Expression of genes involved in insulin metabolism in subcutaneous adipose tissue of pregnant women with and without polycystic ovary syndrome (PCOS)

doi:10.21203/rs.3.rs-4670310/v1

Download PDF

Research Article

Expression of genes involved in insulin metabolism in subcutaneous adipose tissue of pregnant women with and without polycystic ovary syndrome (PCOS)

https://doi.org/10.21203/rs.3.rs-4670310/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

The qualitative analysis of adipose tissue (AT) is an exciting area for research and clinical applications in several diseases and it is emerging along with the approach to research on women with polycystic ovary syndrome (PCOS). PCOS is a common disorder in women of reproductive age, which is associated with dysfunction of AT. The aim of study was comparing the expression of genes involved in insulin metabolism in the subcutaneous adipose tissue (SAT) of pregnant women with and without PCOS.

Methods

In a case-control study, after cesarean section, SAT was taken from two groups of women with PCOS (n = 12) and without PCOS (non-PCOS;n = 24) (2:1 ratio control: case). Then the relative expression of Insulin receptor substrate 1 and 2 (IRS1, IRS2), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) and phosphatidylinositol-4, 5-bisphosphate3-kinasecatalytic subunit alpha (PIK3CA) were measured using Real-time qPCR.

Results

No significant difference was observed in terms of age, pre-pregnancy BMI and BMI on the day of delivery between PCOS and non-PCOS groups. The mRNA levels of IRS1, IRS2, PIK3R1 and PIK3CA in the SAT of pregnant women with PCOS showed a significant decrease compared to non-PCOS pregnant women (P < 0.0001).

Conclusion

This is the first study in humans that investigated gene expression involved in insulin metabolism in subcutaneous AT of pregnant women with and without PCOS. Overall, dramatically decrease in mRNA abundance of IRS1, IRS2, PIK3R1 and PIK3CA in age and BMI-matched case and control groups, proposing the possible central role of AT for insulin metabolism in women suffering from PCOS during pregnancy and around parturition. Given that mRNA may not be directly proportional to the expression level of the proteins, further studies are warranted to elucidate the protein expression of selected factors in response to PCOS in pregnant women with PCOS.

Trial registration:

not applicable

Polycystic ovary syndrome

Subcutaneous Adipose tissue

Pregnancy

insulin metabolism

Polycystic ovary syndrome (PCOS) is a common female endocrine disorder characterized by hyperandrogenism, ovulation disorders, and morphological changes in polycystic ovaries [1]. Due to the imbalance of sex hormones, the ovules are released immaturely or with an inappropriate shape [2]. It has been shown that about 6 to 15 percent of women in reproductive age suffer from this condition, [3] that 70 to 80 percent of them meet pregnancy problems [4]. PCOS can cause individual problems such as body hair growth, fertility problems, emotional disorders and obesity problems. In addition, spontaneous abortions, gestational diabetes (GD), high blood pressure (HBP), and fetal complications such as low birth weight (LBW), special care after birth have also been reported [5–7]. Additionally, pregnant women with PCOS are three times more likely to develop GD [8–10]. Although the importance of insulin metabolism in women with PCOS has been reported, limited data exist on the effective role of AT in pregnant women suffering from PCOS.

Although the main etiology of PCOS is still unknown [11], various genetic, metabolic, endocrine and environmental abnormalities affect PCOS [12]. Clinically, hyperandrogenism by hypothalamic-pituitary-ovarian axis disorder is the main cause of infertility and metabolic abnormalities caused by PCOS. Furthermore, Insulin secretion and Insulin resistance (IR) play a role in the development of PCOS [13]. While induction of IR occurs in the second and third trimesters of normal pregnancy as a physiological adaptation [14–16], in pregnant women with PCOS - especially obese women - it is often more common and is recognized as an etiology [4]. In addition, recent studies have shown that IR is strongly related to the level of amino acids (AA) in follicular fluid (FF), which is influenced by plasma AA and their metabolism [17]. According to previous studies, the composition of FF is probably related to the developmental competence of oocytes [18]. Any changes in metabolic processes caused by IR will also change the composition of AA in FF, which may also change the metabolism of oocytes. This can affect egg quality and fertility [19].

