Pulsed electromagnetic field stimulation:a preventive measure against glucocorticoid -induced osteoporosis in rats

doi:10.21203/rs.3.rs-4660116/v1

Download PDF

Research Article

Pulsed electromagnetic field stimulation:a preventive measure against glucocorticoid -induced osteoporosis in rats

https://doi.org/10.21203/rs.3.rs-4660116/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The use of pulsed electromagnetic field (PEMF) has demonstrated effectiveness in the management of femoral head osteonecrosis as well as nonunion fractures; however, the effects of PEMF on preventing glucocorticoid-induced osteoporosis (GIOP) have not been extensively studied. The aim of this investigation was to explore the effectiveness of PEMF stimulation in averting GIOP in rats and uncover the potential fundamental mechanisms involved.

Methods

A total of seventy-two adult male Wistar rats composed the experimental group and were subsequently assigned to three groups for treatment. (1) On the first day (day 0), 24 rats in the PEMF group were intravenously injected with lipopolysaccharide (LPS) at a concentration of 10 µg/kg. This was followed by intramuscular injections of methylprednisolone acetate (MPSL) at a dose of 20 mg/kg for the subsequent three days (days 1–3). Subsequently, the rats were exposed to PEMF for 4 hours daily, with the duration varying from 1 to 8 weeks. (2) Adhering to the injection schedule of the PEMF group, the MPSL group (consisting of 24 rats) was administered LPS and MPSL, omitting PEMF stimulation. (3) The PS group (n = 24) was administered injections of 0.9% saline solution in an identical manner and at the same time intervals as the other two groups. At 1, 2, 4, and 8 weeks after the last MPSL (or saline) injection, bone mineral density (BMD), bone mineral content (BMC), and the expression levels of bone morphogenetic protein-2 (BMP-2) mRNA and protein in the proximal femur were measured.

Results

Analysis of the PS and PEMF groups at 1, 2, 4, and 8 weeks after the final saline (or MPSL) injection revealed no statistically significant differences in BMD or BMC(P > 0.05). From weeks 2 through 8, the MPSL group rats displayed a marked decrease in BMD and BMC compared to those of the PS group, and at the 4-week and 8-week time points, these values were significantly lower than those of the PEMF group (P < 0.05). Compared with those in the MPSL and PS groups, the expression levels of BMP-2 mRNA markedly increased after PEMF treatment, peaking one week later and sustaining a heightened state for four weeks, but decreased only at the eighth week. Conversely, BMP-2 protein expression exhibited a similar upward trend, peaking two weeks after PEMF treatment and then remaining elevated for the subsequent eight weeks.

Conclusions

PEMF stimulation has been shown to have prophylactic potential against GIOP in rats, possibly through the upregulation expression of BMP-2 expression.

Pulsed electromagnetic fields

glucocorticoid

osteoporosis

Osteoporosis, a highly prevalent bone disease across the globe, is characterized by low bone mineral density and compromised bone microstructure, ultimately culminating in fractures due to bone fragility[1]. The classification of osteoporosis comprises both primary and secondary forms, of which GIOP is the most common secondary variety[2]. Despite being a crucial therapy for illnesses such as severe acute respiratory syndrome (SARS), arthritis, asthma, and systemic lupus erythematosus (SLE)[3], the adverse effects of glucocorticoid treatment, namely, GIOP, remain a significant concern that cannot be overlooked. Over the past few years, the incidence of GIOP has increased significantly, exhibiting a growing trend among younger individuals[4–6]. The occurrence of fractures due to osteoporosis can result in substantial costs, especially for hip fractures. By comparison, averting osteoporosis appears to be a superior method for addressing this disease, as it incurs notably lower costs and boosts patients' quality of life. Unfortunately, a viable clinical method for the prevention and therapeutic management of GIOP has yet to be discovered[7, 8].

PEMF therapy has gained widespread adoption in treating nonunion fractures and femoral head osteonecrosis[9–11], exhibiting no additional adverse effects[12]. Although we have previously documented the capacity of PEMF to prevent steroid-induced osteonecrosis in rats[13], our understanding of its efficacy in preventing GIOP remains limited. Moreover, the precise mechanisms by which PEMF stimulation prevents GIOP have yet to be clarified. As a well-established growth factor, BMP-2 effectively promotes bone regeneration and augments bone density and resilience[14, 15]. In vivo, it is crucial for governing osteoblast proliferation and differentiation, and is commonly employed in the treatment of osteoporosis and its sequelae. We suggest that PEMF could be a valuable treatment for preventing GIOP, and we posit that its mechanism of action lies in promoting the expression of BMP-2. In cases where patients with arthritis, asthma, or SLE require high-dose glucocorticoid treatment, PEMF may be administered concomitantly to help prevent the development of GIOP.

