confirm integration of KanMX in the VMA21 locus of transformants

Fermentation in SGM at 12.5 °C was performed for 192 h, with 8-hourly monitoring, using the RM11-1a and S288C parent strains, the haploid Δcgi121, Δrps17a, and Δvma21 single deletants in RM11-1a and S288C, the RM11-1a × S288C F₁ hybrid and the RHA F₁ hybrids constructed by crossing combinations of RM11-1a and S288C. The RHA hybrids were hemizygous for a null allele and either the RM11-1a copy or the S288C copy of CGI121, RPS17a, or VMA21. Cumulative weight loss curves show that the diploid RM11-1a × S288C F₁ hybrid had a superior fermentation performance compared to the haploid parents, RM11-1a and S288C, based on the emergence from fermentative lag and rate of fermentation (Fig. 5A-C). RM11-1a and S288C performed similarly, and in all cases exhibited a much shorter lag time compared to all RM11-1a and S288C single deletion mutants in Δcgi121, Δrps17a, and Δvma21, in agreement with the results observed for BY4743. This result confirms that the presence of CGI121, RPS17a and VMA1 results in faster lag times. The RM11-1a × S288C Δcgi121 hybrid appeared to exit fermentative lag at the same time as RM11-1a × S288C, while the lag phase of RM11-1a Δcgi121 × S288C was longer (Fig. 5A). There did not appear to be any difference between RM11-1a × S288C Δrps17a or RM11-1a Δrps17a × S288C in terms of fermentation performance, and potentially only a minor difference in lag time compared to RM11-1a × S288C (Fig. 5B). The same trend was observed for RM11-1a × S288C Δvma21 and RM11-1a Δvma21 × S288C; however, both hemizygotes showed a noticeably longer lag time than RM11-1a × S288C (Fig. 5C).

Figure 6A confirms that the lag times for RM11-1a and S288C Δcgi121, Δrps17a, and Δvma21 single deletants were significantly longer than non-deleted RM11-1a and S288C (average of 390 h compared to 126 h), as suggested from the weight loss curves in Fig. 5A-C. The long lag times of the deletion mutants corroborates the results shown by the BY4743 Δcgi121, Δrps17a, and Δvma21 deletants, but with even greater lag duration in RM11-1a and S288C due to the generally poor fermentation performance of haploid strains [27]. There were no significant differences between the non-deleted RM11-1a and S288C strains or between the corresponding pairs of RM11-1a and S288c single deletion mutants in Δcgi121, Δrps17a, or Δvma21. Additionally, there were no significant differences in lag time between RM11-1a Δcgi121, Δrps17a, and Δvma21 single deletants. The same result was observed for the S288C single deletants. For the RHA hybrids (Fig. 6B), the lag time of the RM11-1a × S288C Δcgi121 hybrid was not significantly different from the RM11-1a × S288C wild type (average of 122 h and 121 h, respectively). However, the RM11-1a Δcgi121 × S288C hybrid had a significantly longer lag time (149 h), suggesting that the absence of the RM11-1a CGI121 allele results in a lag time equivalent to wild type, but the S288C version results in increased lag time. This result is strong evidence towards the genetic linkage of CGI121 to fermentative lag and corresponds to mapping data indicating that the longer lag time is consistent with the presence of the S288C CGI121 allele and not the RM11-1a copy in the homozygous F₁ progeny from the original cross [22]. We aligned the RM11-1a and S288C nucleotide sequences of CGI121 in order to determine whether there were any allelic differences. However, nucleotide alignment showed that the sequences were 99% identical and the single base difference observed at 282 bp (G in RM11-1a and A in S288C) was synonymous, with both codons corresponding to a phenylalanine (AAG vs. AAA) (Figure S1). Further alignment of 1 kb in front of the coding sequence of the RM11-1a and S288C CGI121 sequences did not uncover any nucleotide differences in the promoter region.

For RPS17a, as suggested by the weight loss curves, there was no significant difference in lag time between RM11-1a × S288C Δrps17a or RM11-1a Δrps17a × S288C, suggesting that neither allele is genetically linked to lag time, even though RM11-1a Δrps17a × S288C did have a slightly longer lag than RM11-1a × S288C (138 h vs. 121 h). RM11-1a × S288C Δvma21 and RM11-1a Δvma21 × S288C were also not significantly different from one another, with no allele-specific impacts on lag duration for VMA21. The lag times for both hemizygotes were significantly longer than RM11-1a × S288C (144 and 149 h vs. 121 h) suggesting an additive effect with two copies of the VMA21 gene being beneficial for a shorter lag time.

