Exploring the Toxicity and Antiresorptive Activity of a Diterpene from Egletes viscosa (L.) less. in Mice: in silico and in vivo Studies

doi:10.21203/rs.3.rs-4668834/v1

Download PDF

Research Article

Exploring the Toxicity and Antiresorptive Activity of a Diterpene from Egletes viscosa (L.) less. in Mice: in silico and in vivo Studies

https://doi.org/10.21203/rs.3.rs-4668834/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Egletes viscosa (macela) is known for its gastroprotective properties in traditional medicine in Brazil. Herein, we evaluated the toxicity and antiresorptive activity of 12-acetoxyhawtriwaic acid lactone (12-AHAL), a diterpene obtained from E. viscosa. 12-AHAL has been demonstrated to have biological effects which might be important during periodontitis, a bone disorder. Molecular docking studies analyzed ADMT-Tox properties of 12-AHAL and evaluated its binding performance against targets associated with bone loss. Periodontitis was induced by a ligature around the mandibular first molars. The mice received (gavage) 12-AHAL (12.5; 25; 50 mg/kg) for 14d. Bone loss was assessed through morphometric and histometric analysis. Picrosirius Red staining was performed in mandible sections. We investigated in gingival tissues by RT-qPCR RANK-L/OPG and catalase mRNA expression levels, and by colorimetric assay catalase and superoxide dismutase-SOD activities. The in vivo toxicity of 12-AHAL was evaluated. In silico assays suggested good oral bioavailability and hepatotoxicity, and the interactions of 12-AHAL with RANKL/OPG and catalase showed firm bonds. In in vivo experiments, 12-AHAL reduced bone loss. Although 12-AHAL (25 or 50 mg/kg) produced liver and renal toxicity, 12-AHAL (12.5 mg/kg) showed no signs of toxicity, increased collagen type I, reduced RANK-L mRNA levels and increased OPG and catalase mRNA levels, and enhanced catalase and SOD activities. 12-AHAL (12.5 mg/kg) was safe and had anti-resorptive effects during periodontitis in mice, showing antioxidant activity with the involvement of the RANK-L/OPG pathway. These findings point to a novel application for E. viscosa and highlights the need for cautious utilization of medicinal plants.

Periodontitis

Bone resorption

RANK-L

OPG

antioxidant

molecular docking

Egletes viscosa (L.) less., popularly known as “macela”, is one of the most widespread species in northeastern Brazilian medicine, commonly used by the community in the form of teas or infusions for its gastroprotective properties (Santos et al. 2023). As a result, it is readily available in supermarkets and herbal stores across the northeast of Brazil. Populations' empirical use of therapeutic plants has been a scientific foundation for studying and rationalizing medications based on molecules isolated from natural products.

Studies with extracts and compounds isolated from various parts of E. viscosa have confirmed its gastroprotective effects and revealed a variety of other pharmacological actions, including antinociceptive, anti-edematogenic, and anti-inflammatory activities (Carvalho et al. 2020). Phytochemical studies on E. viscosa (Rodrigues et al. 2019) have reported the isolation of biologically active diterpenes, such as the diterpene 12-acetoxy-hawtriwaic acid lactone (12-AHAL), which are pointed out as the active principles of this species (Guedes et al. 2002; Carvalho, 2020). Furthermore, it has been shown that diterpenes have anti-inflammatory and immunomodulatory effects on bone metabolism (Xie et al. 2018; Islam et al. 2022).

Periodontitis, a condition affecting 5–15% of the global population in its severe manifestation and ranked as the sixth most prevalent disease (Dye 2012), is characterized by alveolar bone loss, which often culminates in tooth loss and significantly impacts oral function, aesthetics, and quality of life (Könönen et al. 2019). Periodontitis has a complex etiopathogenesis characterized by intricate interactions between infectious agents (dental biofilm) and immune-inflammatory responses within a susceptible host. These interactions stimulate the production of inflammatory mediators, ultimately contributing to alveolar bone loss (Kwon et al. 2021). Notably, the RANK/RANKL/OPG pathway and oxidative stress are significant contributors, as highlighted in the current literature (Ateeq et al. 2022).

Considering the high prevalence of periodontitis and the widespread use of E. viscosa in the community, alongside documented biological effects in the literature, and the potential of diterpenes in promoting bone health, this study aims to predict the ADME-Tox and pharmacodynamic properties of 12-AHAL in silico. Furthermore, it seeks to evaluate the toxicological and antiresorptive properties of 12-AHAL in ligature-induced periodontitis in mice.

Botanical material

E. viscosa flower buds were obtained in Canindé County (Ceará State, Brazil). Dr. Edson Paula Nunes identified voucher specimens (36694) and deposited at Prisco Bezerra Herbarium of the Biology Department at the Federal University of Ceará. Additionally, commercial samples of E. viscosa dried flower buds were obtained from an herbal store in Fortaleza City (Ceará state). Polar and nonpolar extracts from these samples were compared using thin layer chromatography (TLC) to previously collected plant extracts as well as pure samples of E. viscosa's principal components, ternatin, centipedic acid, and 12-acetoxy-hawtriwaic acid lactone. The compared extracts showed the same chromatographic profile.

Obtaining the 12-AHAL

The flower buds of E. viscosa (277.73 g) were crushed and exhaustively extracted with hexane at room temperature in a maceration process to yield 15.10 g of a light brown viscous extract, after solvent evaporation under reduced pressure.

A white amorphous precipitate (ppt) started forming during the solvent evaporation. This ppt. (905.30 mg) was separated from the extract by filtration and purified by column chromatography as follows: it was adsorbed on silica gel (1.20 g); the resulting mixture was deposited over a column of the same adsorbent (25.0 g; 3cm diameter) and eluted with a hexane-ethyl acetate (8:2) mobile phase (200 mL) in an isocratic manner. Twenty fractions (10 mL each) were collected. Fraction F8-11 showed a uniform spot in TLC and after evaporation of the solvent, yielded 671.50 mg of orthorhombic crystals identical (TLC, mp, IR, NMR ¹H and ¹³C) to the hawtriwaic acid diterpene clerodane lactone.

