Establishment and Characterization of Cri Du Chat Neuronal Stem Cells: A Novel Promising Resource to Study the Syndrome

doi:10.21203/rs.3.rs-4668676/v1

Download PDF

Research Article

Establishment and Characterization of Cri Du Chat Neuronal Stem Cells: A Novel Promising Resource to Study the Syndrome

https://doi.org/10.21203/rs.3.rs-4668676/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The Cri Du Chat (CdC) Syndrome is a rare chromosome disease condition resulting from variable size deletion occurring on the short arm of one of the chromosomes 5. This disorder, which affects one in 50,000 births, is responsible for developmental retardation, the mechanism of which has remained unexplained. TERT, SEMA5A, CTNND2, TPPP, mapped in chromosome 5 short arm, are known to be expressed in the brain, and to play a role in the development of the nervous system, oligodentrocytes and in the regulation of glutamatergic and dopaminergic synaptic transmission. It is critical to understand how their haploinsufficiency might affect the development and presentation of the disease. In the absence of an animal model and of significant accessible, human tissue, human pluripotent stem cells (iPSC) directly reprogrammed from patient somatic cells open a new area of disease modeling as they can virtually be differentiated into any cell type. Our study reports, for the first time, the generation of neuronal stem cells (NSCs) from CdC-iPSCs line and in addition, subsequent differentiation into a heterogeneous population of neurons. Gene expression of the mentioned and single copy deleted genes was also evaluated by comparing their expression level in iPSC, NSCs and neuron lines. The present research represents the first and the most innovative approach, to create an in vitro CdC neuronal model to have a new translational framework to study the pathological processes.

iPSCs-NSC

Cri du Chat syndrome

Cri du Chat neurons

deletion chromosome 5p

disease modeling

Cri-du-Chat (CdC) syndrome is a rare genetic disease caused by total or partial deletion in the short arm of chromosome 5 [1] with the incidence of 1:50,000 live-born infants [2–4]. The main clinical features are a high-pitched monochromatic cry, microcephaly, severe psychomotor and mental retardation. Children have hyperactivity, with clinical features of attention deficit disorder [5], impulsiveness, temper tantrums, obsessive-compulsive disorder, poor concentration, aggressive behaviors, such as biting, hair pulling, pinching, and hitting, and self-injurious behaviors. Individuals may have characteristics of neurodegenerative and autism spectrum disorders [6]. The most frequent structural brain abnormalities in CdC patients, as shown by the few studies available in the literature using MRI, include brain stem hypoplasia, with predominantly pontine involvement, thinning or agenesis of the corpus callosum, cerebellar vermian atrophy or agenesis, cerebellar cortical thickening, and incomplete arborization of the white matter [7, 8]

Using 18F-FDG PET/CT, the differences in brain glucose metabolism between CdC patients and control subjects were disclosed [9].

A study performed after autopsy revealed neuronal intracytoplasmatic inclusion positive for α-Synuclein, Tau, β-amyloid. The brain exhibited minimal inflammation without evidence of infection. Electron microscopy demonstrated Lewy-body (LB)-like inclusions in the neurons. These neuropathological features suggested α-Synucleinopathy with LB-like pathology in CdC disease [10].

Studies, performed in silico for deleted genes in CdC syndrome, highlighted the link between inflammation related to NF-kB/IL1 activation, TERT-induced TNF-a reduction and IL6-induced inflammation [11].

Loss of several genes in the 5p region contributes to the phenotype and to play a role in the development of the nervous system. In particular, the CTNND2, SEMA5A, TPPP, TERT genes seem to be involved in the process of neuronal development and the deletion of one allele could contribute to the syndrome phenotype.

CTNND2, delta-catenin protein, is expressed early in neurons and is thought to play a role in neuronal migration. A mouse model showed that δ-catenin regulated the maintenance of dendrites and dendritic spines in mature cortex of the mouse. [12–15]. SEMA5A, Semaphorin, is one of a large class of proteins that function throughout the nervous system to guide axons [16]. TPPP, TPPP/p25, is a microtubule associated protein, expressed in the human brain that modulates the dynamics and stability of the microtubule system, where is primarily engaged in the development of projections of oligodendrocytes that are responsible for the ensheathment of axons [17–19]. The non-physiological expression levels of this protein lead to distinct diseases such as synucleinopathies [20, 21].

TERT encodes for a ribonucleoprotein polymerase, that maintains telomere ends by addition of the telomere repeat TTAGGG [22]. Telomerase expression plays a role in cellular senescence. Studies in mouse suggest that telomerase also participates in chromosomal repair and has additional roles in cell survival, mitochondrial function, DNA repair, and Wnt signaling, all of which are unrelated to telomeres [23, 24]. TERT is enriched in Purkinje neurons, is expressed in the neonatal brain of mice as well as in distinct regions of the adult mouse brain such as the olfactory bulb, subventricular zone, hippocampus, cortex [25, 26]. Recently, many additional activities exhibited by TERT have been identified. This indicates that TERT may has telomere-independent biological functions [27–29].

While it is clear that these genes located in the deleted region could play a crucial role for the development and function of the nervous system, nonetheless we are far from a conclusive agreement on their function and the consequences of their deletion in hemizygosis on the CdC syndrome.

To date, animal models are not available for CdCS study. Induced pluripotent stem cells (iPSCS) represent an accurate model to investigate the physiopathology of affected human cells and a suitable tool to test drugs or novel therapeutic approaches [30–36].