Overall, these results have demonstrated a clear genetic linkage of CGI121 on Chr. XIII to fermentative lag time, and although RPS17a and VMA21 did not show allelic differences in terms of genetic linkage, both genes clearly affect the length of lag time when deleted.

Table 4 Microsatellite confirmation of F₁ hybrid strains between RM11-1a and S288C for RHA. Numbers are band sizes in bp. The 12 loci detected correspond to 10 variable microsatellite loci and two mating type loci, MATa and MATα, as described in Richards et al. (2009).

Strain	C3	C5	C8	C4	091c	AT4	AT2	Scaat3	009c	267c	α	a
RM11-1a	121	139	146	259	260	296	364	381	419	-	-	480
S288C	120	174	130	240	303	296	358	407	443	-	457	-
RM11-1a x S288C	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a x S288C Δcgi121	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a x S288C Δrps17a	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a x S288C Δvma21	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a Δcgi121 x S288C	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a Δrps17a x S288C	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480
RM11-1a Δvma21 x S288C	120, 121	139, 174	130, 146	240, 259	260, 303	296	358, 364	381, 407	419, 443	-	457	480

Through genetic linkage analysis from a set of completely mapped 119 BY4716 × RM11-1a F₁ progeny, fermentation screening of single BY4743 deletants in candidate genes to narrow down the field, and RHA using RM11-1a and S288C, we have identified genetic linkage between fermentative lag time and the CGI121 gene on Chr. XIII, which likely corresponds to the high LOD score on Chr. XIII [22]. Deletion of Δcgi121 in homozygous diploid BY4743, and haploids RM11-1a and S288C, resulted in a significant increase in fermentative lag in SGM at 12.5 °C, compared to the corresponding wild types. The effect of the CGI121 gene in fermentative lag phase was different in the hemizygous single RHA F₁ hybrids, depending on whether they harboured the RM11-1a or the S288C allele, i.e. the RM11-1a Δcgi121 × S288C F₁ hybrid had a significantly longer fermentative lag duration than RM11-1a × S288C and RM11-1a × S288C Δcgi121. Mapping data from Deed et al. [22] determined that the difference in CGI121 in the F₁ progeny was derived from the S288C allele. Transcriptomics data also demonstrated that CGI121 transcripts are upregulated by at least 2-fold in an M2 × S288C F₁ hybrid vs. the M2 parent during the early stages of fermentation (at 2% weight loss) at 12.5 °C, suggesting a key difference in the regulation of the S288C CGI121 allele. Although the single nucleotide difference between the RM11-1a and S288C CGI121 alleles was synonymous, it has been reported that synonymous mutations can result in differences in gene expression, with the use of particular codons significantly increasing transcript numbers [28]. Alternatively, there could be cis or trans regulatory effects depending on the allele position [23, 29].

Role of CGI121 and evidence for impact on fermentative lag time

CGI121 (YML036W) is a 652 bp gene encoding a small polypeptide component of the endopeptidase-like and kinase associated to transcribed chromatin (EKC)/kinase, endopeptidase and other proteins of small size (KEOPS) protein complex [30]. The EKC/KEOPS complex is highly conserved and has roles in transcription, telomere uncapping, chromosome segregation, and DNA repair, and is specifically required for threonine carbamoyl adenosine (t⁶A) tRNA modification and telomeric TG_1 − 3 recombination and length regulation [30–32]. There are five proteins within this complex, encoded by BUD32, CGI121, GON7, KAE1, and PCC1. Of the five genes, only Δkae1 null mutants are inviable, due to the severe growth impairment and chromosomal instability caused by deleting this essential gene, which encodes an ATPase [33, 34]. The role of Cgi121p in the EKC/KEOPS complex is to regulate Bud32p kinase activity by interacting with the N-terminal lobe, which in turn regulates the Kae1p ATPase, allowing for downstream function and catalytic activities [33, 35]. Cgi121p does not directly participate in the t⁶A tRNA modification function of the complex, but is important for telomere length regulation and recombination [30, 34, 36], and may also be involved in creating stable connections between each KEOPS subunit, allowing for correct assembly [37]. In S. cerevisiae, Cgi121p is the least essential of the five proteins in the EKC/KEOPS complex for retaining functionality but is required for maximal activity [37], with the phenotypes of Δcgi121 mutants being much milder than those displayed by Δkae1 or Δbud32 mutants [32–34].