In silico evaluation of the pharmacokinetic and toxicological profile of the 12-AHAL

In silico studies are commonly used in the early stages of the research process to develop new drugs, allowing the selection of molecules with the greatest potential for development. In this study, the SwissADME® server was used to design and evaluate the physicochemical and pharmacokinetic properties criteria of 12-AHAL.

The prediction of the pharmacokinetic profiles of 12-AHAL was evaluated according to Lipinski's “rule of five” and ADME parameters. According to this rule, to be orally active, a drug must meet at least four principles: molecular weight ≤ 500, partition coefficient ≤ 5, number of hydrogen bond acceptors ≤ 10, hydrogen bond donors ≤ 5, and rotatable bonds ≤ 10. Quantitative and qualitative values were obtained from the SwissADME online server (http://www.swissadme.ch/).

The evaluation of in silico toxicity of 12-AHAL was performed with the ProTox-II software server (Banerjee et al. 2018a).

In silico evaluation of the pharmacodynamic profile of the 12-AHAL for targets that modulate bone metabolism - molecular docking studies

In the preparations of the structure, 12-AHAL was three-dimensionally modeled in Avogadro 1.1.2 software (Hanwell et al. 2012) and geometrically optimized using the Density Functional Theory (DFT) method with B3LYP correlation functional and base 6-31G(d) present in the GAMESS software (Barca et al. 2020). The protein structures (targets in this docking), namely: RANKL/OPG and catalase from homo sapiens organism were obtained from the Protein Data Bank (https://www.rcsb.org/). The docking position of the protein coupling was based on the macromolecule's native ligand and/or with Web Server Computed Atlas of Surface Topography of proteins - CASTp (http://sts.bioe.uic.edu/castp/calculation.html) for structures without native ligands. For molecular docking simulation, AutoDock tools (ADT) v4.2 were used to prepare the ligand and target (Morris et al. 2009) and AutoDock Vina 1.1.2 to perform the calculations (Trott and Olson 2010). Binding affinity and interactions between residues were used to determine better molecular interactions. The result was visualized using ADT, Discovery Studio v4.5 (BIOVIA, San Diego, CA, USA), and PLIP (Salentin et al. 2015).

Study design and ethical aspects

The Local Ethical Committee for Animal Experiments approved the experimental protocol of this study under the protocol nº 04/20. Experimental procedures were conducted according to the ARRIVE guidelines (Research Animal: Report of In Vivo Experiments) and the Brazilian Society of Animal Science (SBCAL) guidelines.

Sixty-six male Swiss mice weighing between 20 and 30 g were obtained from the Central Animal Facility of the Federal University of Ceará (UFC-Fortaleza, Brazil). The mice were randomly housed in appropriate plastic cages at the Experimental Animal Facility of the School of Medicine of the Federal University of Ceará (Sobral, Ceará, Brazil). The animals were housed in plastic cages in a controlled temperature (23ºC ± 2) room, observing the light and dark cycles of 12/12 hours, with access to water and food ad libitum. The sample size of 6 animals per group was determined assuming α = 0.05 and power of 0.8.

Model of periodontitis in mice

After seven days of the adaptation period, mice were anesthetized by intraperitoneal (i.p.) injections of xylazine (10 mg/kg) and ketamine (90 mg/kg). Periodontitis was induced by placing a cotton suture ligature (4.0) around the necks of the right and left mandibular first molars, maintaining the surgical knot facing towards the vestibular face (Abe and Hajishengallis 2013).

The animals were randomly allocated to the following groups:

Naive group: mice that did not undergo any surgical intervention or treatment;
Non-treated group (NT group): mice subjected to periodontitis but not administered any treatment;
12-AHAL groups (12.5, 25, or 50 mg/kg): Mice that received oral administration of 12-AHAL at doses of 12.5, 25, or 50 mg/kg, one hour before periodontitis induction and once daily for 14 days, respectively. These groups are 12-AHAL 12.5, 12-AHAL 25, and 12-AHAL 50.

In the initial set of experiments involving 30 animals, alveolar bone loss in the mandibles was assessed, along with the analysis of collagen content and type, superoxide dismutase and catalase activities, histopathological examination (H&E staining) of organs (liver, kidney, stomach), and serum biochemical measurements. Two additional trials were conducted to obtain sufficient gingival tissue for RT-qPCR analysis, bringing the total number of animals to 66.

Euthanasia

After 14 days of treatment, mice were euthanized under anesthesia (i.p.) with xylazine (30 mg/kg) and ketamine (270 mg/kg). Gingival tissue and mandibles were collected and processed for subsequent analyses. Gingival tissue samples were used for RT-qPCR analysis and colorimetric assays, while the mandibles were divided into left and right portions. The left mandibles underwent morphometric analysis, while the right mandibles underwent histopathological processing. Histologic sections of mandibles were stained with picrosirius red or hematoxylin and eosin (H&E).

Morphometric analysis of alveolar bone loss

The left mandibles were dissected, fixed (10% formalin for 24 hours), stained with 1% methylene blue to differentiate bone from teeth, mounted on wax blocks, and photographed in high resolution. The digital images were subjected to alveolar bone loss analysis using the Image J software (ImageJ 1.44p, National Institute of Health; USA), as described previously (Kuhr et al. 2004). The region of interest for analysis was defined as the area between the cement-enamel junction and the alveolar bone crest of the three molars (Kuhr et al. 2004).

Histometric analysis of alveolar bone loss

For the histopathological analysis, the right mandibles were excised, fixed in 10% neutral-buffered formalin, and demineralized in EDTA. The specimens were then dehydrated, embedded in paraffin, and sectioned along the molars in a mesiodistal plane for H&E staining. Images were captured under a light microscope at 40x magnification and analyzed by a blinded observer using ImageJ software, as described by Guimarães et al. (2016). This involved calculating the area between the highest point of the remaining bone crest and the roof of the furcation of the second molar, as described by Guimarães et al. (2016), and measuring the distance from the bone crest to the cementoenamel junction of the first and second molars (Sima et al. 2016) (Fig. 1).

Analysis of the content and type of collagen in mandible sections

Images from Picrosirius-Red stained mandible sections were captured under 200x magnification using a higher-resolution digital camera connected to a polarized light microscope. Bone collagen was evaluated based on the birefringence of polarization colors, ranging from yellow-red (collagen type I) to green-yellow (collagen type III), as described in previous literature (Rittié 2017).