We have previously reprogrammed to pluripotency peripheral blood mononuclear cells (PBMCs) derived from CdC patient [37]. Starting from these cells, we have differentiated and characterized CdC-Neuronal Stem cells (CdC-NSCs) and in addition, subsequent differentiation into a heterogeneous population of neurons. Our research aims to perform an initial analysis, so far undocumented, on neuronal cells that could express important signs related to the Cri du Chat patient's neurodevelopmental delay.

For this research we used healthy donor iPSCs, as a control, and the CdC-IPSCs lines so that we could compare results by highlighting discrepancies between normal and pathological differentiated cells. We obtained the first very important results on a heterogeneous neuronal population differentiated from CdC-IPSCs and, for the first time, expression data of the mentionated CdC deleted genes involved in neuronal process.

hiPSC Lines

We used healthy donor (HD) hiPSCs line, as a control, [38] and the UNI BSi004-A hiPSCs line derived from patient with CdC syndrome [37]. Reprogramming was previously described [37–39].

Differentiation of CdC-iPSCs into CdC-neural stem cells (CdC-NSCs)

The neuronal differentiation process consisted of the initial neural induction of iPSCs, and than the differentiation of the different subtypes of neurons [40–43]

A protocol based on PSC Neural Induction Medium, containing Neurobasal medium and Gibco PSC neural induction supplement (Thermo Fisher Scientific, catalog number: A1647801), a serum-free medium able to induce efficiently differentiation of iPSCs into NSCs, without requiring intermediate step of embryoid body (EB) formation or co-cultures with stromal cell lines, thus reducing experimental variability and time consuming, has been utilized to produce NSCs [41, 44].

iPSCs were split as small cell clumps into Matrigel-coated 6-well plates at a density of 3 x 10⁴ cells per cm². 24 hours after splitting, culture medium was switched to PSC Neural Induction Medium. Neural induction medium was changed every other day from day 0 to day 4 of neural induction. After day 4 of neural induction, neural induction medium was changed every day as cells reached confluence. At day 7 of neural induction, passage 0 NSCs (NSCs p0) were dissociated with StemPro Accutase (Thermo Fisher Scientific, catalog number: A11105-01) and plated on Matrigel-coated 6-well plates at a density of 5x 10⁴ cells per cm² in an NSC expansion medium containing 50% Neurobasal medium (Thermo Fisher Scientific, catalog number: 21103049), 50% Advanced DMEM/F12 (Thermo Fisher Scientific, catalog number: 12634), and neural induction supplement. NSC expansion medium was changed every other day until NSCs reached confluence. For NSCs before passage 4, 5 µM ROCK inhibitor Y27632 (Sigma-Aldrich, catalog number: Y0503) was added to NSC expansion medium at the time of NSCs plating to treat cells overnight for the prevention of cell death. Dissociated NSCs were collected for cryopreservation, expansion, and characterization.

NSCs Karyotype

NSCs at passage 6, undergoing active cell division, were blocked at metaphase by 10 µg/ml of colcemid (Karyo Max, Gibco Co. BRL), detached by trypsin–EDTA, and subsequently swollen by exposure to hypotonic KCL (0,075 M) solution. The cells were fixed with methanol/ glacial acetic acid (3:1) three times and dropped onto glass slides. Cytogenetic analyses were performed using QFQ-banding at 450 bands resolution. A minimum of 20 metaphase spreads and 3 karyograms were analyzed [45].

Neuronal differentiation of NSCs

Expanded NSCs at passage 10 were used for neuronal differentiation. Accutase-dissociated NSCs were plated onto poly-L-ornithine (Sigma-Aldrich, catalog number: P3655) and Laminin (ThermoFisher Scientific, catalog number: 23017015) coated 6 well plates in StemPro NSC SFM (Thermo Fisher Scientific, catalog number: A1050901) at 5 x 10⁴ cells/cm² for 2 days. This medium allows the proliferation of neuronal precursors. After 2 days, the medium was switched to neural differentiation medium composed by Neurobasal Medium supplemented with B-27 Supplement serum free (50x, Thermo Fisher Scientific, catalog number:17504044), GlutaMAX-I Supplement (100x, Thermo Fisher Scientific, catalog number: 35050038), culture one supplement (100x, Thermo Fisher Scientific, catalog number: A3320201), Ascorbic acid 2-phosphate-sesquimagnesium salt hydrate (200 mM, Sigma Aldrich, catalog number: A8960) and antibiotic-antimycotic (100x, Thermo Fisher Scientific, catalog number: 15240096). The culture medium was changed every 3 days, for 15 to 28 days. Neurons generated were collected for RNA analysis and immunostaining assays.

Quantitative Real Time PCR (qPCR)

qPCR assays based on SYBR-Green was performed for several markers, used to characterize NSCs and neurons lineages (Table 1). Briefly, total RNAs were extracted from specific cell culture, and purified using Macherey-Nagel NucleoSpin® RNA II kit (Macherey-Nagel, catalog number: 740955.250), according to the manufacturer’s protocol. A TURBO-DNase (Thermo Fisher Scientific, catalog number: AM1907) treatment was performed on RNA extracted, to ensure the elimination of residual genomic DNA. RNAs were retro-transcribed by ImProm-II™ Reverse Transcription System (Promega, catalog number: A3800), following the specific protocol. Assays have been carried out by using iTaq™ Universal SYBR® Green Supermix, (Bio-Rad, catalog number: 1725121), 10ng of total cDNA and 200mM of each primer. The annealing temperature has been set at 60°C.