The purpose of our research was to investigate the preventive role of PEMF in GIOP, which included quantifying the BMD and relative BMC in the proximal femur, as well as analyzing the levels of BMP-2 mRNA and protein.

Animals

A total of seventy-two male adult Wistar rats, weighing approximately 250–280 grams, participated in this research. The rats were individually housed in customized Plexiglas cages and kept in a stable environment with a 12-hour light-dark cycle, a temperature of 24–25°C, and humidity fluctuating between 50 and 55%. During the entire study, the rats had unrestricted access to food and water. The experimental methods were reviewed as necessary and were authorized by the Animal Administration Committee of Henan Provincial People's Hospital.

Grouping and treatment

On the initial day, forty-eight rats received an intravenous injection of 10 µg/kg

LPS, followed by intramuscular administration of 20 mg/kg MPSL acetate to the right gluteus medius muscle for three days, was administered at 24-hour intervals[13]. Subsequently, the rats were segregated into two distinct groups and subjected to the respective treatment protocols. (1) The PEMF group (n = 24) underwent 4-hour daily PEMF stimulation sessions beginning one day after the last methylprednisolone injection and continuing for a duration of 1 to 8 weeks. (2) The MPSL group (n = 24) did not receive any further intervention after the methylprednisolone injection. A control cohort comprising 24 rats that received injections of 0.9% saline following the same protocol and at identical intervals was used and designated the PS group. The parameters for the pulsed electromagnetic field were analogous to those documented in our prior study[13]. Each day, the rats belonging to the PEMF group underwent a 4-hour session of pulsed electromagnetic field exposure, whereas the control rats were kept in similar cages and did not receive any kind of stimulation. One, 2, 4, and 8 weeks after the last saline (or MPSL) injection, six rats from each group were humanely euthanized using a lethal dose of pentobarbital sodium, and the bilateral femurs were removed for analysis.

Bone mineral measurements

Immediately after soft tissue dissection, bone mineral measurements were conducted on the right femurs. Using dual-energy X-ray absorptiometry (DEXA) with high-resolution small animal software, the BMD and relative BMC of the proximal segment (accounting for 20% of the total femur length) of the right femurs were quantified. To ensure consistency and minimize operational variability, all samples were assessed and measured by the same technician, who adhered to an identical protocol.

Histology

Immediately after bone densitometry analysis, the proximal segment of the right femur was fixed in 4% neutral buffered paraformaldehyde and subsequently decalcified with 10% neutral buffered ethylenediaminetetraacetic acid (EDTA). Subsequently, the specimens were dehydrated using a series of ethanol concentrations, embedded in paraffin wax, and sliced into 5 µm coronal sections. After staining with hematoxylin and eosin (HE), the sections were observed and analyzed using a light microscope.

Polymerase chain reaction (PCR)

The upper third segment of the left femur, without prior fixation, was instantly plunged into liquid nitrogen for freezing and kept at -80°C to facilitate subsequent isolation of mRNA and proteins. Before pulverization commenced, the samples were rigorously weighed and then ground using a mortar and pestle under liquid nitrogen conditions, ensuring a setting free from RNase. We rigorously followed the manufacturer's guidelines for the extraction of total RNA utilizing TRIzol Reagent. Subsequently, the RNA amount was quantified by measuring its absorbance at 260 nm, referred to as A260. The ratio of the absorbance at 260 nm to that at 280 nm (A260/A280) served as an indicator of RNA purity. The structural integrity and molecular size distribution of the RNA were examined via formaldehyde-agarose gel electrophoresis, and the RNA was subsequently stained with ethidium bromide for visualization. cDNA was successfully synthesized using the Revert Aid First Strand cDNA Synthesis Kit. For PCR analysis, forward and reverse primers targeting BMP-2 and β-actin were used, as listed in Table 1. The reaction protocol began with an initial 5-minute denaturation phase at 94°C, followed by multiple amplification cycles, each of which included 30 seconds of denaturation at 94°C, 30 seconds of annealing at 60°C, and 45 seconds of extension at 72°C. An additional final extension phase was conducted at 72°C for 10 minutes. Amplification was carried out for 35 cycles for BMP-2 and 30 cycles for β-actin. Using 1.5% agarose gel electrophoresis, the PCR amplification products were analyzed, followed by ethidium bromide staining for visualization and subsequent imaging with a Geliance Imaging System. Quantitative analysis of the band intensities was performed using Quantity One software. Gene expression levels are expressed as the ratio of the optical density of BMP-2 to that of β-actin.