Investigation of RANK-L, OPG, and catalase gene expression in gingival tissue

Gingival tissue samples around the lower first molars were collected immediately after euthanasia using RNase-free surgical material (heated for 200°C/4h). The samples were cleaned with sterile PBS treated with diethylpyrocarbonate (DEPC) and stored in sterile 1.5 mL microtubes in liquid nitrogen. Real-time PCR (qRT-PCR) performed quantitative analysis of gene expression. In addition to the nucleic acids, the reaction was composed of specific initiators (300nm each) and 10µl of 2X Power SYBR Green MasterMix (AppliedBiosystems), with a final volume of 20µl. The amplification reaction was performed by initial denaturation of 95°C/10min followed by 40 thermal cycles of 95°C for 15s, 55°C for 15s and 60°C for 20s. For the analysis of gene expression, the levels of gene expression not affected by the analyzed condition (endogenous control) were monitored to normalize the samples regarding possible differences in the amount of cDNA added in each reaction, and as a negative control, the mix without the cDNA. Real-time PCR monitoring was performed in a Real Plex 4S thermocycler (Eppendorf®) by detecting the fluorescence levels of SYBR Green. The Cycletreshold – Ct used for the analysis was the arithmetic mean between the triplicates of the target genes and endogenous controls. Results were normalized using Cycletreshold–Ct. Primers used in this study are shown in Table 1. GAPDH was used as an endogenous control for normalizing messenger RNA expression.

Table 1

Description of biomarkers, gene, primers sequences, and NCBI accession numbers.
Biomarkers	Gene	Primer sequence (5′-3′)	NCBI
Bone markers	RANK-L	TGAGCTATGGAAGGGGGTCA	AF019048.1
	RANK-L	GTCCCAGCGCAATGTAACAA	AF019048.1
	OPG	GAGACGCACCTAGCACTGAC	U94331.1
	OPG	AAGGGTTTCCTGGGTTGTCC	U94331.1
	Catalase	GTGCCCCCAACTATTACCCC	NM_009804.2
	Catalase	AGAATGTCCGCACCTGAGTG	NM_009804.2
Reference gene	GAPDH	GAGGCCCTATCCCAACTCGG	GU214026.1
Reference gene	GAPDH	CCTGTTATTATGGGGGTCTGGG	GU214026.1

Investigation superoxide dismutase (SOD) and catalase (CAT) activities in gingival tissue

Gingival tissue samples around the lower first molars were collected immediately after euthanasia. The samples were cleaned with sterile PBS treated with diethylpyrocarbonate (DEPC) and stored in sterile 1.5 mL microtubes in liquid nitrogen. These samples were used for colorimetric assays to assess oxidative stress through superoxide dismutase (SOD) and catalase (CAT) activities.

The SOD enzyme catalyzes the dismutation of the superoxide anion into oxygen and hydrogen peroxide. When CAT comes into contact with hydrogen peroxide, it transforms this hydrogen peroxide (H₂O₂) into water (H₂O) and oxygen gas (O₂).

SOD was evaluated based on the reduction of nitro-blue-Tetrazolium (NBT) and expressed in grams of SOD/ml. CAT activity was measured through the production rate of H₂O and O₂ in proportion to H₂O₂ (Safieh-Garabedian et al. 1995). The CAT activity was measured in response to the amount of H₂O₂ through a spectrophotometer reading.

Toxicity of the 12-AHAL: histopathological analysis (H&E) of organs (liver, kidney, stomach)

After euthanasia, organs were collected and fixed in 10% liquid formaldehyde and processed for H&E staining. Sections were evaluated semiquantitatively for epithelial cell loss, vascular congestion, hemorrhagic damage, edema, inflammatory cells, and necrosis, giving a score (0–3) for each of these parameters. The analysis was made by an experienced pathologist who was blind to the treatment protocol (KMP).

Toxicity of the 12-AHAL: Serum biochemical measurement

To assess preclinical safety, blood samples were collected from the abdominal aorta of the mice and centrifuged for biochemical measurements of the levels of total alkaline phosphatase (TALP) creatinine, and transaminases (ALT, AST) by using commercial kits (Labtest® MG, Brazil), according to the manufacturer's instructions in a semi-automatic biochemical analyzer (Bioplus BIO-200F).

Statistical analysis

The Shapiro-Wilk normality test normalized all data. Data were expressed as mean ± standard error (S.E.M.) or as median, when appropriate. ANOVA followed by Tukey test was used to compare means and Kruskal–Wallis and Dunn tests were used to compare the medians. Statistical analyzes were performed using the GraphPad Prism 5 software (GraphPad Prism software, La Jolla, CA, USA) and SPSS 20.0 (SPSS Inc., Chicago, IL, USA). Probability Level (P-value) < 0.05 was assumed.

In silico evaluation of the pharmacokinetic and toxicological profile (ADME-T) of the 12-AHAL

Table 2 shows the physicochemical properties of 12-AHAL. By comparison with the reference values assigned by Lipinski's rule of 5, it was demonstrated that 12-AHAL met all the five parameters, predicting its good oral bioavailability.

Table 2

Physical-chemical properties according to Lipinski's Rule of 5, pharmacokinetic parameters of permeability to biological barriers (GIT, BBB), enzymatic inhibition (pGP), metabolism, and toxicity prediction results of the of 12-acetoxy-hawtriwaic acid lactone (12-AHAL) isolated from the flower buds of *E. viscosa*.
Physical-chemical properties of 12-AHAL	Result
Molecular weight ≤ 500 (g/mol)	376.49
Partition coefficient ≥ 5 (Log Po/w)	3.10
N^o of hydrogen bond acceptors ≤ 10	5
N^o of hydrogen bond donors ≤ 5	0
Nº of rotatable connections ≤ 10	5
Pharmacokinetic parameters of 12-AHAL	Result
Permeability to GIT	High
Permeability to BBB	Yes
Enzymatic inhibition (pGP)	Yes
CYP2D6	Yes
CYP3A4	Yes
CYP1A2	No
Toxicity prediction of 12-AHAL	Result
LD50	555mg/kg
Toxicity class	4
Hepatotoxicity	+ (0.87%) *
Prediction accuracy	70.9%
Abbreviations: GIT: absorption through the Gastro Intestinal Tract; BBB: permeability through the blood-brain barrier; pGP: substrate for P-Glycoprotein; CYP: cytochrome P450. *Probability percentage