Classical genetics studies have shown that null mutants of Δcgi121 have increased replicative lifespan and viability, and reduced single-stranded DNA at uncapped telomeres which functions to initiate telomere recombination [34, 36]. Deletion of Δcgi121 in BY4742 resulted in cells with a 50% longer lifespan, as the absence of CGI121 inhibits telomere recombination and therefore provides greater genome stability [36]. Large-scale surveys have implicated the Δcgi121 deletion in causing reduced vegetative and fermentative growth rates; however, data from Srinivasan et al. [30] suggests that the vegetative growth of a W303-1A Δcgi121 mutant was close to wild type on solid medium after two days growth at 30 °C. In the propagation of BY4743 Δcgi121 for fermentation in this research there did not appear to be any difference in vegetative growth in YPD compared to BY4743, with equivalent cell titres (data not shown), but there could be a difference in lag phase earlier on in vegetative growth which was not observable after 24 hours of growth at 28 °C. In terms of fermentative growth, Δcgi121 was identified by Steinmetz et al. [38] as showing reduced growth on YPD with 2% glucose; however, this screen was aerobic and does not adequately represent the fermentation environment. Hoose et al. [39] identified S288C mutants in Δcgi121 as having an increased duration of cell cycle progression in G₁ phase, with the percentage of S288C Δcgi121 G₁ cells greater than two standard deviations (41.57%) above wild type S288C at equivalent measurement times. The longer period spent in G₁ phase would mean that Δcgi121 cells do not divide as often as wild type and can explain the longer lag time during fermentation. Cell division and vegetative growth influences the timeframe of the fermentative lag phase and stressful environmental conditions, such as those encountered in the enological environment can significantly prolong G₁ [39], which could be why the impact of the Δcgi121 was more pronounced during fermentation at low temperature. The presence of certain nutrients also influences the timing through G₁ to START, from where the rest of the growth cycle can be completed. When shifting from poor to rich medium, the G₁ phase can be prolonged temporarily until the cells reach a critical size allowing them to commit to a phase of cell division [39]. In Δcgi121 mutants, there is a decreased rate of carbon and nitrogen utilization, with abnormal glucose and arginine metabolism [40], as well as an upregulation of carbohydrate metabolism genes in Δcgi121 mutants compared to wild type [41]. Therefore, abnormal usage of glucose, a primary carbon source in grape juice and SGM, as well as decreased nitrogen consumption and accumulation of arginine, could greatly impact on the lag duration of Δcgi121 mutants during fermentation.

Impact of RPS17a and VMA21 on fermentative lag duration

We have also shown that along with the single deletion in Δcgi121, single deletions in Δrps17a (encoding a ribosomal protein of the small 40S subunit [42]), and Δvma21 (encoding an integral membrane protein required for V-ATPase function [43]) resulted in an extended lag time duration in BY4743, RM11-1a and S288C; however, neither RPS17a nor VMA21 provided clear evidence for any genetic linkage via RHA analysis. Interestingly, Δrps17a mutants demonstrate a prolonged G₁ phase in the cell cycle, in the same way as Δcgi121 [39], which could explain the influence of the null mutant on fermentative lag. Null mutations in Δvma21, result in a multitude of phenotypes in S. cerevisiae, with decreased resistance to oxidative and osmotic stress [44], and decreased thermotolerance [45], all of which can result in a longer fermentative lag time [13]. Although Δvma21 mutants also had a decreased carbon utilization rate, these were for non-fermentable carbon sources [40, 44]. The QTL responsible for the high LOD score on Chr. VII in Deed et al. [22] is yet to be identified, but may be derived from the RM11-1a parent, which would mean that the initial BY4743 screen was so useful for pinpointing the QTL responsible.

We have shown that single deletions of Δcgi121, Δrps17a and Δvma21 result in increased fermentative lag duration in S. cerevisiae. This research has also demonstrated that the CGI121 gene, encoding a component of the EKC/KEOPS complex, is responsible for genetic linkage of a QTL on Chr. XIII to fermentative lag phase in S. cerevisiae. Deletion of CGI121 in haploid RM11-1a and S288C resulted in an increase in fermentative lag. Allele swaps via RHA confirmed that the influence on lag duration was derived from the S288C CGI121 allele. A greater understanding of the role of the CGI121 in stress tolerance will allow easier manipulation and/or selection of S. cerevisiae strains to shorten or lengthen lag time and provide growth advantages during the fermentation of foods and beverages.