Table 1

Primers set used for characterization of generated neuronal cell lines (qPCR assays based on SYBR-Green)
Gene	Forward 5’-3’	Reverse 5’-3’
ACTIN	CGCCGCCAGCTCACCATG	CACGATGGAGGGGAAGACGG
OCT4	CCTCACTTCACTGCACTGTA	CAGGTTTTCTTTCCCTAGCT
SOX2	CCCAGCAGACTTCACATGT	CCTCCCATTTCCCTCGTTTT
NESTIN	GCGTTGGAACAGAGGTTGGA	TGGGAGCAAAGATCCAAGAC
SOX1	CCTCCGTCCATCCTCTG	AAAGCATCAAACAACCTCAAG
PAX6	CTGAAGCGGAAGCTGCAAAG	TTGCTGGCCTGTCTTCTCTG
MAP2	GACTGCAGCTCTGCCTTTAG	AAGTAAATCTTCCTCCACTGTGAC
DCX	TATGCGCCGAAGCAAGTCTC	TACAGGTCCTTGTGCTTCCG
TUBB3	GGCCAAGTTCTGGGAAGTCAT	CTCGAGGCACGTACTTGTGA
GFAP	CTGCGGCTCGATCAACTC	TCCAGCGACTCAATCTTCCTC
GAD	GTCGAGGACTCTGGACAGTA	GGAAGCAGATCTCTAGCAAA
CHAT	ACTGGGTGTCTGAGTACTGG	TTGGAAGCCATTTTGACTAT
TH	TCATCACCTGGTCACCAAGTT	GGTCGCCGTGCCTGTACT

qPCR for gene expression in control and patient cell lines was performed using TaqMan Gene Expression Master mix (Applied Biosystems catalog number: 4369016), 10ng of total cDNA, and using Taqman probe assays: (HS00389316-m1, TPPP gene; HS01549381-m1 SEMA5A gene; HS00181643-m1 CTNND2 gene; HS00972656-m1, TERT gene; HS02758991-g1, GAPDH gene) (Thermo Fisher Scientific). All samples were analyzed in triplicates.

qPCR assays were performed on CFX96 C1000 Touch™ Real-Time PCR Detection System (Bio-Rad) and analyzed with Bio-rad CFX manager software v.3.1. (Bio-Rad). The relative quantification was calculated using the 2^-ΔΔCT method.

Immunofluorescence assay

Immunofluorescence assays was performed on adherent cells cultured on glass slides (Steroglass, catalog number: KITY025653) inserted in 24 well, to verify the expression of specific markers of NSCs and neurons. Initial washing was done with 1X phosphate-buffered saline (PBS) before fixing for 15 minutes with Reagent A (Fix & Perm-Reagent A, SIC, catalog number: GAS-002A-1). After fixing, the cells were either stored in 1X PBS at 4°C or stained immediately. Permeabilisation was performed with Reagent B (Fix & Perm-Reagent B, SIC, catalog number: GAS-002B-1) for 15 minutes. Then a blocking solution (iBindTM 5X Buffer-Invitrogen, catalog number: SLF1020) has been applied for 45 minutes. After blocking, cells were incubated with primary antibodies (Table 2) diluted in permeabilization Reagent B for 3 hours at room temperature. After incubation with primary antibodies, cells were washed three times with 1% BSA in 1X PBS, and incubated light-protected with secondary antibodies (Table 2) diluted in permeabilization Reagent B for 1 hours at room temperature. Following incubation, cells were washed twice with 1X PBS and incubated in 4',6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, D1306) diluted in 1X PBS for 5 min at room temperature. Finally, the glass slides were mounted with Glycerol Gelatin (Sigma Aldrich, catalog number: GG1) and stored at 4°C in the dark overnight. Cells have been observed under a fluorescence microscope, Olympus IX70 inverted microscope and images analyzed with the Image-Pro Plus software v7.0 (Media Cybernetics).

Table 2

Antibodies used for cell characterization with immunofluorescence assay.
Typology	Name Antibody	Catalog Number	Dilution	Host
Primary Ab.	NESTIN	Thermo Fisher Scientific, A24345	1:100	mouse
Primary Ab.	MAP2	Invitrogen, 13-1500	1:300	mouse
Primary Ab.	TH	Sigma Aldrich, AB152	1:200	Rabbit
Secondary Ab.	Goat anti rabbit IgG (H + L) Alexa Fluor 568	Thermo Fisher Scientific, A-11011	1:250	Rabbit
Secondary Ab.	Goat anti mouse IgG (H + L) Alexa Fluor 568	Thermo Fisher Scientific, A-11004	1:200	Mouse
Secondary Ab.	Goat anti rabbit IgG (H + L) Alexa Fluor 488	Thermo Fisher Scientific, A-11008	1:200	Rabbit
Conjugated Ab	Alexa FluorTM 488 Phalloidin	Invitrogen, A12379	1:500

Derivation of Expandable Population of Neural Stem Cells

The neural induction workflow is described in Fig. 1a. The iPSCs transition to NSCs phenotypes is shown in Fig. 1b. It is noteworthy that during the neural induction phase a change in iPSCs morphology was observed. At the initial stages of neural induction, cells expanded and displayed the typical iPSCs colonies shape: small round cells, and uniform surface with well defined edge. As the duration of the culture progressed to day 2–4 cells exhibited a rounder morphology with a very expanded and dense nuclei. By days 6/7 cells propagated and grew in a distinct uniform monolayer with some elongated cells emerging from the colonies.