The phosphatidyl 3-kinase (PI3K) pathway has been shown to be the insulin signaling pathway [20], and the genes of phosphatidylinositol-4,5-bisphosphate3-kinasecatalytic subunit alpha (PIK3CA), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1), Insulin receptor substrate 1 (IRS1), and 2 (IRS2) are involved [21]. PI3K consists of a protein heterodimer consisting of a p110α catalytic subunit, encoded by PIK3CA [21], and a p85α regulatory subunit, encoded by PIK3R1 [22–24]. PIK3R1 encodes P85a subunit and inhibits P110a catalytic activity [25]. The role of PIK3CA and PIK3R1 is to phosphorylate phosphatidyl-inositol-4, 5-bisphosphate (PIP2) to generate phosphatidyl-3, 4, 5-triphosphate (PIP3) to activate pathways such as PI3K [26]. Studies showed that the mutation in the PIK3R1 gene leads to a decrease in PI3K activity, severe IR and physical defects in the body [27]. In addition, IRS1 acts as an adapter protein for insulin signaling [28, 29]. The most common variant is IRS1Gly972Arg, which is associated with IR, PCOS and type 2 diabetes (T2DM) [30, 31]. IRS1 deficiency disrupts the classical insulin signaling pathway, which is critically important in IR and blood glucose homeostasis [32]. The IRS2 gene is a cytoplasmic signal and encodes IRS2. The IRS2 Gly1057Asp, the most common variant, affects IR and T2DM in women with PCOS [30, 31]. While the overall similarity of the amino acid sequence between IRS1 and IRS2 is only 43%, they share structural and functional features. Therefore, it is possible that IRS2 can compensate for the defect in the insulin signaling pathway in IRS1 deficiency [33].

In the insulin signaling process, insulin binds to its receptor α subunit on the outside of the cell. PIP3 is produced by the activation of tyrosine kinase in the beta subunit inside the cell [34, 35] that leads to glucose absorption and glycogen synthesis [36]. PI3K is an important signal integrator essential for controlling insulin sensitivity and inducing an inflammatory response in adipose tissue (AT), and its pathway selectively affects the metabolic pathways in the insulin and ovary target tissues [8, 37]. In PCOS, there is a post-junction defect in insulin receptor signaling [8].

Since the studied are connected through PI3K, the communication and role of each one is very important in the pregnancy process of PCOS women, especially in the subcutaneous adipose tissue (SAT). SAT is a type of adipose tissue in adult humans, which has important differences from visceral adipose tissue (VAT) in terms of metabolism and function [38]. Effective roles of SAT and VAT in Steroids metabolism as well as insulin regulation were reported [39]. Meanwhile, Abdominal SAT is approximately twice as much as VAT, which may indicate a relationship between SAT and insulin sensitivity due to the greater volume of subcutaneous fat mass[40]. However, in the study of Rancourt et al., no difference was observed in terms of the expression of insulin pathway genes between the gestational diabetes (GD) and non-GD women [22]., [40]. In addition, few studies have investigated the expression of genes involved in insulin metabolism in AT of women with PCOS (20, 32).

There is limited information in the field of insulin metabolism in AT, particularly SAT in pregnant women. Taking into account, the observation that SAT has effective roles in insulin metabolism, this prompted us to explore whether differences in genes involved in insulin metabolism relative expression and could partly explain this issue in pregnant women with PCOS.

Therefore, due to the increasing prevalence of PCOS and the importance of maternal and fetal health, the study aimed to compare the expression of four genes (IRS1, IRS2, PIK3R1, and PIK3CA) in the SAT of pregnant women with and without PCOS.

Patients and AT samples collection

The present case-control study was conducted in 2022–2023 in the Royan Institute, Tehran, Iran. Sample and data collection as well as all experiment procedures used were confirmed by the Ethics Committee of Royan Institute, Tehran, Iran (IR.ACECR.ROYAN.REC.1402.015).

After obtaining written consent from 12 women with PCOS (case group) and 24 non-PCOS women (control group), 36 samples of abdominal SAT were collected at the cesarean section. PCOS diagnosis was reported by the medical practitioners affiliated to Tehran University of Medical Science, Tehran, Iran. PCOS cases were selected if they had two of the three characteristics - Polycystic ovary syndrome in ultrasound, oligomenorrhea or amenorrhea and clinical or laboratory signs of hyperandrogenism - based on the Rotterdam criteria [41].

During cesarean section, snap-freezing was performed on a piece of sample of abdominal SAT in both PCOS and non-PCOS groups. SAT samples were directly immersed in liquid nitrogen, and after one minute removed and transferred to Cryovials. Then, the Cryo vial was kept in liquid nitrogen (-196°C) until the analysis. The exclusion criteria included history of diabetes type 1, diabetes mellitus, gestational diabetes, chronic kidney disease, any type of chronic metabolic diseases, endometriosis, consumption of any medication affecting glucose and lipid metabolism, alcoholism, and smoking [41].

RNA extraction, cDNA synthesis and quantitative reverse-transcription polymerase chain reaction procedures

Based on the study of Rancourt et al. in 2019 [22], the target genes were selected and primer design was done using Perl Primer and Primer-BLAST software. Gene Runner software was used to confirm the quality of premiers designed for targeted and house-keeping genes (Table 1).