Table 2 depicts the theoretical pharmacokinetic parameters of 12-AHAL. Among the evaluation models were considered permeability to the human intestine (GIT), blood-brain barrier (BBB), and inhibition of P-glycoprotein (pGP). Regarding the distribution, the SwissADME® server revealed the possible subcellular location. As for metabolism, substrate and inhibitor models were performed for three (CYP2D6, CYP3A4, CYP1A2) of the five main isoforms of the cytochrome (CYP) P450 family involved in 75–90% of CYP-related metabolism. 12-AHAL showed high permeability to the human intestine, predicting good oral absorption. Regarding permeability to the blood-brain barrier, 12-AHAL showed permeability, predicting possible central action. Furthermore, 12-AHAL inhibited pGP, a surface glycoprotein on the cytoplasmic membrane, and acts as an efflux pump. As for the inhibition of CYP enzymes, 12-AHAL inhibited CYP2D6 and CYP3A4 isoforms, while the CYP1A2 isoform was not inhibited by 12-AHAL (Table 2).

In the toxicity tests (Table 2), the predicted LD50 of 12-AHAL was 555 mg/kg. The toxicity class indicated by the PROTOX-2 software (on a scale of 1 to 6) was category 4 (low toxicity) for 12-AHAL (Banerjee et al. 2018b). From the biological toxicity evaluations, it was possible to observe in the hepatotoxicity parameter, there was a positive relationship with a probability of success of the software of 0.87% for the 12-AHAL.

In silico evaluation of the pharmacodynamic profile of the 12-AHAL: molecular docking studies

All interactions of 12-AHAL with the target structures (RANKL/OPG and catalase) showed acceptable bonds (below − 6.0 kcal/mol) (Table 3). Figure 2 illustrates the interactions of 12-AHAL with the target structures.

Table 3

Affinity of the 12-acetoxy-hawtriwaic acid lactone (12-AHAL) isolated from the flower buds of *E. viscosa* with targets that interfere with bone metabolism (RANK-L/OPG and catalase).
Targets	12-AHAL
RANK-L/OPG	− 7.5
Catalase	− 7.0

Considering the theoretical potential of 12-AHAL interaction with the targets that modulate bone metabolism, the possible antiresorptive effect of 12-AHAL in the mouse model of periodontitis was evaluated.

Antiresorptive effect of the 12-AHAL

Periodontitis challenge was associated with alveolar bone resorption, which was reduced (P < 0.01) by 12-AHAL (12.5; 25 or 50 mg/kg) (Fig. 3A). Figure 3B, C, and D illustrate the morphometric aspect of the mandible of mice from naive, NT, and 12-AHAL (12.5 mg/kg) groups, showing the alveolar bone protective effects of the 12-AHAL.

In vivo toxicity assessment of the 12-AHAL

After 14 days of gavage with 12-AHAL (12.5, 25, or 50 mg/kg), mice were anesthetized and euthanized for collecting of organs and peripheral blood to evaluate the putative toxicity of 12-AHAL. The wet weights of the stomach, liver, and kidneys were normal. There was no toxicity in the kidney, stomach, and liver from mice treated with 12-AHAL (12.5 mg/kg) (Table 4). However, mice gavaged with 12-AHAL (25 mg/kg) showed reversible histological changes (edema) in the kidney (Table 4 and Fig. 4). Furthermore, in mice gavaged with 12-AHAL (25 or 50 mg/kg) it was observed in the liver both reversible (edema – 25 mg/kg) and irreversible histological changes (focal necrosis - few cells – 25 or 50 mg/kg) (Table 4 and Fig. 4). Although it was shown previously (Guedes et al. 2002) that 12-AHAL at doses of 25 or 50 mg/kg had antinociceptive and gastroprotective effects, and no toxicity was described, in the present study using these doses for 14 days, we identified renal and liver toxicity. Thus, we only used 12-AHAL at 12.5 mg /kg for the following experiments.

Table 4

Effect of 12-acetoxy-hawtriwaic acid lactone (12-AHAL) treatment isolated from the flower buds of *E. viscosa* on histopathological (H&E) analysis of the stomach, liver, and kidney.
Organs / Histopathological Parameters	Groups
	Naive	NT	12-AHAL (mg/kg)
	Naive	NT	12.5	25	50
Stomach
Hemorrhagic damage	0 (0–0)	1 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)
Edema	0.5 (0–1)	1 (0–1)	0.5 (0–1)	1 (0–1)	0 (0–1)
Inflammatory cells	0 (0–0)	0 (0–1)	0 (0–0)	0.5 (0–1)	0 (0–1)
Liver
Necrosis	0 (0–0)	0 (0–0)	0 (0–0)	1 (1–1) **	1 (1–1) **
Vascular congestion	0 (0–1)	0 (0–1)	1 (0–1)	1 (1–1)	0.5 (0–2)
Hemorrhagic damage	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)
Edema	0 (0–0)	1 (0–1)	1 (0–1)	2 (2–2) *	2 (1–2)
Inflammatory cells	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)
Kidney
Necrosis	0 (0–0)	0 (0–0)	0 (0–1)	0 (0–1)	0 (0–1)
Hemorrhagic damage	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)
Edema	0 (0–0)	1 (1–1)	1 (0–1)	2 (1–2) *	1 (0–2)
Inflammatory cells	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)	0 (0–0)
Data represents mean ± S.E.M. (n = 6 for each treatment). * P < 0.006 versus naïve; ** P < 0.0003 versus naive. ANOVA, Tukey

Table 5

Evaluation of 12-acetoxy-hawtriwaic acid lactone (12-AHAL) treatment isolated from the flower buds of *E. viscosa* on biochemical parameters during periodontitis challenge.
Biochemical parameters	Naive	NT	12-AHAL (12.5 mg/kg)
Total Alkaline Phosphatase	116.1 ± 11.16	113.0 ± 4.45	101.2 ± 7.29
Creatinine	0.30 ± 0.02	0.22 ± 0.01	0.25 ± 0.03
AST (U/I)	49.73 ± 8.83	58.24 ± 6.73	83.01 ± 12.05
ALT (U/I)	58.59 ± 6.33	54.10 ± 12.58	38.80 ± 8.67
Data represent the mean ± S.E.M. (ANOVA; Tukey's)

Effect of the 12-AHAL on Histometric Analysis

The histometric analysis showed that ligature-induced periodontitis increased (P < 0.0008) the area between the furcation roof and the remaining bone crest in the untreated animals (138.2 ± 30.29) when compared to the naive group (17.84 ± 3.23) (Fig. 5G). 12-AHAL (12.5 mg/kg) reduced (P < 0.0001) bone resorption from the furcation area (55.02 ± 13.28) when compared to the not-treated group (138.2 ± 30.29) (Fig. 5G). Figure 5A, 5B, and 5C illustrate H&E staining sections of mandibles showing where was performed the histometric study in the second molar furcation of mice from naive, NT, and 12-AHAL groups, respectively.