Table 1

The primers used for PCR analysis.
Gene	Primer sequence (5'-3')	Product size (bp)
BMP-2 β-actin	Forward: TTCAATTTAAGTTCTGTCCCTACTG Reverse: GCAAAGACCTGCTAATCCTCAC Forward: TGGTGGGTATGGGTCAGAAGG Reverse: ATGGCTGGGGTGTTGAAGGTC	349 265

Western blot analysis

The proximal one-third sections of the left femurs were dissected and manually pulverized in liquid nitrogen and subsequently homogenized in ice-cold radioimmunoprecipitation buffer that contained phenylmethylsulfonyl fluoride and a protease inhibitor cocktail. At 4°C and 14000 rpm, the samples were subjected to two rounds of centrifugation, each lasting 10 minutes. The supernatant was subsequently isolated, and 5× loading buffer was added to a quarter of the volume. The mixture was heated to 95°C for 5 minutes and then stored at -20°C for potential use in electrophoresis procedures. Using a 10% sodium dodecyl sulfate polyacrylamide gel, proteins were separated via electrophoresis and then transferred to polyvinylidene fluoride membranes. After blocking with 2% bovine serum albumin, the membrane was incubated with rabbit anti-BMP-2 or rabbit anti-β-actin primary antibodies overnight at 4°C. Subsequently, the membrane was incubated for 1 h with peroxidase-labeled secondary antibodies at 25°C. After utilizing an enhanced chemiluminescence (ECL) plus kit for detection, the proteins on the membrane were imaged on X-ray film and then captured digitally using a Geliance Imaging System. The analysis of band optical density was performed using the Quantity One software package. The BMP-2 expression level was normalized to the β-actin expression level.

Statistical analysis

The data are presented as the mean ± SD. The statistical analyses were conducted with SPSS version 26.0. To assess group differences, we conducted one-way ANOVA supplemented with Turkey's test for multiple comparisons. Statistical significance was achieved for all tests with a P-value less than 0.05.

BMD and BMC of the Proximal Femur

During the experimental phase, no rat died, ensuring complete survival. The BMD and BMC values of the proximal femur are presented in Fig. 1. The comparison of BMD and BMC between the PEMF and PS groups revealed no statistically significant differences at 1, 2, 4, or 8 weeks post-MPSL (or saline) injection (P > 0.05). From weeks 2 to 8, the MPSL group exhibited significantly lower BMD and BMC values than did the PS group, and at weeks 4 and 8, these values were also significantly lower than those of the PEMF group (P < 0.05).

Histological observation of the proximal femur

Figure 2 shows the histological images of the proximal femur tissue from the three groups at week 8. Within the MPSL group, cartilage erosion was observed, and the bone trabecula of the proximal femur appeared sparse or fractured. The samples obtained from the PEMF group were healthy and were characterized by undamaged cartilage and intact bone trabecula.

mRNA expression of BMP-2

Over the period from weeks 1 to 8, a marked decrease in BMP-2 mRNA expression was observed in the MPSL group compared to the PS group (P < 0.05). From weeks 1 to 8, the PEMF group displayed a statistically significant increase in BMP-2 mRNA expression compared to the MPSL group (P < 0.05). Moreover, in the initial four weeks after PEMF stimulation, the expression levels were notably greater than those in the PS group (P < 0.05), as illustrated in Fig. 3.

Protein expression of BMP-2

From weeks 1 through 8, the PEMF group exhibited significantly greater BMP-2 protein expression than did the MPSL and PS groups (P < 0.05). Compared with the other two groups, the MPSL group displayed significantly lower BMP-2 protein expression (P < 0.05) (Fig. 4).