Table 1

The sequence of forward (F) and reverse (R) primers and the length of each gene product
Name of gene	Primer sequence	Length of PCR product (pair of base)
PIK3R1	F: AGCAAGACTGTTAGCCCTCAAA	99
PIK3R1	R: AGAGACGCAGACTAAAACCAGG	99
PIK3CA	F: TGTGGGACTTATTGAGGTGGTG	102
PIK3CA	R: TGTAGTGTGTGGCTGTTGAACT	102
IRS1	F: TTAGTCCATCACACAAGGAGGC	107
IRS1	R: CTTCCACCCATTCTTCTTCCCA	107
IRS2	F: GACTTCTTGTCCCACCACTTGA	172
IRS2	R: ACACAGTCATTGCTCAGATCCA	172
BETAACTIN	F: CAAGATCATTGCTCCTCCTG	90
BETAACTIN	R: ATCCACATCTGCTGGAAGG	90

Total mRNA was extracted from 100 mg of SAT samples using Kyazol. Nano Drop device (NANODROP2000, Thermo Scientific, Germany) was used to measure the concentration of extracted RNA, DNA and protein. The 1% agarose gels (KBC Company, Iran) were used to measure the quality of extracted RNA. Then, cDNA was made using the cDNA synthesis kit (SMO BIO Company, Korea) from 2000 ng/per-macro liter of RNA and according to the instructions of the manufacturer.

Complementary DNA was obtained by using random Hexamer primers or Oligo (dT) and reverse transcription technique. This cDNA was used to quantify the mRNA levels of ERK, Kcnd2 and Gria2 genes. Real time-PCR method (ABI model, Applied Biosystem, USA) was used to evaluate the quality of synthesized cDNAs and to quantitatively check gene expression.

BETAACTIN housekeeping gene and fluorescent dye SYBR green PCR master (ampliqion, Denmark) were used to equalize mRNA levels [42]. Other qRT-PCR steps were performed according to the manufacturer's instructions and schedule. The desired genes were evaluated by comparing the gene expression levels in case and control groups. Data analysis was performed by the comparative 2− (ΔΔCT) method.

Statistical analysis

Data were initially tested for normal distribution using Kolmogorov–Smirnov test (UNIVARIATE procedure).

All analyses were conducted in SPSS. Quantitative values were expressed as mean ± SEM. Data with normal distribution were analyzed using t-test. Differences were considered significant at P ≤ 0.05 level.

There was no significant difference in terms of age (p = 0.8221) and Body Mass Index (BMI) before pregnancy (p = 0.9898) and on the delivery day (p = 0.7837), between 24 non-PCOS pregnant women and 12 PCOS pregnant women. (Table 2).

Figure 1 shows the result of the T-Test comparing the gene expression of four genes IRS1, IRS2, PIK3R1 and PIK3CA between PCOS and non-PCOS groups. The expression of all genes in the PCOS group showed a significant decrease compared to the control group.

Table 2

Demographic characteristics of the patients in the case (PCOS; n = 12) and control (non-PCOS; n = 24) groups (mean ± sd)
	PCOS	Non-PCOS	P-value^*
Age (year)	31.67 ± 3.65	31.21 ± 6.48	0.8221
BMI before pregnancy (kgm − 2)	26.22 ± 6.11	26.19 ± 4.74	0.9898
BMI at delivery day (kgm − 2)	30.35 ± 5.52	30.87 ± 5.27	0.7837
^*Non-Dependent T-test, p ≤ 0.05

There is a growing body of evidence supporting the crucial roles of AT in IR and consequently insulin dysfunction [43]. However, the mechanisms behind this association are still unclear, particularly in AT of pregnant women with PCOS. The present study found dramatically decrease in mRNA abundance of key genes involved in insulin metabolism in SAT of pregnant women suffering from PCOS. Our experiment has a few constraints. Small sample size was the restriction of the current study for age- and BMI- matched women with PCOS. However, we worked on samples collected from 36 Iranian mothers (PCOS and non-PCOS), while former studies conducted on gene expression in AT samples of non-pregnant women with PCOS have similar or lower sample size or assessed few genes (Emami et al. [44]). It was attempted select subjects with similar BMI and age, with no metabolic disorders and with approximately healthy lifestyle. It would have been interesting to compare expressions across gestation as well as further studies with larger sample sizes which could confirm these results in pregnant women with PCOS alongside measured several hormone levels. Moreover, we did not have access to VAT to compare between VAT and SAT.

It has been suggested that PCOS is a complex endocrine and metabolic disorder in which various factors play a role in its pathogenesis. The insulin signaling pathway is one of the pathways that is considered in the pathogenesis of PCOS. The changes in the expression of IRS1, IRS2, PIK3R1 and PIK3CA genes, as factors in the insulin signaling pathway, can lead to IR in PCOS. During pregnancy of PCOS as a physiological state with extensive metabolic changes, it can significantly affect the mechanisms of the PI3K pathway and its signaling factors.

In the current study, all four genes were significantly decreased in pregnant women with PCOS. it was assumed that pregnancy, PCOS and IR resulting from these conditions and disruption in the process of glucose absorption cause a lower expression of IRS1 and IRS2 and as a result PI3K pathway disruption that the synergistic relationship between the expression of IRS1 and IRS2 genes and the PI3K pathway was mentioned by Li Men et al. [45]. Based on current study, that there is a synergistic relationship between IRS1 and IRS2 gene expression and the PI3K pathway in SAT of pregnant women with PCOS.