The acquisition of the correct neuronal phenotype was firstly assessed by qualitative immuno-fluorescence staining on NSCs at passage 0 (p0) showing the presence of the NSCs markers, NESTIN, and the cytoskeletal marker Phalloidin, Fig. 1c. The cytogenetic analysis revealed no chromosomal aberrations, thus suggesting that the cells preserved their corrisponding karyotypes (Fig. 1d). Finally, to deepen the NSCs characterization, gene expression analysis of NSCs markers NESTIN, SOX1, SOX2, PAX6, and the pluripotent marker OCT4 was performed. The analysis in SYBR Green qPCR was conducted on RNAs collected at the end of the induction process (day 7, NSCs p0) comparing the newly generated NSCs with the parental iPSCs, set as calibrator. In Fig. 1e the activation of NSCs genes expression, associated to a strong reduction of iPSCs marker OCT4 is shown. The strong reduction of OCT4 expression prove the absence of residual untransformed iPSC colonies. CdC-derived NSCs display a similar expression pattern to the HD-derived NSCs, with prominent increase of SOX1, PAX6, and an expected moderate increment of SOX2 and NESTIN.

These results suggest that cells derived from iPSCs through neural induction process possess the NSC phenotype and, exploiting their multipotency ability, can be used to generate a population of neurons in vitro.

CdC-NSCs Can Be Differentiated to Neuronal Lineages

Expanded HD and CdC-NSCs at passage 10 were differentiated in neurons (Fig. 2a). The differentiation process led to the growth of a heterogeneous neuronal population after 30 days in culture. The morphological modifications occurred during neuronal differentiation are reported in Fig. 2b. At day 8, cells under differention stimuli spread on the plate and assume a more elongated shape in comparison to their parental NSCs that tend to grow clustered. Over several days the cells were in over confluence and began to form aggregates that reminds the neuronal rosettes [42].

To validate the neuronal phenotype acquisition of derived neurons, we analysed by immunofluorescence the protein expression of the neuro-cytoskeletal MAP2 marker, and the dopaminergic target TH. As shown in Fig. 2c, MAP2 is well expressed in both the control and the patient cells but with a different distribution: in the control, the differentiation has led to a well-organised and distributed neuronal network, whereas in the patient it appears minor and less structured. Moreover, a moderate reduced expression of TH is observad in the CdC neurons compared to HD. The gene expression panel, analysed from RNAs collected at day 15 and 30 of neuronal differentiation, have included neuronal cytoskeletal markers as doublecortin (DCX), microtubule associated protein 2 (MAP2) and β III tubulin (TUBB3), and others specific neuronal subpopulations markers as the glutamic acid decarboxylase (GAD) expressed in gabaergic neurons, the choline acetyltransferase (CHAT) expressed in cholinergic neurons, the tyrosine hydroxylase (TH) expressed in dopaminergic neurons and the glial fibrillary acidic protein (GFAP) encoded by the glial cells. Data were normalized on ACTIN and calculated in relation to parental NSCs line at passage 0. The graph shown in Fig. 2d reports the increase of all the neuronal markers in both HD and CdC NSCs-derived neurons apart from MAP2 and TUBB3, whose increases are less appreciable following the already consolidated expression in parental NSCs. Both HD and CdC neurons show as predominant subcellular population the dopaminergic one, represented by the strong induction of TH, followed by the cholinergic (CHAT) and finally the gabaergic (GAD). Moreover, all neuronal cultures at 15 days of differentiation showed a negligible level of GFAP that strongly increased after 30 days. Finally, these results suggest that both HD and CdC-derived NSCs can generate a heterogenous population of neurons endowed of the typical neuronal marker of maturity such MAP2 and TH. Comparing the HD and CdC performance, is notable that CdC-derived neurons at day 30 have a strong reduction of the TH and CHAT positive population and a slight significant increase in the GFAP positive cells.

Quantitative Real Time (qRT)-PCR deleted genes

We carried out the expression study of TERT, CTNND2, SEMA5A and TPPP, genes deleted in the heterozygous state, comparing their expression level in the iPSCs, NSCs and Neurons lines generated in vitro from HD and CdC cells.

In CdC- iPSCs, TERT gene expression is half as compared to the HD, CDNND2 value five times lower, SEMA5A gene expression is four times lower and TPPP about three times lower (Fig. 3a).

In CdC- NSCs, CDNND2 expression value is ten times less, SEMA5A is about a half and TPPP about ten times less than HD-derived NSCs while TERT expression is similar in the two populations (Fig. 3b)

In CdC-neurons, TERT gene expression is half as compared to HD, CDNND2 value is four times lower, SEMA5A gene expression is half and TPPP about ten times less (Fig. 3c).

The strong reduction of CDNND2, SEMA5A, and TPPP expression showed in CdC-derived iPSCs, NSCs, and neurons is statistically significant.

CdC syndrome scientific research is focused only on clinical and instrumental studies of affected patients, well defining the phenotype. As far as CdC syndrome is concerned, to date there are no animal models to study this rare chromosome disease. Our research group developed the first iPSCs model from PBMCs of a patient affected by CdC Syndrome [37]. Starting from these cells, we established and characterized a novel NSCs line. The stabilization, phenotypic matching of these cells and their multipotency ability allowed us to further differentiate them into heterogeneous neuronal cells to highlight, if possible, which neuronal subpopulation may be most involved in the pathological process of the syndrome. The choice of this target is dictated by the severe delay and neuro-motor development present in 100% of CdC patients caused by the characteristic deletion of the short arm of one chromosome 5, which translates into the loss of a copy of genes mapped in the 5 short arm. Our research visualizes a CdC-induced neuronal population, at 30 days of in vitro growth. The overview showed different patterns between the CdC and HD neuronal subpopulations, confirmed by the relative expressions. Comparing the gene expression panel for DCX, MAP2, TUBB3, TH, GAD, CHAT, and GFAP for the different types of neurons, the dopaminergic one is the predominant neuronal population both in HD and CdC-cells, followed by the cholinergic and gabaergic.