Furthermore, 12-AHAL (12.5 mg/kg) reduced (P < 0.0001 and P < 0.0002) the distance from the cemento-enamel junction to the bone crest of the first (0.24 ± 0.036) (Fig. 5H) and second molar (0.079 ± 0.009) (Fig. 5I), respectively, when compared to the not-treated group (0.47 ± 0.057 and 0.24 ± 0.58, respectively) (Fig. 5H and 5I). Figure 5D, 5E, and 5F illustrate HE staining sections of mandibles of mice showing where was performed the histometric study evaluating the distance from bone crest to cementoenamel junction of the second molar from naïve, NT, and 12-AHAL group, respectively.

Effect of the 12-AHAL on the amount and type of collagen

The picrosirius red staining increases the collagen birefringence when exposed to polarized light. Thus, collagen type I is yellow-red (reddish-yellow birefringence), while type III shows green (whitish-green birefringence).

In the present study, there was no difference among the groups considering the percentage of total collagen (Fig. 6D). Under polarized light, the collagen fibers in the NT group (25.11%±11.46) showed a reduction in the reddish-yellow birefringence (Fig. 6E), characteristic of type I collagen, when compared to the naive group (41.45%±17.82) (Fig. 6E). 12-AHAL 12.5 mg/kg (46.32%±4.79) (Fig. 6E) caused an increase in reddish-yellow birefringence when compared to the NT group (25.11%±11.46) (P < 0.05). Considering the whitish-green birefringence, characteristic of type III collagen, in the group treated with 12-AHAL 12.5 mg/kg (53.68%±4.79) it was observed a significant reduction of this birefringence, when compared to the NT group (76.96 ± 11.8) (P < 0.05) (Fig. 6F).

Effect of the 12-AHAL on mRNA expression level of RANKL, OPG, and CAT

The NT group expressed a significant increase (P < 0.008) in RANKL mRNA levels when compared to the naive group (Fig. 7A). 12-AHAL treatment (12.5 mg/kg) significantly reduced (P < 0.008) RANKL mRNA expression level and significantly increased (P < 0.0002; P < 0.013) OPG (Fig. 7B) and CAT (Fig. 7C) mRNA expression level, respectively, when compared to the NT group.

Effect of the 12-AHAL on superoxide dismutase (SOD) and catalase (CAT) activities

The NT group showed a significant reduction (P < 0.000008 and P < 0.002, respectively) in SOD and CAT activities, when compared to the naive group (Fig. 8A and 8B). 12-AHAL (12.5 mg/kg) significantly increased (P < 0.04 and P < 0.03, respectively) SOD and CAT activities (Fig. 8A and 8B), when compared to the NT group.

Herein, we examined the toxicity and antiresorptive action of 12-acetoxyhawtriwaic acid lactone (12-AHAL), a diterpene from Egletes viscosa (L.) less. (macela), using both in silico and in vivo assays. In silico assays suggested good oral bioavailability and hepatotoxicity, and the interactions of 12-AHAL with target structures related to bone metabolism (RANKL/OPG and catalase) showed strong bindings. In vivo assays revealed that 12-AHAL (12.5, 25, or 50 mg/kg) reduced alveolar bone loss. There was no toxicity in the stomach, kidney, and liver from mice treated with 12-AHAL (12.5 mg/kg). Conversely, kidneys from mice gavaged with 25 mg/kg of 12-AHAL showed reversible histopathological change (edema). Moreover, edema and focal necrosis - few cells were seen in the livers of mice gavaged with 12-AHAL (25 or 50 mg/kg). In light of these findings, the dose of 12.5 mg/kg was employed in the subsequent studies designed to explore the mechanisms of action of 12-AHAL, which showed increased collagen type I and reduced RANK-L mRNA levels while increasing OPG and CAT ones. Furthermore, 12-AHAL (12.5 mg/kg) increased both superoxide dismutase (SOD) and catalase (CAT) activities. There were no statistically significant differences in the levels of total alkaline phosphatase (TALP), creatinine, and transaminases (ALT, AST) among the groups - naive, not-treated group (NT), and 12-AHAL (12.5 mg/kg), suggesting that 12-AHAL, administered at a dose of 12.5 mg/kg, is both safe and efficacious in in the ligature-induced periodontitis in mice.

In silico models were used to predict the physicochemical qualities (molecule weight, lipophilicity, hydrogen acceptors and donors) and pharmacokinetic features (Absorption, Distribution, Metabolism, Excretion, and Toxicity - ADME-Tox) of 12-AHAL. Furthermore, we examined the pharmacological profile of 12-AHAL for targets that affect bone metabolism (RANK-L, OPG, and catalase).

The physicochemical properties of 12-AHAL were comparable with the parameters of Lipinski's rule, indicating that it would be well absorbed orally. This criterion is one of the primary descriptors in evaluating new therapeutic candidate molecules (Lipinski et al. 2001). Lipinski's rule states that the following attributes are essential for a novel drug candidate: molecular weight 500; logP value 5; number of hydrogen bond acceptors 10; number of hydrogen bond donors 5; and number of rotatable bonds 10. The molecular weight of 12-AHAL was 500, and the logP value was 5. Regarding hydrogen bonding capability, 12-AHAL demonstrated acceptable values of 0 and 5 for hydrogen bond donors and acceptors. Another critical factor is the number of rotatable bonds: 12-AHAL has five rotatable bonds, which is a sufficient number. Thus, as established by other authors (Verma et al. 2020), the use of Lipinski's rule contributes to the search for new drug prototypes, and 12-AHAL, by not breaking any of the rule's criteria, can be considered a viable candidate for a new medicine.