During pregnancy, many metabolic processes of the mother's body change to provide nutrients to the fetus and also to prepare the mother for the breastfeeding period. The AT expansion is an adaptive response to healthy pregnancy in women and may have a regulatory role [46]. At the end of the second trimester of pregnancy, the mother's fat reserves reach their peak due to the hyperplasia of fat cells and increasing of fat tissue lipogenesis [47]. In the middle of pregnancy, the body's metabolism shifts to a catabolic state, characterized by an increase in the circulation of fatty acids in AT and an increase in the level of lipolysis [47]. The increase in lipolysis may be caused by the increase in maternal IR [48]. Following placenta growth and rising progesterone hormone levels, placental factors are released in the blood of the pregnant women. This can predispose the pregnant women to GD and IR in pregnancy [49], so that the mother's blood glucose is available to the growing fetus as the main source of energy [50]. On the other hand, the expression of PIK3R1 has been shown to play an important role in helping insulin sensitivity in AT [37, 51]. Based on animal studies, mice with reduced expression of IRS1 and IRS2 showed resistance to insulin [52]. Furthermore, overexpression of IRS2 increases insulin signaling, and deletion of IRS1 leads to mild peripheral insulin resistance, which occurs mainly in skeletal muscle [51]. Altogether, these could be the possible reasons for the down-regulation of IRS1, IRS2, PIK3R1, and PIK3CA in pregnant women with PCOS.

This was expected; as we had initially hypothesized, that pregnancy might have effects on AT function in PCOS women. Few studies have investigated the expression of genes involved in insulin metabolism in PCOS, which was inconsistent with the current study [22, 34]. Xu et al. found differential expression of components of the main insulin signaling pathway in SAT was not the main factor in the pathogenesis of PCOS [34]. They pointed out that the expression of IRS1, IRS2, PIK3R1 and PIK3CA in the SAT of women with PCOS was not significantly different from the control group [34]. More attention should be given to participants of Xu et al. study who focused on non-pregnant women with PCOS. Based on previous studies, at the beginning of pregnancy, women start with different fat stores, therefore, the body's basal metabolism increases to compensate for the increased fat storage and accumulation. This variation in energy consumption and storage during pregnancy can create or inhibit different mechanisms in the body to receive energy and store it [53]. In this way, it is necessary to investigate the different roles of AT in metabolism in future studies.

Furthermore, in a previous study by Corbulid et al., insulin signaling was investigated in PCOS myotubes. The findings did not report any difference in the frequency of insulin receptor β subunit or tyrosine phosphorylation. However, increased abundance of IRS1 was observed in PCOS myotubes. When IRS1 abundance returned to normal, PI3K activity decreased in PCOS myotubes [54]. In this study, contrary to the current findings, no significant difference was observed in gene expression. Therefore, the pregnancy status may be the cause of the difference in these results.

The findings of the current study are true for subcutaneous abdominal fat, but may not be true for visceral adipose tissue. While subcutaneous abdominal fat significantly affects insulin activity throughout the body, there may be differences between insulin signaling gene expression in visceral adipose tissue and other insulin target tissues, such as skeletal muscle and liver [22]. In this regard, Rancourt et al. compared the expression of four genes (IRS1, IRS2, PIK3R1 and PIK3CA) in SAT versus VAT of pregnant women with GD versus non-GD. The expression of PIK3R1 in VAT was significantly decreased in GD women, but no significant difference was observed in SAT between the two groups [22]. Interestingly not only SAT plays a major role in obesity-related IR compared to VAT., but also, SAT is more responsive to insulin inhibition than VAT [55]. Furthermore, healthy subjects with a family history of type 2 diabetes have a higher SAT diameter compared to the BMI-matched control group, and SAT value seems to be independently associated with IR in different populations [56]. On the other hand, insulin binding to SAT fat cells decreased by more than 50% in the third trimester of pregnancy compared to the non-pregnant control group [57, 58].

In addition, one study showed lean women with PCOS may have a genetically limited ability to store excess fat in the SAT. This leads to a disturbance in body processes that is similar to in obese women. This process concerning fat storage can affect the pathophysiology of PCOS [59]. Thus, our data support the crucial roles of SAT in PCOS women and support the hypothesized that there is a relationship between SAT and IR, especially during pregnancy, which warrants future studies with pregnant women suffering from PCOS.

Finally, the similarity in age and BMI of case and control groups was an innovation of our study which proposing the possible central role of AT for insulin metabolism around parturition despite BMI. Therefore, there is a cross talk between PCOS and AT in pregnant women with PCOS that warrants further studies.

Ultimately, in order to generalize our research, the survey on mother with PCOS and offspring health is considered as a spectacular and emerging issue for clinic and basic. Uniquely, Katsigianni et al. [60] reported that children of mothers with PCOS have a higher risk of developing autism spectrum disorder. Therefore, further investigation of the insulin signaling pathway and the role of AT in the metabolism of glucose uptake in mothers with PCOS may help to understand side effects of mother PCOS on offspring health.