In CdC- neuronal line there is a general reduction in all the markers at both 15 and 30 days of growth, expecially for TH and CHAT genes, compared to the HD levels. These results might suggest that there may be both a low number but also a reduced functionality of subpopulations, probably related to deletion of above-mentioned genes. The reduced CHAT expression is reported in Alzeimer patients where a 60–95% decrease in CHAT activity has been noted [46, 47], index for down-functionality of cholinergic neurons, and, as we observe the same phenomenon, extensive studies are needed to define if the CHAT-positive population in CdC-induced neurons are hypofunctional. GABAergic neurons type is reduced in the CdC neuronal population and the obtained results of immunofluorescence on CdC TH positive neurons showed a very uneven appearance. GFAP gene expression is slightly increased in CdC. GFAP is a marker expressed by a heterogeneous population of the glia cells that have different roles in in the adult mammalian brain function such as myelination, synaptic function, modulation of homeostatic functions, nerve signal propagation and responses to neural injury [48–51]. GFAP is adopted as a marker of astrocytes in the central nervous system (CNS). GFAP levels increase as a nearly universal response to injury and disease, when astrocytes enter a state of “reactive gliosis” [52]

It will be interesting to differentiate only the astrocytic population and study its morphology, as well as do more in-depth studies on the microglia population because its activation or dysfunction can be associated with neuroinflammation, brain and energy metabolism as reported by Cistaro in a group of CdC patients [9].

The results of our study regarding gene expression of selected genes might help us to make hypotheses to understand and correlate the data obtained from neuronal differentiation.

At first, the very low relative expression we obtained suggests a downregulation of TPPP/p25 gene. More recently, TPPP/p25 was shown to be specifically expressed in myelinating oligodendrocytes important for oligodendrocyte differentiation and microtubule assembly in vitro [53, 54]. In the CNS, myelination is carried by oligodendrocytes derivated from oligodendrocyte progenitor cells (OPCs), which hold the capacity to proliferate, migrate, and differentiate into myelinating oligodendrocytes. It has been shown that at substoichiometric concentrations, TPPP/p25 promotes the polymerization of tubulin into aberrant forms, such as double-walled tubules and aggregates [55]. Our results seem indicate that very low expression might prevent oligodendrocyte differentiation.

TERT gene, in iPSCs and neuronal populations, is expressed respecting the hemizygosity, while in NSCs it is the same as the HD, perhaps highlighting an up-expression. Saretzki [27, 56] reports attributing an extra-telomerase role to the TERT protein, associating over-expression with a possible protective role, even if not entirely clear, against potential toxigenic proteins involved in neurodegeneration, already observed in post-mortem studies on a CdC patient [10]. There is interest in the role of telomerase protein for brain function, such as cognitive ability, ageing, brain injury and memory [57–61].

For SEMA5A gene, the expression value found in all three types of cell lines was half of the HD exactly as we expected. Regarding CTNND2 gene, the low expression value found in all three cell line types was surprising and unexpected. ð-catenin is a critical regulator of spine architecture in developing and mature neurons. In mouse model loss of ð -catenin leads to a reduction in the head width and length of spines [62]. However, our results are insufficient to understand how much the absence of an allele influences the development of dendritic spines and therefore more in-depth studies performed on different types of neuronal cells, will be necessary.

In conclusion, we successfully established and characterized new CdC NSCs from CdC-iPSCs, which allowed us to perform subsequent differentiation in a heterogeneous population of neurons. The differences shown between control and syndrome suggested to us that in the future, it will be necessary to differentiate individual neuronal subtypes such as dopaminergic, gabaergic, oligodentrocytic, and astrocytic for their possible prominent role in the pathology of the CdC patient, starting from aur CdC NSCs. We also reported and discussed, for the first time, the gene expression value of CTNND2, SEMA5A, TPPP, TERT genes, present in hemizygosity, in the three types of cell lines. The neural stem cells obtained will be a valuable and very important aid for in vitro functional research on CdC syndrome, advancing the understanding of the pathological mechanisms underlying the disease and contributing to the development of possible innovative treatments.

Funding

The research project was funded by the University of Brescia "Local Funds Ex 60%"

Conflict of interest

The authors declare that they have no known competing financial interests.

Ethics approval

This study was approved by the A.B.C scientific committee.

Informed consent

Not pertinent

Acknowledgments

We wish to thank the “Associazione Italiana Bambini Cri du Chat” (ABC) and the patient's family for the collaboration. We acknowledge the contribute of Fondazione A. Nocivelli.