S. cerevisiae strains

We utilized laboratory strain BY4743 (MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0) and 28 BY4743 single deletants derived from EUROSCARF containing a Kanamycin resistance construct (KanMX) in place of each ORF of interest (Table 1). The deletants were selected based on an original list of 44 candidates linked to lag phase in Deed et al. [22] after linkage analysis of 119/121 BY4716 × RM11-1a F₁ progeny using 2957 mapped loci [23]. Of the 44 original candidates, 28 were available from EUROSCARF. Single gene deletions in three of the 28 candidates of interest were constructed in S288C (MATα), standing in for the BY4716 parent, and RM11-1a (MATa HO::HphMX) (Table 2). Combinations of wild type and deletant versions of S288C and RM11-1a were then used to make hybrids for RHA.

Growth and fermentation conditions

S. cerevisiae cultures were propagated using yeast peptone dextrose medium (YPD) medium and incubated overnight at 28 °C, with orbital shaking at 150 revolutions per minute (rpm). BY4743 and BY4743 deletion mutants were fermented in 250-mL flasks with airlock at 12.5 °C and 15 °C in 100 mL SGM supplemented with additional amounts of the following amino acids: 10 × histidine (300 mg L^-1), 10 × leucine (300 mg L^-1) and 10 × uracil (100 mg L^-1) for auxotrophies [46]. RM11-1a and S288C wild types, deletants, and RHA hybrids were fermented at 12.5 °C in 13-mL tubes with 8 mL SGM. A < 0.5 mm² pin-hole was punctured into each tube lid to allow for CO₂ escape [22]. All fermentations were inoculated at density of 1 × 10⁶ cells mL^-1 and were monitored either 8-hourly or daily by measuring cumulative weight loss (g) (Bely et al. 1990).

Analysis of kinetic parameters

The length of lag phase (h) of BY4743 and the 28 BY4743 deletants at 15 °C was determined using the cumulative weight loss data to calculate the time elapsed between inoculation and the x-axis intercept where the steepest part of the slope transects y₀, as per Marullo et al. (2006). Lag phase duration for all fermentations performed at 12.5 °C was measured using a Gompertz model with curve fitting based on Tronchoni et al. [24] and executed using the R package nlstools [47].

Gene deletions and reciprocal hemizygosity analysis

Deletion of three candidate genes, CGI121, RPS17a and VMA21, within either the the Chr. VII or Chr. XIII QTLs linked to lag phase were constructed in RM11-1a Hgm^R and S288C using a modification of the Schiestl and Gietz (1989) lithium acetate yeast transformation protocol. Transformation of haploid RM11-1a and S288C was performed independently to generate mutants with KanMX insertions in CGI121, RPS17a, and VMA21 by amplifying the corresponding constructs, CGI121::KanMX, RPS17a::KanMX, and VMA21::KanMX, from BY4743 EUROSCARF deletion library strains. Transformation with a Nat^R pFLR-A plasmid was used as a positive control. Successful deletions were confirmed via PCR (list of oligonucleotide primers in Table 3) and gel electrophoresis. Crosses were made between RM11-1a and S288C wild types, and combinations of non-deleted RM11-1a with each S288C deletion mutant and vice versa, in order to construct diploid hemizygous F₁ hybrids for RHA [48] (crosses in Table 2). Since there were no markers in the S288C parent, this strain had to be present in 100 × excess of the RM11-1a deletion strain parent for mating (1 × 10⁸ cells mL^-1 S288C wild type with 1 × 10⁶ cells mL^-1 RM11-1a Hgm^R Kan^R deletion strain). Hybrids were selected on YPD plates containing 300 μg L^-1 hygromycin B and 200 μg L^-1 G-418. A multiplex PCR to amplify ten variable microsatellite markers and two mating type loci, MATa and MATα, was used to ensure that the hybridization was successful and to finalize strain selection since there would be some RM11-1a parents present when crossed with the marker-less S288C (Table 4) (Richards et al. 2009).

Statistical analysis and bioinformatics

All fermentation experiments were carried out in triplicate. Student’s t-tests were carried out using Microsoft Excel, while ANOVA and post-hoc Tukey’s HSD were performed using JASP software (version 0.12.2.0). Geneious Prime (version 2020.2.1) was used to align nucleotide sequences and translate to amino acids.