This is the first study that has investigated gene expression involved in IR in subcutaneous AT of age and BMI-matched pregnant women with and without PCOS. Genes involved in insulin metabolism (IRS1, IRS2, PIK3R1 and PIK3CA) are less expressed in the SAT of pregnant women with PCOS under the same conditions in terms of age and BMI. The decrease in the expression of the relevant genes confirms the existence of a disorder in insulin metabolism in pregnant women with PCOS, which can be the cause of insulin metabolism dysfunction in pregnant women with PCOS.

Amino Acids

adipose tissue

Follicular Fluid

Gestational diabetes

HBP

High Blood Pressure

IRS1

Insulin receptor substrate 1

IRS2

Insulin receptor substrate 2

PCOS

polycystic ovary syndrome

PIK3R1

Phosphoinositide-3-kinase regulatory subunit 1

PIK3CA

phosphatidylinositol-4, 5-bisphosphate3-kinase catalytic subunit alpha

SAT

Subcutaneous Adipose Tissue

LBW

Low Birth Weight

VAT

Visceral Adipose Tissue

Ethics approval and consent to participate

This study approved by the Ethics Committee of Royan Institute (IR.ACECR.ROYAN.REC.1402.015). The written informed consent was obtained from all participants before data collection.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests

Author’s information

¹Department of Genetics, Faculty of Advanced Science and Technology, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran

²Department of Embryology, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran

³Gyn-medicum, Center for ReproductiveMedicine, Göttingen, Germany

⁴Institute of Pharmacology and Toxicology, University Medical Center Göttingen, Göttingen, Germany

⁵Department of Endocrinology and Female Infertility, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran

⁶Department of Genetics, Reproductive Biomedicine Research Center, Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran

⁷Department of Gynecology & Obstetrics, University Hospitals Schleswig-Holstein, Campus Kiel, Kiel, Germany

⁸Department of Gynecology and Obstetrics, Tehran University of Medical Sciences, Tehran, Iran.

Funding

This MSc thesis was supported by the Royan Institute, Tehran, Iran, and Tehran Medical Sciences, Islamic Azad University, Tehran, Iran (Project code 401000224).

Author Contribution

SJ MSc. student, Main project contributor, Investigation, Data collection and analysis, Writing- Original draft preparation. PG Project advisor, Investigation, Methodology, Writing—review & editing. AA Methodology, project management, interpretation, writing- Original draft preparation, Writing and reviewing final version, Visualization. SA Methodology, PCR Methodology, Validation Writing- Original draft preparation. NE Methodology and participant’s selection, sample collection, Validation Writing- Original draft preparation. AM the Head of surgical team, Methodology and participants selection, Writing—review & editing. MS Methodology, Project management, Validation, Writing- Original draft preparation, Writing and reviewing final version, Visualization. AS Methodology, interpretation, and drafting and editing of the project and final manuscript. MH Projects supervisor, Validation, Investigation, Methodology, Writing—review & editing. All authors have read and approved the final manuscript.