Osteoporosis is a bone disease that involves bone mass loss and structural weakening, resulting in bones that are more fragile and prone to fractures[16]. An imbalance between bone resorption and bone formation plays a significant role in the progression of various types of osteoporosis, ultimately leading to a decrease in bone mineral density and overall bone strength[17]. Glucocorticoid medication, which has anti-inflammatory effects, is a commonly administered therapeutic for a wide array of illnesses, such as arthritis, lupus, and respiratory disorders such as asthma[3]. Based on previous investigations, glucocorticoid therapy diminishes bone formation and intensifies bone resorption, resulting in negative calcium homeostasis and heightened vulnerability to fractures[18, 19]. Immediately upon glucocorticoid treatment, bone loss sets in rapidly, increasing the likelihood of fractures, while prolonged glucocorticoid administration contributes to the onset of osteopenia. Previous research has suggested that a low dose of glucocorticoids notably curtails bone formation, presumably due to diminished bone remodeling, which has implications for bone strength[20, 21]. In our investigation, following glucocorticoid administration, the rats in the MPSL group exhibited cartilage erosion, and the bone trabeculae in the proximal femur were either infrequent or disrupted. Currently, numerous pharmacological modalities are available for the treatment of osteoporosis, including calcium, vitamin D, bisphosphonates, hormone replacement therapy, calcitonin, parathyroid hormone, and raloxifene[22, 23]. However, the extended use of osteoporosis medications is associated with potential adverse effects, including atypical femoral fractures in the subtrochanteric or diaphyseal region, gastrointestinal distress, and necrosis of the jawbone[24].

Apart from pharmacotherapy, physical therapy that incorporates safe and nonintrusive biophysical interventions should be strongly advocated for clinical use. Compared to pharmacological interventions, PEMFs are considered an effective treatment modality for a wide range of bone conditions, including fresh fractures, fractures with delayed healing or failure to unite, diabetic osteopenia, and bone necrosis[25]. To date, there is a lack of clarity regarding the effects PEMF exerts on patients with GIOP. PEMFs, with their beneficial effects as a form of mechanical stimulation for bone mass preservation, have potential for clinical use in preventing and managing osteoporosis[25, 26]. This research aimed to examine the preventative impact of PEMF on GIOP in rats, while delving into the mechanisms responsible. Inspired by the report published by Ishida et al., the PEMF parameters were chosen based on their observation that PEMF can lower the chances of steroid-induced osteonecrosis[27]. Guided by our preceding research, we kept the electromagnetic frequency constant while modifying the daily stimulation interval from 10 hours to 4 hours[13].

Monitoring the BMD and BMC in the proximal femur of the rats revealed a progressive decrease in the MPSL group, starting at week 2 and attaining the lowest values by week 8. A marked statistical distinction was observed in comparison to the remaining two groups, suggesting that the administration of glucocorticoids diminishes BMD and BMC in rats, thereby contributing to the development of GIOP. In contrast, compared with those in the PS group, the BMD and BMC in the PEMF group did not significantly differ at any measurement point, and these values were markedly greater than those in the MPSL group at weeks 4 and 8. Hence, we are convinced that PEMF has the potential to counter glucocorticoid-mediated bone loss, thereby sustaining BMD and BMC within normal levels.

BMP-2, a growth factor that accelerates bone renewal and boosts bone robustness and density, has garnered widespread application in the treatment of osteoporosis and its associated conditions[14, 15]. Because of its fleeting half-life and inadequate retention capability, BMP-2 is unsuitable for administration as a standalone injection[28]. Additionally, the direct administration of large quantities of BMP-2 can result in severe complications and side effects. PEMF, a noninvasive therapeutic method, exhibits endocrine-like actions, promoting the a sustained secretion of cytokines, such as transforming growth factor-β1 (TGF-β1) and BMP-2, that aid osteoblast differentiation in bone tissue affected by a fracture, thus facilitating bone tissue reparative processes[29]. However, the precise mechanism responsible for PEMF mediated enhancement of bone formation, specifically in GIOP treatment, is still not fully understood. The findings of our investigation revealed a downregulation of BMP-2 mRNA and protein expression in the MPSL cohort, whereas an upregulation was observed in the PEMF group. Hence, there is a significant probability that PEMF stimulation boosts BMP-2 expression in the proximal femur area of rats given glucocorticoids, playing a role in the prevention of GIOP, likely constituting one of the key mechanisms involved. As a prophylactic measure, PEMF could be administered alongside glucocorticoids for the management of various clinical disorders, including arthritis, asthma, and SLE, for which high-dose glucocorticoid therapy is necessary.

PEMF stimulation can prevent GIOP in rats, and the underlying mechanisms increased the expression of BMP-2. PEMF stimulation is both effective and safe without the need for invasive procedures, serves as a beneficial prophylaxis for GIOP.