ANOVA: Analysis of variance; EUROSCARF: European Saccharomyces cerevisiae archive for functional analysis ; F₁: First filial; Hgm^R: Hygromycin resistant; HSD: Honestly significant difference; Kan^R: Kanamycin resistant; Nat^R: Natamycin resistant; OD: Optical density; ORF: Open reading frame; PCR: Polymerase chain reaction; QTL: Quantitative trait locus; RHA: Reciprocal hemizygosity analysis; SGM: Synthetic grape medium; YPD: Yeast peptone dextrose.

Acknowledgments

The authors would like to thank Kristine Boxen (Genomics Unit, School of Biological Sciences, University of Auckland) for processing the microsatellite samples and Max Huang for assisting RL in the laboratory.

Data availability

All strains are available upon request. The dataset supporting the results of this article are included in the article.

Funding

This work was supported by internal funding from the School of Chemical Sciences, University of Auckland.

Authors’ contributions

RL conducted the experiments, analyzed the data, and wrote the manuscript. RD conceived the study, participated in study design, analyzed the data, and wrote the manuscript. Both authors have read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

García-Ríos E, Morard M, Parts L, Liti G, Guillamón JM. The genetic architecture of low-temperature adaptation in the wine yeast Saccharomyces cerevisiae. BMC Genom 2017, 18(1).
Molina AM, Swiegers JH, Varela C, Pretorius IS, Agosin E. Influence of wine fermentation temperature on the synthesis of yeast-derived volatile aroma compounds. Appl Microbiol Biotechnol. 2007;77(3):675–87.
Llauradó JM, Rozès N, Bobet R, Mas A, Constantí M. Low temperature alcoholic fermentations in high sugar concentration grape musts. J Food Sci. 2002;67(1):268–73.
Colombie S, Malherbe S, Sablayrolles JM. Modeling alcoholic fermentation in enological conditions: feasibility and interest. Am J Enol Vitic. 2005;56(3):238–45.
Llauradó JM, Rozès N, Constanti M, Mas A. Study of some Saccharomyces cerevisiae strains for winemaking after preadaptation at low temperatures. J Agric Food Chem. 2005;53(4):1003–11.
Beltran G, Rozes N, Mas A, Guillamon JM. Effect of low-temperature fermentation on yeast nitrogen metabolism. World J Microbiol Biotechnol. 2007;23(6):809–15.
López-Malo M, Querol A, Guillamon JM. Metabolomic comparison of Saccharomyces cerevisiae and the cryotolerant species S. bayanus var. uvarum and S. kudriavzevii during wine fermentation at low temperature. PloS One. 2013;8(3):1–14.
Bisson LF. Stuck and sluggish fermentations. Am J Enol Vitic. 1999;50(1):107–19.
Ganucci D, Guerrini S, Mangani S, Vincenzini M, Granchi L: Quantifying the effects of ethanol and temperature on the fitness advantage of predominant Saccharomyces cerevisiae strains occurring in spontaneous wine fermentations. FRONT MICROBIOL 2018, 9(JUL).
García-Ríos E, Ramos-Alonso L, Guillamón JM: Correlation between low temperature adaptation and oxidative stress in Saccharomyces cerevisiae. FRONT MICROBIOL 2016, 7(AUG).
Redón M, Guillamón JM, Mas A, Rozès N. Effect of growth temperature on yeast lipid composition and alcoholic fermentation at low temperature. Eur Food Res Technol. 2011;232(3):517–27.
Marullo P, Bely M, Masneuf-Pomarède I, Pons M, Aigle M, Dubourdieu D. Breeding strategies for combining fermentative qualities and reducing off-flavor production in a wine yeast model. FEMS Yeast Res. 2006;6(2):268–79.
Ferreira D, Galeote V, Sanchez I, Legras JL, Ortiz-Julien A, Dequin S. Yeast multistress resistance and lag-phase characterisation during wine fermentation. FEMS Yeast Res 2017, 17(6).