Acknowledgement

We thank all participants who were involved in the present study. We also would like to extend our appreciation Royan Institute staffs, particularly Mr. Amin Izadi and Mrs. Rezvaneh cheraghi for their sincere contributions in all laboratory procedures and data analysis. Surgical teams in several hospitals are highly appreciated for their assistance in biopsy collection. AliReza Alizadeh Moghadam Masouleh was a research fellow at the gyn-medicum, Göttingen, Germany, and University Medical Center Göttingen, Göttingen, Germany at the time the research was done. He is the recipient of a Georg Forster Research Fellowship for experienced researchers, awarded by the Alexander von Humboldt Foundation (Bonn, Germany).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Kamalanathan S, Sahoo JP, Sathyapalan T. Pregnancy in polycystic ovary syndrome. Indian J Endocrinol Metabol. 2013;17(1):37–43.
Tatarchuk T, Tutchenko T, Burka O. Special considerations on hyperandrogenism and insulin resistance in nonobese polycystic ovaries syndrome. In Polycystic Ovary Syndrome-Functional Investigation and Clinical Application. 2022.
Grześk-Kaczyńska M, Ostrowska M, Pałac D, Kaczyński S. Polycystic ovary syndrome and pregnancy-review. J Educ Health Sport. 2022;12(6):221–8.
Shang Y, Zhou H, Hu M, Feng H. Journal of Clinical Endocrinology & Metabolism. Effect of diet on insulin resistance in polycystic ovary syndrome. 2020;105(10):3346-60.
Yang ST, Liu CH, Ma SH, Chang WH, Chen YJ, Lee WL, Wang PH. Association between pre-pregnancy overweightness/obesity and pregnancy outcomes in women with polycystic ovary syndrome: a systematic review and meta-analysis. Int J Environ Res Public Health. 2022;19(15):9094.
Navid B, Mohammadi M, Sasannejad R, Dehkordi MA, Maroufizadeh S, Hafezi M, Omani-Samani R. Marital satisfaction and social support in infertile women with and without polycystic ovary syndrome. Middle East Fertility Soc J. 2018;23(4):450–5.
Shalchian Z, Taheri S, Hafezi M, Shirvanizadeh F, Nasiri N. Eftekhari yazdi P. P-114 Abdominal obesity in Polycystic ovary syndrome patients can increase endometrial stromal cells decidualization. Hum Reprod. 2023;38:dead093–478.
Diamanti-Kandarakis E, Dunaif A. Insulin resistance and the polycystic ovary syndrome revisited: an update on mechanisms and implications. Endocr Rev. 2012;33(6):981–1030.
Huang ZH, Manickam B, Ryvkin V, Zhou XJ, Fantuzzi G, Mazzone T, Sam S. PCOS is associated with increased CD11c expression and crown-like structures in adipose tissue and increased central abdominal fat depots independent of obesity. J Clin Endocrinol Metabolism. 2013;98(1):E17–24.
Shirvanizadeh F, Eidi A, Hafezi M, Eftekhari-Yazdi P. Abdominal Obesity May Play a Significant Role in inflammation Exacerbation in Polycystic Ovary Syndrome Patients. JBRA Assist Reprod. 2023;27(4):682.
Abruzzese GA, Silva AF, Velazquez ME, Ferrer MJ, Motta AB. Hyperandrogenism and Polycystic ovary syndrome: Effects in pregnancy and offspring development. WIREs Mech disease. 2022;14(5):e1558.
Hajitarkhani S, Moini A, Hafezi M, Shahhoseini M, Alizadeh A. Differences in gene expression of enzymes involved in branched-chain amino acid metabolism of abdominal subcutaneous adipose tissue between pregnant women with and without PCOS. Taiwan J Obstet Gynecol. 2021;60(2):290–4.
Umayal B, Chandrasekharan NV, Wijesundera WS, Wijeyaratne CN. Polycystic ovary syndrome: Genetic contributions from the hypothalamic-pituitary-gonadal axis. Int Arch Endocrinol Clin Res. 2018;4(013):1–8.
Ott R, Melchior K, Stupin JH, Ziska T, Schellong K, Henrich W, Rancourt RC, Plagemann A. Reduced insulin receptor expression and altered DNA methylation in fat tissues and blood of women with GDM and offspring. J Clin Endocrinol Metabolism. 2019;104(1):137–49.
Zong HY, Wang EL, Han YM, Wang QJ, Wang JL, Wang Z. Effect of miR-29b on rats with gestational diabetes mellitus by targeting PI3K/Akt signal. Eur Rev Med Pharmacol Sci. 2019;23(6).
Franzago M, Fraticelli F, Stuppia L, Vitacolonna E. Nutrigenetics, epigenetics and gestational diabetes: consequences in mother and child. Epigenetics. 2019;14(3):215–35.
Sun S, He D, Luo C, Lin X, Wu J, Yin X, Jia C, Pan Q, Dong X, Zheng F, Li H. Metabolic syndrome and its components are associated with altered amino acid profile in Chinese han population. Front Endocrinol. 2022;12:795044.
Sinclair KD, Lunn LA, Kwong WY, Wonnacott K, Linforth RS, Craigon J. Amino acid and fatty acid composition of follicular fluid as predictors of in-vitro embryo development. Reprod Biomed Online. 2008;16(6):859–68.