Lejeune, J., Lafourcade, J., Berger, R., Vialatte, J., Boeswillwald, M., Seringe, P., Turpin, R., (1963) [3 cases of partial deletion of the short arm of a 5 chromosome.]. C R Hebd Seances Acad Sci.; 257:3098-102
Rodriguez-Caballero, A., Torres-Lagares, D., Rodriguez-Perez, A., Serrera-Figallo, M.A., Hernandez-Guisado, J.M., Machuca-Portillo, G. (2010) Cri du chat syndrome: a critical review. Med Oral Patol Oral Cir Bucal.;15: e473-e478. 3
Cerruti Mainardi, P. (2006) Cri du chat syndrome. Orphanet J Rare Dis.;1:33.
Nevado, J., Bel-Fenellós, C., Sandoval-Talamantes, A.K., Hernández, A., Biencinto-López, C., Martínez-Fernández, M.L., Barrúz, P., Santos-Simarro, F., Mori-Álvarez M.Á., Mansilla, E., García-Santiago, F.A., Valcorba, I., Sáenz-Rico, B., Martínez-Frías, M.L., Lapunzina, P., (2021) Phenotyping and Genetic Characterization of a Cohort of 70 Individuals With 5p Minus Syndrome. Front Genet. Jul 30; 12:645595.
Cornish, K.M., Pigram, J. (1996) Developmental and behavioural characteristics of cri du chat syndrome. Arch Dis Child.;75:448-50
Ajitkumar, A., Jamil, R.T., Mathai, J.K. Cri Du Chat Syndrome. (2021) In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; Sep 14.
Hong, J.H., Lee, H.Y., Lim, M.K. (2013). Brain stem hypoplasia associated with cri-du-chat syndrome. Korean J Radiol. 14:960–962
Villa, R., Fergnani, V.G.C., Silipigni, R., Guerneri, S., Cinnante, C., Guala, A., Danesino, C., Scola, E., Conte, G., Fumagalli, M., Gangi, S., Colombo, L., Picciolini, O., Ajmone, P.F., Accogli, A., Madia, F., Tassano, E., Scala, M., Capra, V., Srour, M., Spaccini, L., Righini, A., Greco, D., Castiglia, L., Romano, C., Bedeschi, M.F. (2020) Structural brain anomalies in Cri-du-Chat syndrome: MRI findings in 14 patients and possible genotype-phenotype correlations. Eur J Paediatr Neurol. Sep; 28:110-119.
Cistaro, A., Quartuccio, N., Piccardo, A., Fania, P., Spunton, M., Liava, A., Danesino, C., Albani, G., Guala, A. (2020) ¹⁸F-FDG PET Identifies Altered Brain Metabolism in Patients with Cri du Chat Syndrome. J Nucl MedAug;61(8):1195-1199
Dmetrichuk, J.M., Chiasson, D.A., Lu, J.Q. (2019) Neuronal inclusions and α-Synucleinopathy in a patient with 5p deletion syndrome. J Neurol Sci. Aug 15; 403:56-58.
Corrêa, T., Feltes, B.C., Riegel, M. (2019) Integrated analysis of the critical region 5p15.3-p15.2 associated with cri-du-chat syndrome. Genet Mol Biol.;42(1 suppl 1):186-196
Israely, I., Costa, R.M., Xie, C.W., Silva, A.J., Kosik, K.S., Liu, X. (2004) Deletion of the neuron-specific protein delta-catenin leads to severe cognitive and synaptic dysfunction. Curr Biol; 14:1657–1663.
Medina, M., Marinescu, R.C., Overhauser, J., Kosik, K.S. (2000) Hemizygosity of delta-catenin (CTNND2) is associated with severe mental retardation in cri-du-chat syndrome. Genomics; 63:157–164.
Matter, C., Pribadi, M., Liu, X. (2009) Trachtenberg JT Delta-catenin is required for the maintenance of neural structure and function in mature cortex in vivo. Neuron 64:320–327.
Belcaro, C., Dipresa, S., Morini, G., Pecile, V., Skabar, A., Fabretto, A. (2015) Ctnnd2 deletion and intellectual disability. Gene; 565:146–149.
Melin, M., Carlsson, B., Anckarsater, H., Rastam, M., Betancur, C., Isaksson, A., Gillberg, C., Dahl, C. (2006) Constitutional downregulation of SEMA5A expression in autism. Neuropsychobiology 54:64–69.
Conde, C., Cáceres, A. (2009) Microtubule assembly, organization and dynamics in axons and dendrites. Nat Rev Neurosci.;10(5):319–332
De Forges, H., Bouissou, A., Perez, F. (2012) Interplay between microtubule dynamics and intracellular organization. Int J Biochem Cell Biol.;44(2):266–274
Lehotzky, A., Tirián, L., Tőkési, N. (2004) Dynamic targeting of microtubules by TPPP/p25 affects cell survival. J Cell Sci.;117(Pt 25):6249–6259
Kovács, G.G., Gelpi, E., Lehotzky, A. (2007) The brain-specific protein TPPP/p25 in pathological protein deposits of neurodegenerative diseases. Acta Neuropathol.;113(2):153–161.
Kovács, G.G., László, L., Kovács, J. (2004) Natively unfolded tubulin polymerization promoting protein TPPP/p25 is a common marker of alpha-synucleinopathies. Neurobiol Dis.;17(2):155–162 This was the first study which proved the co-localization of TPPP/p25 and α-synuclein in inclusion bodies characteristic for PD and MSA, suggesting TPPP/p25 as a hallmark protein of synucleinopathies
Flores, I., Cayuela, M.L. and Blasco M.A. (2005). Effects of telomerase and telomere length on epidermal stem cell behavior. Science, 309, pp. 1253–1256