Treu L, Campanaro S, Nadai C, Toniolo C, Nardi T, Giacomini A, Valle G, Blondin B, Corich V. Oxidative stress response and nitrogen utilization are strongly variable in Saccharomyces cerevisiae wine strains with different fermentation performances. Appl Microbiol Biotechnol. 2014;98(9):4119–35.
Camarasa C, Sanchez I, Brial P, Bigey F, Dequin S. Phenotypic landscape of Saccharomyces cerevisiae during wine fermentation: Evidence for origin-dependent metabolic traits. PLoS ONE 2011, 6(9).
Marullo P, Aigle M, Bely M, Masneuf-Pomarède I, Durrens P, Dubourdieu D, Yvert G. Single QTL mapping and nucleotide-level resolution of a physiologic trait in wine Saccharomyces cerevisiae strains. FEMS Yeast Res. 2007;7(6):941–52.
Salvadó Z, Chiva R, Rodriguez-Vargas S, Randez-Gil F, Mas A, Guillamón JM. Proteomic evolution of a wine yeast during the first hours of fermentation. FEMS Yeast Res. 2008;8(7):1137–46.
Rossignol T, Dulau L, Julien A, Blondin B. Genome-wide monitoring of wine yeast gene expression during alcoholic fermentation. Yeast. 2003;20(16):1369–85.
Albertin W, Zimmer A, Miot-Sertier C, Bernard M, Coulon J, Moine V, Colonna-Ceccaldi B, Bely M, Marullo P, Masneuf-Pomarede I. Combined effect of the Saccharomyces cerevisiae lag phase and the non-Saccharomyces consortium to enhance wine fruitiness and complexity. Appl Microbiol Biotechnol. 2017;101(20):7603–20.
Peltier E, Sharma V, Martí Raga M, Roncoroni M, Bernard M, Jiranek V, Gibon Y, Marullo P. Dissection of the molecular bases of genotype x environment interactions: A study of phenotypic plasticity of Saccharomyces cerevisiae in grape juices. BMC Genom 2018, 19(1).
Perez-Ortin JE, Querol A, Puig S, Barrio E. Molecular characterization of a chromosomal rearrangement involved in the adaptive evolution of yeast strains. Genome Res. 2002;12(10):1533–9.
Deed RC, Fedrizzi B, Gardner RC. Saccharomyces cerevisiae FLO1 gene demonstrates genetic linkage to increased fermentation rate at low temperatures. G3-GENES GENOM GENET 2017, 7(3):1039–1048.
Brem RB, Yvert G, Clinton R, Kruglyak L. Genetic dissection of transcriptional regulation in budding yeast. Science. 2002;296(5568):752–5.
Tronchoni J, Gamero A, Arroyo-López FN, Barrio E, Querol A. Differences in the glucose and fructose consumption profiles in diverse Saccharomyces wine species and their hybrids during grape juice fermentation. Int J Food Microbiol. 2009;134(3):237–43.
Charoenchai C, Fleet GH, Henschke PA. Effects of temperature, pH, and sugar concentration on the growth rates and cell biomass of wine yeasts. Am J Enol Vitic. 1998;49(3):283–8.
Torija MJ, Rozes N, Poblet M, Guillamon JM, Mas A. Effects of fermentation temperature on the strain population of Saccharomyces cerevisiae. Int J Food Microbiol. 2003;80(1):47–53.
Li BZ, Cheng JS, Ding MZ, Yuan YJ. Transcriptome analysis of differential responses of diploid and haploid yeast to ethanol stress. J Biotechnol. 2010;148(4):194–203.
Plotkin JB, Kudla G. Synonymous but not the same: The causes and consequences of codon bias. Nat Rev Genet. 2011;12(1):32–42.
Sinha H, Nicholson BP, Steinmetz LM, McCusker JH. Complex genetic interactions in a quantitative trait locus. PLoS Genet. 2006;2(2):140–7.
Srinivasan M, Mehta P, Yu Y, Prugar E, Koonin EV, Karzai AW, Sternglanz R. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification, t6A. EMBO J. 2011;30(5):873–81.
Liu YY, He MH, Liu JC, Lu YS, Peng J, Zhou JQ. Yeast KEOPS complex regulates telomere length independently of its t6A modification function. J Genet Genomics. 2018;45(5):247–57.
Kisseleva-Romanova E, Lopreiato R, Baudin-Baillieu A, Rousselle JC, Ilan L, Hofmann K, Namane A, Mann C, Libri D. Yeast homolog of a cancer-testis antigen defines a new transcription complex. EMBO J. 2006;25(15):3576–85.