Kurdi C, Lelovics V, Hesszenberger D, Lajtai A, Lakatos Á, Herczeg R, Gödöny K, Mauchart P, Várnagy Á, Kovács GL, Kőszegi T. Amino Acid Profiling of Follicular Fluid in Assisted Reproduction Reveals Important Roles of Several Amino Acids in Patients with Insulin Resistance. Int J Mol Sci. 2023;24(15):12458.
Højlund K. Metabolism and insulin signaling in common metabolic disorders and inherited insulin resistance. Dan Med J. 2014;61(7):B4890.
Karakas B, Bachman KE, Park BH. Mutation of the PIK3CA oncogene in human cancers. Br J Cancer. 2006;94(4):455–9.
Rancourt RC, Ott R, Schellong K, Melchior K, Ziska T, Henrich W, Plagemann A. Visceral adipose tissue alteration of PI3KR1 expression is associated with gestational diabetes but not promoter DNA methylation. Adipocyte. 2019;8(1):339–46.
Kwok A, Zvetkova I, Virtue S, Luijten I, Huang-Doran I, Tomlinson P, Bulger DA, West J, Murfitt S, Griffin J, Alam R. Truncation of Pik3r1 causes severe insulin resistance uncoupled from obesity and dyslipidaemia by increased energy expenditure. Mol Metabolism. 2020;40:101020.
McCurdy CE, Klemm DJ. Adipose tissue insulin sensitivity and macrophage recruitment: Does PI3K pick the pathway? Adipocyte. 2013;2(3):135–42.
Chen L, Yang L, Yao L, Kuang XY, Zuo WJ, Li S, Qiao F, Liu YR, Cao ZG, Zhou SL, Zhou XY. Characterization of PIK3CA and PIK3R1 somatic mutations in Chinese breast cancer patients. Nat Commun. 2018;9(1):1357.
Tharin Z, Richard C, Derangère V, Ilie A, Arnould L, Ghiringhelli F, Boidot R, Ladoire S. PIK3CA and PIK3R1 tumor mutational landscape in a pan-cancer patient cohort and its association with pathway activation and treatment efficacy. Sci Rep. 2023;13(1):4467.
Hamaguchi T, Hirota Y, Takeuchi T, Nakagawa Y, Matsuoka A, Matsumoto M, Awano H, Iijima K, Cha PC, Satake W, Toda T. Treatment of a case of severe insulin resistance as a result of a PIK 3R1 mutation with a sodium–glucose cotransporter 2 inhibitor. J diabetes Invest. 2018;9(5):1224–7.
Rashidi B, Azizy L, Najmeddin F, Azizi E. Prevalence of the insulin receptor substrate-1 (IRS-1) Gly972Arg and the insulin receptor substrate-2 (IRS-2) Gly1057Asp polymorphisms in PCOS patients and non-diabetic healthy women. J Assist Reprod Genet. 2012;29:195–201.
Martínez Báez A, Castro Romero I, Chihu Amparan L, Castañeda JR, Ayala G. The Insulin Receptor Substrate 2 Mediates the Action of Insulin on HeLa Cell Migration via the PI3K/Akt Signaling Pathway. Curr Issues Mol Biol. 2023;45(3):2296–308.
Ruan Y, Ma J, Xie X. Association of IRS-1 and IRS-2 genes polymorphisms with polycystic ovary syndrome: a meta-analysis. Endocr J. 2012;59(7):601–9.
Yan H, Yang W, Zhou F, Pan Q, Allred K, Allred C, Sun Y, Threadgill D, Dostal D, Tong C, Guo S. Estrogen protects cardiac function and energy metabolism in dilated cardiomyopathy induced by loss of cardiac IRS1 and IRS2. Circulation: Heart Failure. 2022;15(6):e008758.
Tang CY, Man XF, Guo Y, Tang HN, Tang J, Zhou CL, Tan SW, Wang M, Zhou HD. IRS-2 partially compensates for the insulin signal defects in IRS-1–/– mice mediated by miR-33. Mol Cells. 2017;40(2):123–32.
Barbour LA, Shao J, Qiao L, Pulawa LK, Jensen DR, Bartke A, Garrity M, Draznin B, Friedman JE. Human placental growth hormone causes severe insulin resistance in transgenic mice. Am J Obstet Gynecol. 2002;186(3):512–7.
Xu N, Geller DH, Jones MR, Funari VA, Azziz R, Goodarzi MO. Comprehensive assessment of expression of insulin signaling pathway components in subcutaneous adipose tissue of women with and without polycystic ovary syndrome. J Clin translational Endocrinol. 2015;2(3):99–104.
Kushi R, Hirota Y, Ogawa W. Insulin resistance and exaggerated insulin sensitivity triggered by single-gene mutations in the insulin signaling pathway. Diabetol Int. 2021;12(1):62–7.
Hopkins BD, Goncalves MD, Cantley LC. Insulin–PI3K signalling: an evolutionarily insulated metabolic driver of cancer. Nat Reviews Endocrinol. 2020;16(5):276–83.
McCurdy CE, Schenk S, Holliday MJ, Philp A, Houck JA, Patsouris D, MacLean PS, Majka SM, Klemm DJ, Friedman JE. Attenuated Pik3r1 expression prevents insulin resistance and adipose tissue macrophage accumulation in diet-induced obese mice. Diabetes. 2012;61(10):2495–505.
Ronquillo MD, Mellnyk A, Cárdenas-Rodríguez N, Martínez E, Comoto DA, Carmona-Aparicio L, Herrera NE, Lara E, Pereyra A, Floriano-Sánchez E. Different gene expression profiles in subcutaneous & visceral adipose tissues from Mexican patients with obesity. Indian J Med Res. 2019;149(5):616–26.
Li J, Papadopoulos V, Vihma V. Steroid biosynthesis in adipose tissue. Steroids. 2015;103:89–104.
Patel P, Abate N. Role of subcutaneous adipose tissue in the pathogenesis of insulin resistance. J Obes. 2013;2013(1):489187.