Tomlinson, R. L., Ziegler, T. D., Supakorndej, T., Terns R. M. and Terns M. P. (2006). Cell Cycle-regulated Trafficking of Human Telomerase to Telomeres. Molecular Biology of the Cell 17(2): 955-965.
Flores, I., Blasco M.A. (2010). The role of telomeres and telomerase in stem cell aging. FEBS Lett., 584, pp. 3826–3830
Tümpel, S. and Rudolph K.L. (2012). The role of telomere shortening in somatic stem cells and tissue aging: lessons from telomerase model systems. Ann. N.Y. Acad. Sci., 1266, pp. 28–39
Eitan, E., Braverman, C., Tichon, A., Gitler, D., Hutchison, E.R., Mattson, M.P., Priel, E. (2016) Excitotoxic and Radiation Stress Increase TERT Levels in the Mitochondria and Cytosol of Cerebellar Purkinje Neurons. Cerebellum. Aug;15(4):509-17.
Saretzki, G. (2014) Extra-telomeric function of human telomerase: Cancer, Mitochondria and Oxidative Stress. Curr Pharm Des. 20(41), 6386-403
Chung, H. K., Cheong, C., Song, J. and Lee, H. W. (2005). Extratelomeric functions of telomerase. Curr Mol Med 5(2): 233-241.
Radeghieri, A., Savio, G., Zendrini, A., Di Noto, G., Salvi, A., Bergese, P., and Piovani G. (2017) Cultured human amniocytes express hTERT, which is distributed between nucleus and cytoplasm and is secreted in extracellular vesicles. Biochem Biophys Res Commun. Jan 29;483(1):706-711
Takahashi, K., Yamanaka, S. (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. ;126: 663-76.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., Yamanaka, S. (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell.; 131: 861-72
Chhabra, A. (2017) Derivation of Human Induced Pluripotent Stem Cell (iPSC) Lines and Mechanism of Pluripotency: Historical Perspective and Recent Advances. Stem Cell Rev and Rep. Dec;13(6):757-773.
Ban, H., Nishishita, N., Fusaki, N., Tabata, T., Saeki, K., Shikamura, M., Takada, N., Inoue, M., Hasegawa, M., Kawamata, S. (2011) Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc. Natl. Acad. Sci. U. S. A.; 108, 14234–14239.
Bayart, E., Cohen-Haguenauer, O. (2013) Technological Overview of iPS Induction from Human Adult Somatic Cells. Current Gene Therapy,; 73: 92 73
Smith, Z., Sindhu, C., Meissner, A. (2016) Molecular features of cellular reprogramming and development. Nature Reviews, Molecular Cell Biology; 17: 139-152
Genova, E., Cavion, F., Lucafò, M., Pelin, M., Lanzi, G., Masneri, S., Ferraro, R.M., Fazzi, E.M., Orcesi, S., Decorti, G., Tommasini, A., Giliani, S., Stocco, G. (2020) Biomarkers and Precision Therapy for Primary Immunodeficiencies: An In Vitro Study Based on Induced Pluripotent Stem Cells From Patients. Clin Pharmacol Ther. Aug;108(2):358-367.
Piovani, G., Lanzi, G., Ferraro, R.M., Masneri, S., Barisani, C., Savio, G., Giliani. S.C. (2019) Generation of induced pluripotent stem cells (iPSCs) from patient with Cri du Chat Syndrome. Stem Cell Res. Jan 26;35:101393
Ali, E., Ferraro, R.M., Lanzi, G., Masneri, S., Piovani, G., Mazzoldi, E., Serpieri, V., Valente, E.M., Giordano, L., Giliani, S.C. (2020) Generation of induced pluripotent stem cell (iPSC) lines from a Joubert syndrome patient with compound heterozygous mutations in C5orf42 gene. Stem Cell Res. Dec; 49:102007
R.M., Lanzi, G., Masneri, S., Barisani, C., Piovani, G., Savio, G., Marco Cattalini, M., Galli, J., Cereda, C., Muzi-Falconi, M., Orcesi, S., Fazzi, E., Giliani, S. (2019) Generation of three iPSC lines from fibroblasts of a patient with Aicardi Goutières Syndrome mutated in TREX1.Stem Cell Research; Dec:41:101580
Yan, Y., Shin, S., Jha, B.S., Liu, Q., Sheng, J., Li, F., Zhan, M., Davis, J., Bharti, K., Zeng, X., Rao, M., Malik, N., Vemuri, M.C. (2013) Efficient and Rapid Derivation of Primitive Neural Stem Cells and Generation of Brain Subtype Neurons From Human Pluripotent Stem Cells. Stemcells Translational Medicine; 2: 862–870
Conti, L. and Cattaneo, E. (2010) Neural stem cell systems: physiological players or in vitro entities? Nature Reviews Neuroscience; 11: 176–187
Yang, K., Jung, H., Lee, H.R., Lee, J.S., Kim, S.R., Song, K.Y., Cheong, E., Bang, J., Im, S.G., Cho, S.W. (2014) Hierarchically Patterned Topography for Directing Human Neural Stem Cells into Functional Neurons. American Chemical Society 8: 7809–7822.
Ferraro, R.M. et al. 2020 Carbonization of polymer precursors substrates to direct human iPSC-derived neurons differentiation and maturation. Procedia CIRP; 89: 39 – 44 Personal comunication
Reynolds, B.A., Tetzlaff, W., Weiss, S. (1992) Multipotent EGF-Responsive Striatal Embryonic Progenitor Cell Produces Neurons and Astrocytes. The Journal of Neuroscience 12: 4565-4574