Mao DYL, Neculai D, Downey M, Orlicky S, Haffani YZ, Ceccarelli DF, Ho JSL, Szilard RK, Zhang W, Ho CS, et al. Atomic Structure of the KEOPS Complex: An Ancient Protein Kinase-Containing Molecular Machine. Mol Cell. 2008;32(2):259–75.
Downey M, Houlsworth R, Maringele L, Rollie A, Brehme M, Galicia S, Guillard S, Partington M, Zubko MK, Krogan NJ, et al. A Genome-Wide Screen Identifies the Evolutionarily Conserved KEOPS Complex as a Telomere Regulator. Cell. 2006;124(6):1155–68.
Zhang W, Collinet B, Graille M, Daugeron MC, Lazar N, Libri D, Durand D, Van Tilbeurgh H. Crystal structures of the Gon7/Pcc1 and Bud32/Cgi121 complexes provide a model for the complete yeast KEOPS complex. Nucleic Acids Res. 2015;43(6):3358–72.
Peng J, He MH, Duan YM, Liu YT, Zhou JQ. Inhibition of Telomere Recombination by Inactivation of KEOPS Subunit Cgi121 Promotes Cell Longevity. PLoS Genet 2015, 11(3).
Perrochia L, Guetta D, Hecker A, Forterre P, Basta T. Functional assignment of KEOPS/EKC complex subunits in the biosynthesis of the universal t6A tRNA modification. Nucleic Acids Res. 2013;41(20):9484–99.
Steinmetz LM, Scharfe C, Deutschbauer AM, Mokranjac D, Herman ZS, Jones T, Chu AM, Giaever G, Prokisch H, Oefner PJ, et al. Systematic screen for human disease genes in yeast. Nat Genet. 2002;31(4):400–4.
Hoose SA, Rawlings JA, Kelly MM, Leitch C, Ababneh QO, Robles JP, Taylor D, Hoover EM, Hailu B, McEnery KA, et al: A systematic analysis of cell cycle regulators in yeast reveals that most factors act independently of cell size to control initiation of division. PLoS Genet 2012, 8(3).
VanderSluis B, Hess DC, Pesyna C, Krumholz EW, Syed T, Szappanos B, Nislow C, Papp B, Troyanskaya OG, Myers CL, et al: Broad metabolic sensitivity profiling of a prototrophic yeast deletion collection. Genome Biol 2014, 15(4).
Chou HJ, Donnard E, Gustafsson HT, Garber M, Rando OJ. Transcriptome-wide Analysis of Roles for tRNA Modifications in Translational Regulation. Mol Cell. 2017;68(5):978–92.e974.
Abovich N, Gritz L, Tung L, Rosbash M. Effect of RP51 gene dosage alterations on ribosome synthesis in Saccharomyces cerevisiae. Mol Cell Biol. 1985;5(12):3429–35.
Hill KJ, Stevens TH. Vma21p is a yeast membrane protein retained in the endoplasmic reticulum by a di-lysine motif and is required for the assembly of the vacuolar H+-ATPase complex. MOL BIOL CELL. 1994;5(9):1039–50.
Dudley AM, Janse DM, Tanay A, Shamir R, Church GM. A global view of pleiotropy and phenotypically derived gene function in yeast. Mol Syst Biol 2005, 1.
Jarolim S, Ayer A, Pillay B, Gee AC, Phrakaysone A, Perrone GG, Breitenbach M, Dawes IW. Saccharomyces cerevisiae genes involved in survival of heat shock. G3-GENES GENOM GENET 2013, 3(12):2321–2333.
Harsch MJ, Lee SA, Goddard MR, Gardner RC. Optimized fermentation of grape juice by laboratory strains of Saccharomyces cerevisiae. FEMS Yeast Res. 2010;10(1):72–82.
Baty F, Ritz C, Charles S, Brutsche M, Flandrois J, Delignette-Muller M. A Toolbox for Nonlinear Regression in R: The Package nlstools. J Stat Softw. 2015;66(5):1–21.
Steinmetz LM, Sinha H, Richards DR, Spiegelman JI, Oefner PJ, McCusker JH, Davis RW. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 2002;416(6878):326–30.

LiDeedFileS1.docx

Download PDF

Journal Publication

published 03 Mar, 2021

Read the published version in G3 Genes|Genomes|Genetics →

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

The CGI121 gene from Saccharomyces cerevisiae demonstrates genetic linkage to increased lag time under enological conditions

Status:

Journal Publication

Version 1

Abstract

Background

Results

Conclusion

Figures

Background

Results

Discussion

Conclusions

Methods

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1