In the present study, the following criteria were used to predict ADME for 12-AHAL: Human Intestinal Absorption (HIA), permeability through the blood-brain barrier (BBB), and inhibition of P-glycoprotein and cytochrome P450 (CYP2D6; CYP344, CYP1A2).

12-AHAL has been found to have a high intestinal absorption rate, cross the blood-brain barrier, and inhibit P-glycoprotein. One of the most crucial factors in ADME analysis is Human Intestinal Absorption (HIA) since it plays a significant role in the drug's delivery to its intended location and affects the prototype drug's bioavailability (Yan et al. 2008). 12-AHAL crosses the BBB, implying a potential central action. In this regard, Araújo et al (2008) found that an aqueous extract of E. viscosa has a central nervous system depressive effect in mice. Also, our findings revealed that 12-AHAL was a substrate for CYP2D6 and CYP344, implying that 12-AHAL is metabolized in the liver.

To evaluate 12-AHAL's safety for the following pre-clinical trials, we used in silico toxicology assays to anticipate its toxicity. Verma et al (2020) demonstrated that using in silico tests for toxicity prediction enhances preclinical research by assisting in assessing prototype medication safety. In this study, the predicted LD50 for 12-AHAL was 555 mg/Kg. Considering the predicted LD50 (300 < LD50 ≤ 2000), the toxicity class indicated by the PROTOX-2 software for 12-AHAL was class IV (low toxicity), and the model predicted the likelihood of hepatotoxicity.

Although no reports of antiresorptive activity of E. viscosa have been found in the literature, some authors (Xie et al. 2018; Islam et al. 2022) have shown that diterpenes have anti-inflammatory and immunomodulatory effects on bone metabolism. In this regard, a diterpene derived from Rabdosia rubescens has been demonstrated by other authors to both enhance osteoblastic bone formation and decrease osteoclastic bone resorption triggered by RANKL, both in vitro and in vivo (Xie et al. 2018). Furthermore, diterpenes have been demonstrated in pre-clinical and clinical trials to have anti-arthritic properties by modulating oxidative stress and cytokines (Islam et al. 2022). In the present study, molecular docking tests demonstrated that 12-AHAL exhibited strong bonding (above − 6.0 kcal/mol) in its interactions with targets related to bone metabolism (RANKL/OPG and catalase). Additionally, 12-AHAL decreased alveolar bone loss in the ligature-induced periodontitis model in mice at all three doses (12.5, 25, and 50 mg/kg). This is the first report of the antiresorptive action of a diterpene derived from E. viscosa Less (Macela).

Histopathological (H&E) analysis of the organs revealed that 12.5 mg/kg dose did not cause any toxicity after 14 days of treatment. However, 12-AHAL 25 mg/kg caused reversible toxicity (edema) in the kidney; in the liver, 12-AHAL 25 mg/kg promoted edema and focal necrosis - few cells, and groups gavaged with 12-AHAL 50 mg/kg showed signals of irreversible histological change (focal necrosis - few cells). In contrast to our present data, Souza et al (1997) showed that ternatin (25 and 50 mg/kg), a flavone from E. viscosa Less, reduced CCl₄-induced hepatoxicity and showed anti-inflammatory effects in mice. Our data can contribute to the rational handling of E. viscosa.

Given the efficacy and safety of 12-AHAL 12.5 mg/kg, we employed this dose in the following assays to investigate the putative mechanism of action of 12-AHAL in the ligature-induced periodontitis model in mice. Serum values of total alkaline phosphatase, creatinine, and ALT/AST showed no variation between the naive and NT groups, confirming the safety of this dose.

It was used histometric analysis to confirm the antiresorptive activity of 12-AHAL, which is a parameter already well utilized to evaluate bone loss in ligature-induced periodontitis in rodents (Conti et al. 2020). In the current study, histometric analysis of the second molar's furcation area and measurement of the cemento-enamel junction of the first and second molars revealed that 12-AHAL (12.5 mg/kg) reduced these measurements, compared to the NT group, demonstrating its antiresorptive activity.

Types I and III collagens play critical roles in periodontal tissue remodeling. Type III collagen is eventually replaced by type I collagen during periodontal ligament repair, increasing mature bone (Chen et al. 2014). In the current study, periodontitis challenge was linked to a decrease in type I collagen and an increase in type III collagen compared to the naive group. However, compared to the NT group, 12-AHAL 12.5 mg/kg considerably improved these parameters, indicating that 12-AHAL may have a role in collagen production during periodontitis, which may contribute to its antiresorptive action.

Since bone resorption is a prevalent hallmark of periodontitis, variables that affect osteoclast activity may be strategic targets in antiresorptive therapy. Three cytokines, the NF-kappaB receptor activator (RANK), its ligand RANKL, and the RANKL decoy receptor osteoprotegerin (OPG), are essential regulators of osteoclast function in this setting (Ateeq et al. 2022). In the present study, gingival mRNA levels of RANK-L decreased after 14 days of treatment with 12-AHAL (12.5 mg/kg), compared to the NT group, whereas those of OPG were increased. This suggests that the antiresorptive efficacy of 12-AHAL (12.5 mg/kg) can be partially attributed to the inhibition of RANK-L and the increase in OPG.

Given the increased interest in safe and effective natural antioxidants by the pharmaceutical sector, plants that exhibit antioxidant activity belong to one of the most investigated classes of natural goods (Devi et al. 2021). The primary enzymatic antioxidants found in periodontitis patients' gingival fluid, saliva, and blood serum are superoxide dismutase – SOD and catalase - CAT, both of which assist in cellular redox equilibrium. The polymorphism of these enzymes' genes determines their reactions to periodontal root planning and subsequent healing (Lee et al. 2019). The present study revealed that CAT mRNA levels were elevated following treatment with 12-AHAL (12.5 mg/kg), as evidenced by an increase in CAT activity. In addition, we observed higher SOD activity in the treated group, when compared to the NT group.