PEMF: Pulsed electromagnetic field; GIOP: Glucocorticoid-induced osteoporosis; LPS: Lipopolysaccharide; MPSL: Methylprednisolone acetate; BMD: Bone mineral density; BMC: Bone mineral content; BMP-2: Bone morphogenetic protein-2; SARS: Severe acute respiratory syndrome; SLE: Systemic lupus erythematosus; DEXA: Dual-energy X-ray absorptiometry; EDTA: Ethylenediaminetetraacetic acid; HE: Hematoxylin and eosin; PCR: Polymerase chain reaction; ECL: enhanced chemiluminescence; TGF-β1: Transforming growth factor-β1.

Ethics approval and consent to participate

The experimental methods were reviewed as necessary and were authorized by the Animal Administration Committee of Henan Provincial People's Hospital.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the Henan Provincial Medical Science and Technology Tackling Program Joint Project (LHGJ20230041).

Clinical Trial Number

LHGJ20230041

Registration Date

October 16, 2023

Authors’contributions

Shuai Ding, Guangquan Zhang and Yanzheng Gao were involved in the design of the study. Shuai Ding and Guangquan Zhang carried out the histopathological and Bone mineral measurements. Zhiqiang Hou and Fuqiang Shao carried out the molecular analysis. Yanzheng Gao performed the statistical analysis. Shuai Ding and Guangquan Zhang drafted the manuscript. All authors read and approved

the final manuscript.

Acknowledgements

None

Authors' information

Department of Spine and Spinal Cord Surgery, Henan Provincial People’s Hospital; People’s Hospital of Zhengzhou University; People’s Hospital of Henan University, Zhengzhou, China.

Address Correspondence: Guangquan Zhang, MD

No. 7, Weiwu Road, Jinshui District, Zhengzhou 450003, Henan, China

E-mail: [email protected]

Eastell R, O'Neill TW, Hofbauer LC, Langdahl B, Reid IR, Gold DT, Cummings SR: Postmenopausal osteoporosis. Nat Rev Dis Primers 2016, 2:16069.
Sadat-Ali M, Alelq AH, Alshafei BA, Al-Turki HA, Abujubara MA: Osteoporosis prophylaxis in patients receiving chronic glucocorticoid therapy. Ann Saudi Med 2009, 29(3):215-218.
Cho SK, Sung YK: Update on Glucocorticoid Induced Osteoporosis. Endocrinol Metab (Seoul) 2021, 36(3):536-543.
Buckley L, Guyatt G, Fink HA, Cannon M, Grossman J, Hansen KE, Humphrey MB, Lane NE, Magrey M, Miller M et al: 2017 American College of Rheumatology Guideline for the Prevention and Treatment of Glucocorticoid-Induced Osteoporosis. Arthritis Rheumatol 2017, 69(8):1521-1537.
Chotiyarnwong P, McCloskey EV: Pathogenesis of glucocorticoid-induced osteoporosis and options for treatment. Nat Rev Endocrinol 2020, 16(8):437-447.
Kubo T, Ueshima K, Saito M, Ishida M, Arai Y, Fujiwara H: Clinical and basic research on steroid-induced osteonecrosis of the femoral head in Japan. J Orthop Sci 2016, 21(4):407-413.
Adami G, Saag KG: Glucocorticoid-induced osteoporosis update. Curr Opin Rheumatol 2019, 31(4):388-393.
Song L, Cao L, Liu R, Ma H, Li Y, Shang Q, Zheng Z, Zhang L, Zhang W, Han Y et al: The critical role of T cells in glucocorticoid-induced osteoporosis. Cell Death Dis 2020, 12(1):45.
Massari L, Fini M, Cadossi R, Setti S, Traina GC: Biophysical stimulation with pulsed electromagnetic fields in osteonecrosis of the femoral head. J Bone Joint Surg Am 2006, 88 Suppl 3:56-60.
Bassett CA, Mitchell SN, Gaston SR: Pulsing electromagnetic field treatment in ununited fractures and failed arthrodeses. Jama 1982, 247(5):623-628.
Pan X, Xiao D, Zhang X, Huang Y, Lin B: Study of rotating permanent magnetic field to treat steroid-induced osteonecrosis of femoral head. Int Orthop 2009, 33(3):617-623.
Sutbeyaz ST, Sezer N, Koseoglu BF: The effect of pulsed electromagnetic fields in the treatment of cervical osteoarthritis: a randomized, double-blind, sham-controlled trial. Rheumatol Int 2006, 26(4):320-324.
Ding S, Peng H, Fang HS, Zhou JL, Wang Z: Pulsed electromagnetic fields stimulation prevents steroid-induced osteonecrosis in rats. BMC Musculoskelet Disord 2011, 12:215.
Park SB, Park SH, Kim NH, Chung CK: BMP-2 induced early bone formation in spine fusion using rat ovariectomy osteoporosis model. Spine J 2013, 13(10):1273-1280.
Segredo-Morales E, García-García P, Reyes R, Pérez-Herrero E, Delgado A, Évora C: Bone regeneration in osteoporosis by delivery BMP-2 and PRGF from tetronic-alginate composite thermogel. Int J Pharm 2018, 543(1-2):160-168.
NIH Consensus Development Panel on Osteoporosis Prevention, Diagnosis, and Therapy, March 7-29, 2000: highlights of the conference. South Med J 2001, 94(6):569-573.
Tanaka Y, Ohira T: Mechanisms and therapeutic targets for bone damage in rheumatoid arthritis, in particular the RANK-RANKL system. Curr Opin Pharmacol 2018, 40:110-119.
Hozayen WG, El-Desouky MA, Soliman HA, Ahmed RR, Khaliefa AK: Antiosteoporotic effect of Petroselinum crispum, Ocimum basilicum and Cichorium intybus L. in glucocorticoid-induced osteoporosis in rats. BMC Complement Altern Med 2016, 16:165.
Zhao J, Li Y, Zhang H, Shi D, Li Q, Meng Y, Zuo L: Preventative effects of metformin on glucocorticoid-induced osteoporosis in rats. J Bone Miner Metab 2019, 37(5):805-814.
Fan Q, Zhan X, Li X, Zhao J, Chen Y: Vanadate inhibits dexamethasone-induced apoptosis of rat bone marrow-derived mesenchymal stem cells. Ann Clin Lab Sci 2015, 45(2):173-180.
Esmail MY, Sun L, Yu L, Xu H, Shi L, Zhang J: Effects of PEMF and glucocorticoids on proliferation and differentiation of osteoblasts. Electromagn Biol Med 2012, 31(4):375-381.
Jacobs JW, de Nijs RN, Lems WF, Geusens PP, Laan RF, Huisman AM, Algra A, Buskens E, Hofbauer LC, Oostveen AC et al: Prevention of glucocorticoid induced osteoporosis with alendronate or alfacalcidol: relations of change in bone mineral density, bone markers, and calcium homeostasis. J Rheumatol 2007, 34(5):1051-1057.
Minisola S, Scillitani A, Romagnoli E: Alendronate or alfacalcidol in glucocorticoid-induced osteoporosis. N Engl J Med 2006, 355(20):2156-2157; author reply 2157.
Canalis E, Mazziotti G, Giustina A, Bilezikian JP: Glucocorticoid-induced osteoporosis: pathophysiology and therapy. Osteoporos Int 2007, 18(10):1319-1328.
Liu HF, Yang L, He HC, Zhou J, Liu Y, Wang CY, Wu YC, He CQ: Pulsed electromagnetic fields on postmenopausal osteoporosis in Southwest China: a randomized, active-controlled clinical trial. Bioelectromagnetics 2013, 34(4):323-332.
Garland DE, Adkins RH, Matsuno NN, Stewart CA: The effect of pulsed electromagnetic fields on osteoporosis at the knee in individuals with spinal cord injury. J Spinal Cord Med 1999, 22(4):239-245.
Ishida M, Fujioka M, Takahashi KA, Arai Y, Kubo T: Electromagnetic fields: a novel prophylaxis for steroid-induced osteonecrosis. Clin Orthop Relat Res 2008, 466(5):1068-1073.
Chen CY, Rao SS, Yue T, Tan YJ, Yin H, Chen LJ, Luo MJ, Wang Z, Wang YY, Hong CG et al: Glucocorticoid-induced loss of beneficial gut bacterial extracellular vesicles is associated with the pathogenesis of osteonecrosis. Sci Adv 2022, 8(15):eabg8335.
Tepper OM, Callaghan MJ, Chang EI, Galiano RD, Bhatt KA, Baharestani S, Gan J, Simon B, Hopper RA, Levine JP et al: Electromagnetic fields increase in vitro and in vivo angiogenesis through endothelial release of FGF-2. Faseb j 2004, 18(11):1231-1233.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Pulsed electromagnetic field stimulation:a preventive measure against glucocorticoid -induced osteoporosis in rats

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Statistical analysis

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1