Piovani, G., Savio, G., Traversa, M., Pilotta, A., De Petro, G., Barlati, S., Magri, C. (2014) De novo 1Mb interstitial deletion of 8p22 in a patient with slight mental retardation and speech delay. Mol Cytogenet. Apr 15; 7:25
Choi, S.H., Kim, Y.H., Hebisch, M., Sliwinski, C., Lee, S., D'Avanzo, C., Chen, H., Hooli, B., Asselin, C., Muffat, J., Klee, J.B., Zhang, C., Wainger, B.J., Peitz, M., Kovacs, D.M., Woolf. C.J., Wagner, S.L., Tanzi, R.E., Kim. DY. A three-dimensional human neural cell culture model of Alzheimer’s disease. Nature 515, 274–278 (2014).
Mesulam, M. M. (2013). Cholinergic circuitry of the human nucleus basalis and its fate in Alzheimer's disease. Journal of Comparative Neurology, 521(18), 4124-4144.
Domingues, H.S., Portugal, C.C., Socodato, R., Relvas, J.B. (2016) Oligodendrocyte, Astrocyte, and Microglia Crosstalk in Myelin Development, Damage, and Repair. Frontiers in Cell and Developmental Biology. vol. 4. Article 71: 1-16
Grabel, L. (2012) Developmental Origin of Neural Stem Cells: The Glial Cell That Could. Stem Cell Rev and Rep 8: 577–585
Nash, B., Ioannidou, K., Barnett, S.C. (2011) Astrocyte phenotypes and their relationship to myelination. J. Anatomy; 219: 44–52
Hol, E.M., Pekny, M. (2015) Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system. Curr. Opin. Cell Biol., 32, 121–130
Messing A, Brenner M. GFAP at 50. ASN Neuro. 2020 Jan-Dec; 12:175909142094968
Vincze, O., Tökési, N., Oláh, J., Hlavanda, E,, Zotter, A., Horváth, I., Lehotzky, A., Tirián, L., Medzihradszky, K.F., Kovács, J., Orosz, F., Ovádi. J. (2006) Tubulin polymerization promoting proteins (TPPPs): members of a new family with distinct structures and functions. Biochemistry. Nov 21;45(46):13818-26.
Tirián, L., Hlavanda, E., Oláh, J., Horváth, I., Orosz, F., Szabó, B., Kovács, J., Szabad, J., Ovádi, J. (2003) TPPP/p25 promotes tubulin assemblies and blocks mitotic spindle formation. Proc Natl Acad Sci U S A. Nov 25;100(24):13976-81
Lehotzky, A., Lau, P., Tokési, N., Muja, N., Hudson, L.D., Ovádi, J. (2010) Tubulin polymerization-promoting protein (TPPP/p25) is critical for oligodendrocyte differentiation. Glia. Jan 15;58(2):157-68
Saretzki, G., Wan, T. (2021) Telomerase in Brain: The New Kid on the Block and Its Role in Neurodegenerative Diseases. Biomedicines. Apr 29;9(5):490.
Sharma, N.K., Reyes, A., Green, P., Caron, M.J., Bonini, M.G., Gordon, D.M., Holt, I.J., Santos, J.H. (2012) Human telomerase acts as a hTR-independent reverse transcriptase in mitochondria. Nucleic Acids Res.40, 712–725.
Fu, W., Killen, M., Culmsee, C., Dhar, S., Pandita, T.K., Mattson, M.P. (2000) The catalytic subunit of telomerase is expressed in developing brain neurons and serves a cell survival-promoting function. J. Mol. Neurosci., 14, 3–15.
Lu, C., Fu, W., Mattson, M.P. (2001) Telomerase protects developing neurons against DNA damage-induced cell death. Brain Res. Dev. Brain Res. 131, 167–171.
De Jesus, B.B., Schneeberger, K., Vera, E., Tejera, A., Harley, C.B., Blasco, M.A. (2011) The telomerase activator TA-65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence. Aging Cell, 10, 604–621.
Zhou, Q.G., Liu, M.Y., Lee, H.W., Ishikawa, F., Devkota, S., Shen, X.R., Jin, X., Wu, H.Y., Liu,Z., Liu, X., Jin, X., Zhou, H.H., Ro, E.J., Zhang, J., Zhang, Y., Lin, Y.H., Suh.H., Zhu, D.Y. (2017) Hippocampal TERT Regulates Spatial Memory Formation through Modulation of Neural Development. Stem Cell Reports. Aug 8;9(2):543-556.
Yuan, L., Seong, E., Beuscher, J.L., Arikkath, J. (2015) δ-Catenin Regulates Spine Architecture via Cadherin and PDZ-dependent Interactions. J Biol Chem. Apr 24;290(17):10947-57.

Download PDF

Reviewers invited by journal
05 Jul, 2024
Editor assigned by journal
03 Jul, 2024
First submitted to journal
01 Jul, 2024

You are reading this latest preprint version

Establishment and Characterization of Cri Du Chat Neuronal Stem Cells: A Novel Promising Resource to Study the Syndrome

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIAL AND METHODS

hiPSC Lines

Differentiation of CdC-iPSCs into CdC-neural stem cells (CdC-NSCs)

NSCs Karyotype

Neuronal differentiation of NSCs

Quantitative Real Time PCR (qPCR)

Immunofluorescence assay

RESULTS

Derivation of Expandable Population of Neural Stem Cells

CdC-NSCs Can Be Differentiated to Neuronal Lineages

Quantitative Real Time (qRT)-PCR deleted genes

DISCUSSION

Declarations

References

Status:

Version 1