Despite the reproducibility of the periodontitis model in mice, some limitations should be considered: (1) conditions such as substantially small mouths require highly trained operators to ensure animal welfare; (2) the insertion of the ligature can already produce gingival tissue stress in mice; (3) there are differences in the anatomy of the teeth of mice and human species; (4) for all experiments in our investigation, we only used male animals; and (5) since most research has concentrated on the gastroprotective and inflammatory properties of E. viscosa, comparison with previous studies was not possible as our study is an innovative work evaluating the antiresorptive effects of a diterpene derived from E. viscosa.

12-AHAL (12.5 mg/kg) was safe and showed antiresorptive activity in the ligature-induced periodontitis in mice, which can be attributed, at least in part, to the modulation of the RANK-L/OPG pathway and its antioxidant effects. Accordingly, to our knowledge, this is the first report to describe the antiresorptive effect of a diterpene extracted from Egletes viscosa (L.) less. (macela). These findings point to a novel application for Egletes viscosa (L.) less. (macela), a plant widely used by the community for its gastroprotective activity. However, the use of 12-AHAL at higher doses (25 or 50 mg/kg) was associated with liver toxicity, which emphasizes, within the limits of a pre-clinical investigation, the significance of using medicinal plants cautiously, since natural origin does not necessarily translate into non-toxicity.

Author Contribution Iara Laís L. de Sousa: Methodology, Investigation. Iracema M. de Melo: Methodology, Investigation, Original Draft. Jordânia M. de O. Freire: Methodology, Investigation. Andreia S. Lima: Methodology, Investigation. Antônia T. A. Pimenta: Methodology, Formal Analysis, Resources, Validation. Mary Anne Sousa Lima: Methodology, Formal Analysis, Resources, Validation. River Jordan O. Mesquita: Methodology, Investigation. Joao Henrique S. Luciano: Methodology, Investigation. José Jackson do N. Costa: Methodology, Investigation, Formal Analysis. Paula Goes: Conceptualization, Methodology, Investigation, Writing – Review and Editing. Renata F. de C. Leitão: Resources, Supervision. Vanessa C. de S. Ferreira: Methodology, Investigation. Karuza Maria A. Pereira: Methodology, Investigation, Formal Analysis. Helyson Lucas B. Braz: Methodology, Investigation. Hellíada V. Chaves: Conceptualization, Methodology, Investigation. Mirna M. Bezerra: Conceptualization, Methodology, Investigation, Writing – Review and Editing.

Funding This research was partially supported by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) through a scholarship for a master's student.

Ethics Statement The Local Ethical Committee for Animal Experiments approved the experimental protocol of this study under the protocol nº 04/20.

Conflict of Interest: None of the authors have any conflicts of interest to declare.

Acknowledgments The authors thank Roberta Jeane B. Jorge for her assistance with in silico assays and Luana R. Portela and Bianca D. Aguiar for technical assistance. Mary Anne Sousa Lima, Paula Goes, Renata F. de C. Leitão, Karuza Maria A. Pereira, Hellíada V. Chaves, and Mirna M. Bezerra are investigators of the Brazilian National Council for Scientific and Technological Development (CNPq).