ESHRE TR, ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril. 2004;81(1):19–25.
Zhang WX, Fan J, Ma J, Rao YS, Zhang L, Yan YE. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue. Int J Mol Sci. 2016;17(6):968.
Ahmed B, Sultana R, Greene MW. Adipose tissue and insulin resistance in obese. Biomed Pharmacother. 2021;137:111315.
Emami N, Moini A, Yaghmaei P, Akbarinejad V, Shahhoseini M, Alizadeh A. Differences in expression of genes related to steroidgenesis in abdominal subcutaneous adipose tissue of pregnant women with and without PCOS; a case control study. BMC Pregnancy Childbirth. 2021;21:1–0.
Li CX, Men CD, Yang WH, Chen R, Zhu JH, Cheng ZP. Repressing IRS1/2 by NT157 inhibits the malignant behaviors of ovarian cancer through inactivating PI3K/AKT/mTOR pathway and inducing autophagy. Kaohsiung J Med Sci. 2023;39(4):377–89.
Mazaki-Tovi S, Vaisbuch E, Tarca AL, Kusanovic JP, Than NG, Chaiworapongsa T, Dong Z, Hassan SS, Romero R. Characterization of visceral and subcutaneous adipose tissue transcriptome and biological pathways in pregnant and non-pregnant women: evidence for pregnancy-related regional-specific differences in adipose tissue. PLoS ONE. 2015;10(12):e0143779.
Resi V, Basu S, Haghiac M, Presley L, Minium J, Kaufman B, Bernard S, Catalano P, Hauguel-de Mouzon S. Molecular inflammation and adipose tissue matrix remodeling precede physiological adaptations to pregnancy. Am J Physiology-Endocrinology Metabolism. 2012;303(7):E832–40.
Bjercke S, Dale PO, Tanbo T, Storeng R, Ertzeid G, Åbyholm T. Impact of insulin resistance on pregnancy complications and outcome in women with polycystic ovary syndrome. Gynecol Obstet Invest. 2003;54(2):94–8.
Lain KY, Catalano PM. Metabolic changes in pregnancy. Clin Obstet Gynecol. 2007;50(4):938–48.
Desoye G, Herrera E. Adipose tissue development and lipid metabolism in the human fetus: The 2020 perspective focusing on maternal diabetes and obesity. Prog Lipid Res. 2021;81:101082.
Tang CY, Man XF, Guo Y, Tang HN, Tang J, Zhou CL, Tan SW, Wang M, Zhou HD. IRS-2 partially compensates for the insulin signal defects in IRS-1–/– mice mediated by miR-33. Mol Cells. 2017;40(2):123–32.
Shaw LM. The insulin receptor substrate (IRS) proteins: at the intersection of metabolism and cancer. Cell Cycle. 2011;10(11):1750–6.
King JC. Physiology of pregnancy and nutrient metabolism. Am J Clin Nutr. 2000;71(5):S1218–25.
Corbould A, Kim YB, Youngren JF, Pender C, Kahn BB, Lee A, Dunaif A. Insulin resistance in the skeletal muscle of women with PCOS involves intrinsic and acquired defects in insulin signaling. Am J Physiology-Endocrinology Metabolism. 2005;288(5):E1047–54.
Trivett C, Lees ZJ, Freeman DJ. Adipose tissue function in healthy pregnancy, gestational diabetes mellitus and pre-eclampsia. Eur J Clin Nutr. 2021;75(12):1745–56.
McLaughlin T, Lamendola C, Coghlan N, Liu TC, Lerner K, Sherman A, Cushman SW. Subcutaneous adipose cell size and distribution: relationship to insulin resistance and body fat. Obesity. 2014;22(3):673–80.
Hjøllund E, Pedersen O, Espersen T, Klebe JG. Impaired insulin receptor binding and postbinding defects of adipocytes from normal and diabetic pregnant women. Diabetes. 1986;35(5):598–603.
Ciaraldi TP, Kettel M, El-Roiey A, Madar Z, Reichart D, Yen SS, Olefsky JM. Mechanisms of cellular insulin resistance in human pregnancy. Am J Obstet Gynecol. 1994;170(2):635–41.
Parker J, O’brien C, Hawrelak J, Gersh FL. Polycystic ovary syndrome: an evolutionary adaptation to lifestyle and the environment. Int J Environ Res Public Health. 2022;19(3):1336.
Katsigianni M, Karageorgiou V, Lambrinoudaki I, Siristatidis C. Maternal polycystic ovarian syndrome in autism spectrum disorder: a systematic review and meta-analysis. Mol Psychiatry. 2019;24(12):1787–97.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
22 Jul, 2024
Editor assigned by journal
22 Jul, 2024
Submission checks completed at journal
20 Jul, 2024
First submitted to journal
01 Jul, 2024

You are reading this latest preprint version

Expression of genes involved in insulin metabolism in subcutaneous adipose tissue of pregnant women with and without polycystic ovary syndrome (PCOS)

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Trial registration:

Figures

BACKGROUND

MATERIALS AND METHODS

Patients and AT samples collection

RNA extraction, cDNA synthesis and quantitative reverse-transcription polymerase chain reaction procedures

Statistical analysis

RESULTS

CONCLUSION

Abbreviations

Declarations

Competing interests

Author’s information

Funding

Author Contribution

Acknowledgement

Data availability

References

Additional Declarations

Status:

Version 1