Abe T, Hajishengallis G (2013) Optimization of the ligature-induced periodontitis model in mice. J Immunol Methods 394:49–54. https://doi:10.1016/j.jim.2013.05.002
Araújo AAS, Bonjardim LR, Mota ÉM, Albuquerque-Júnior RLC, Estevam CDS, Cordeiro L, Quintans-Júnior LJ (2008) Antinociceptive activity and toxicological study of aqueous extract of Egletes viscosa Less (Asteraceae). Rev Bras Cienc Farm 44:707–715. https://doi.org/10.1590/S1516-93322008000400018
Ateeq H, Zia A, Husain Q, Khan MS, Ahmad M (2022) Effect of inflammation on bones in diabetic patients with periodontitis via RANKL/OPG system-A review. J Diabetes Metab Disord 21:1003–1009. https://doi:10.1007/s40200-021-00960-7
Banerjee P, Eckert AO, Schrey AK, Preissner R (2018a) ProTox-II: a webserver for the prediction of toxicity of chemicals. Nucleic Acids Res 46:W257–W263. https://doi.org/10.1093/nar/gky318
Banerjee S, Tian T, Wei Z, Shih N, Feldman MD, Peck KN, DeMichele AM, Alwine JC, Robertson ES (2018b) Distinct microbial signatures associated with different breast cancer types. Front Microbiol 9:951. https://doi:10.3389/fmicb.2018.00951
Barca GMJ, Bertoni C, Carrington L, Datta D, Silva N, Deustua JE, Fedorov DG, Gour JR, Gunina AO, Guidez E, Harville T, Irle S, Ivanic J, Kowalski K, Leang H, Li SS, Li W, Lutz JJ, Magoulas I, Mato J, Mironov V, Nakata H, Pham BQ, Piecuch P, Poole D, Pruitt SR, Rendell AP, Roskop LB, Ruedenberg K, Sattasathuchana T, Schmidt MW, Shen J, Slipchenko L, Sosonkina M, Sundriyal V, Tiwari A, Galvez Vallejo JL, Westheimer B, Włoch M, Xu P, Zahariev F, Gordon MS (2020) Recent developments in the general atomic and molecular electronic structure system. J Chem Phys 152:154102. https://doi.org/10.1063/5.0005188
Carvalho KR, Souza ASQ, Alves Filho EG, Silva LMA, Silva EO, Rita de Cássia AP, Canuto KM (2020) NIR and 1H qNMR methods coupled to chemometrics discriminate the chemotypes of the gastroprotective herb Egletes viscosa. Food Res Int 138:109759
Chen X, Li N, LeleYang Liu J, Chen J, Liu H (2014) Expression of collagen I, collagen III and MMP-1 on the tension side of distracted tooth using periodontal ligament distraction osteogenesis in beagle dogs. Ach Oral Biol 59:1217–1225. https://doi.org/:10.1016/j.archoralbio.2014.07.011
Conti LC, Segura-Egea JJ, Cardoso CBM, Benetti F, Azuma MM, Oliveira PHC, Bomfim SRM, Cintra LTA (2020) Relationship between apical periodontitis and atherosclerosis in rats: lipid profile and histological study. Int Endod J 53:1387–1397. https://doi:10.1111/iej.13350
Devi A, Dwibedi V, Khan ZA (2021) Natural Antioxidants in New Age-Related Diseases. Rev Bras Farmacogn 31:387–407. https://doi.org/10.1007/s43450-021-00175-0
Dye BA (2012) Global periodontal disease epidemiology. Periodontol. 2000. 58:10–25. https://doi:10.1111/j.1600-0757.2011.00413.x
Guedes MM, Cunha AN, Silveira ER, Rao VS (2002) Antinociceptive and gastroprotective effects of diterpenes from the flower buds of Egletes viscosa. Planta Med 68:1044–1046. https://doi:10.1055/s-2002-35664
Guimarães MV, Melo IM, Adriano Araújo VM, Tenazoa Wong DV, Roriz Fonteles CS, Moreira Leal LK, Ribeiro RA, Lima V (2016) Dry extract of Matricaria recutita L. (Chamomile) prevents ligature-induced alveolar bone resorption in rats via inhibition of tumor necrosis factor-α and interleukin-1β. J Periodontol 87:706–715. https://doi:10.1902/jop.2016.150411
Hanwell MD, Curtis DE, Lonie DC, Vandermeersch T, Zurek E, Hutchison GR (2012) Avogadro: an advanced semantic chemical editor, visualization, and analysis platform. J Cheminform 4:17. https://doi.org/10.1186/1758-2946-4-17
Könönen E, Gursoy M, Gursoy UK (2019) Periodontitis: A multifaceted disease of tooth-supporting tissues. J Clin Med 8:1135. https://doi:10.3390/jcm8081135
Kuhr A, Popa-Wagner A, Schmoll H, Schwahn C, Kocher T (2004) Observations on experimental marginal periodontitis in rats. J Periodontal Res 39:101–106. htts://doi.org/
Kwon T, Lamster IB, Levin L (2021) Current concepts in the management of periodontitis. Int Dent J 71:462–476. https://doi.org/10.1111/idj.12630
Lee CY, Chang CH, Teng NC, Chang HM, Huang WT, Huang YK (2019) Associations between the phenotype and genotype of MnSOD and catalase in periodontal disease. BMC Oral Health. https://doi.org/10.1186/s12903-019-0877-3
Lipinski CA, Lombardo F, Dominy BW, Feeney PJ (2001) Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Deliv Rev 46:3–26. https://doi.org/10.1016/s0169-409x(00)00129-0
Morris GM, Huey R, Lindstrom W, Sanner MF, Belew RK, Goodsell DS, Olson AJ (2009) AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility. J Comput Chem 30:2785–2791. https://doi.org/10.1002/jcc.21256
Rittié L (2017) Method for picrosirius red-polarization detection of collagen fibers in tissue sections. Methods Mol Biol 1627:395–407. https://doi:10.1007/978-1-4939-7113-8_26
Rodrigues CK, Zocolo GJ, Pereira RCA, Martins FICC, Ribeiro PRV, Brito ES, Silveira ER, Marques KC (2019) Development of a UPLC-ESI-MS method for simultaneous determination of flavonoids and diterpenes in Egletes viscosa (L.) Less herbal products. J Pharm Biomed Anal 166:155–163. https://doi:10.1016/j.jpba.2019.01.008
Safieh-Garabedian B, Poole S, Allchorne A, Winter J, Woolf CJ (1995) Contribution of interleukin-1 beta to the inflammation-induced increase in nerve growth factor levels and inflammatory hyperalgesia. Br J Pharmacol 115:1265–1275. https://doi.org/10.1111/j.1476-5381.1995.tb15035.x
Salentin S, Schreiber S, Haupt VJ, Adasme MF, Schroeder M (2015) PLIP: fully automated protein-ligand interaction profiler. Nucleic Acids Res 43:443–447. https://doi.org/10.1093/nar/gkv315
Sima C, Aboodi GM, Lakschevitz FS, Sun C, Goldberg MB, Glogauer M (2016) Nuclear factor erythroid 2-related factor 2 down-regulation in oral neutrophils is associated with periodontal oxidative damage and severe chronic periodontitis. Am J Pathol 186:1417–1426. https://doi.org/10.1016/j.ajpath.2016.01.013
Souza MF, Rao VS, Silveira ER (1997) Inhibition of lipid peroxidation by ternatin, a tetramethoxyflavone from Egletes viscosa L. Phytomedicine 4:27–31. https://doi.org/10.1016/S0944-7113(97)80024-4
Torequl Islam M, Quispe C, Herrera-Bravo J, Rahaman MM, Hossain R, Sarkar C, Raihan MA, Chowdhury MM, Uddin SJ, Shilpi JA, Sousa MC, Melo-Cavalcante AAC, Mubarak MS, Sharifi-Rad J, Calina D (2022) Activities and molecular mechanisms of diterpenes, diterpenoids, and their derivatives in rheumatoid arthritis. Evid Based Complement Alternat Med 25:4787643. https://doi.org/10.1155/2022/4787643
Trott O, Olson AJ (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31:455–461. https://doi.org/10.1002/jcc.21334
Verma R, Bhatia R, Singh G, Kumar B, Mehan S, Monga V (2020) Design, synthesis and neuropharmacological evaluation of new 2,4-disubstituted-1,5-benzodiazepines as CNS active agents. Bioor Chem 101:104010. https://doi.org/10.1016/j.bioorg.2020.104010
Xie Z, Yu H, Sun X, Tang P, Jie Z, Chen S, Wang J, Qin A, Fan S (2018) A novel diterpenoid suppresses osteoclastogenesis and promotes osteogenesis by inhibiting Ifrd1-mediated and IκBα-mediated p65 nuclear translocation. J Bone Min Res 33:667–678. https://doi.org/10.1002/jbmr.3334
Yan A, Wang Z, Cai Z (2008) Prediction of human intestinal absorption by GA feature selection and support vector machine regression. Int J Mol Sci 10:1961–1976. https://doi.org/10.3390/ijms9101961

deSousaetalGraphicalAbstract.tif

Download PDF

Reviewers invited by journal
19 Jul, 2024
Editor invited by journal
10 Jul, 2024
Editor assigned by journal
01 Jul, 2024
First submitted to journal
01 Jul, 2024

You are reading this latest preprint version

Exploring the Toxicity and Antiresorptive Activity of a Diterpene from Egletes viscosa (L.) less. in Mice: in silico and in vivo Studies

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods